Nucleic acid probe compositions for enriching, extracting and / or detecting variant target nucleic acids in sample

Abstract

The present invention provides a nucleic acid probe composition for enriching, extracting and / or detecting a variant target nucleic acid in a sample comprising the variant target nucleic acid and a reference target nucleic acid. The variant target nucleic acid and the reference target nucleic acid each comprise a nucleic acid chain segment having a 5'end, a 3 'end and a nucleic acid sequence. In addition to the nucleic acid sequence of the nucleic acid chain segment of the variant target nucleic acid comprising substitutions, insertions or deletions of 1 to 100 nucleotides relative to a reference target nucleic acid, the nucleic acid sequences of both are the same. The compositions comprise a capture probe comprising an oligonucleotide having 5'and 3 'ends, the oligonucleotide comprising a variant target domain and a 5' upstream foothold domain or a 3 'downstream foothold domain. The composition further comprises an enhancement probe comprising an oligonucleotide having 5'and 3 'termini, the oligonucleotide comprising a reference target domain and a 3' downstream or 5 'upstream foothold domain.

Description

Technical Field

[0001] The present invention relates to a nucleic acid probe composition for enriching, extracting and detecting variant target nucleic acids in a sample, and more particularly, to a nucleic acid probe composition comprising a capture probe and an enhancement probe. Background Art

[0002] Variations in nucleic acid sequences (including DNA and RNA) occur in the development of many diseases, so detecting nucleic acid sequence variants at the base pair resolution level is crucial for diagnosis and treatment. There are many technologies available to achieve this detection, including hybridization, polymerase chain reaction ("PCR"), isothermal amplification, and sequencing, which can be used alone or in combination. Although each of these technologies has its advantages, it also has its disadvantages. For example, PCR-based detection methods often lead to false positives and artificial mutations due to replication errors (slippage), while sequencing technology exhibits an inherent error rate of up to about 1.0% per nucleotide. This makes it very difficult to detect sequence variants, such as single nucleotide variants (especially rare mutations).

[0003] Competitive hybridization reactions can be used to detect nucleic acid sequence variants, for example, see Jeffreys et al., Genome Research 13:2316-2324 (2003). Jeffreys et al. (2003) reported a method for enriching mutant DNA, in which the presence of a competitive probe specific for the wild-type allele can improve the enrichment effect of mutant DNA.

[0004] Toehold-mediated strand displacement ("toehold displacement") and toehold exchange are competitive hybridization reactions that have been applied in a variety of ways to the detection of nucleic acid sequence variants. See, e.g., Zhang et al., Science 318: 1121-1125 (2007); Zhang et al., Journal of the American Chemical Society 131: 17303-17314 (2009); Zhang et al., Nature Chemistry 4: 208-214 (2012); Yu et al., RSC Advances 7: 40858-40865 (2017).

[0005] Toehold displacement refers to a newly entered nucleic acid chain that replaces the original chain in the nucleic acid double strand through competitive binding, thereby forming a more matching double-stranded structure with the complementary chain in the double strand. See, for example, Yurke et al., Nature 406:605-608 (2000); Yu et al. (2017). This process is based on the introduction of a chain with a unique toehold domain, which includes about 4 to 10 nucleotides, is complementary to the remaining chain, and is not present in the original chain. The toehold domain of the introduced chain binds to the remaining chain through the toehold, thereby forming an intermediate complex consisting of three chains. Subsequently, the branch migration of the invading chain causes the original chain to be displaced, ultimately forming a more matching double-stranded structure.

[0006] Toehold displacement is controlled by the Gibbs free energy of hybridization. The initial step of the incoming strand binding to the remaining strand through the toehold is endothermic and rate limiting. By adjusting the strength of the toehold domain, for example based on changing its length and / or G / C content, the rate of this step can be adjusted over a range of six orders of magnitude, thereby achieving kinetic control. The entire process is energetically favorable, and although the reverse reaction occurs, its rate can be up to six orders of magnitude slower.

[0007] Toehold exchange is similar to toehold replacement in terms of the incoming nucleic acid strand and the original strand, but the difference is that the incoming strand and the original strand each have a unique toehold domain that is not present in the other strand. Therefore, completing toehold exchange requires the incoming strand to bind to the remaining strand through its unique toehold and for the original strand to spontaneously dissociate from the remaining strand at its unique toehold. Toehold exchange has fast reaction kinetics and high specificity.

[0008] Toehold displacement probes and toehold exchange probes have been used in a variety of methods for detecting target nucleic acids (including variant target nucleic acids) that rely on the specificity of nucleic acid hybridization.

[0009] For example, a toehold replacement probe has been used to capture target DNA in a sample on a magnetic bead. See, for example, Fenati et al., International Journal of Nanotechnology 14:75-86 (2017); Kennedy-Darling et al., Chemistry and Biochemistry 15:2353-2356 (2014). According to these methods, a double-stranded toehold replacement probe is prepared in advance and is pre-fixed on the surface of a solid (such as a magnetic bead). After the target DNA in the sample contacts the toehold replacement probe, the target DNA replaces one strand of the double-stranded toehold replacement probe, and therefore, the target DNA is captured by the magnetic bead by toehold replacement.

[0010] Similarly, toehold exchange probes have also been used to detect the presence of variant target DNA in a sample. For example, see Yu et al. (2017); Zhou et al., Langmuir 34: 14811-14816 (2018); Wu et al., Biosensors and Bioelectronics 80: 175181 (2016). According to these methods, a double-stranded probe including a toehold exchange probe strand is prepared, and the variant target nucleic acid in the sample is contacted with the double-stranded probe to induce strand displacement. The release of the detection probe strand in the double-stranded probe is monitored as an indicator of the presence of the variant target nucleic acid in the sample.

[0011] Currently, detection of variant target nucleic acids still requires other methods. Summary of the invention

[0012] The present invention provides a nucleic acid probe composition for enriching, extracting and detecting variant target nucleic acids in a sample containing variant target nucleic acids and reference target nucleic acids. The variant target nucleic acid and the reference target nucleic acid each contain a nucleic acid chain segment having a 5' end, a 3' end and a nucleic acid sequence, and the nucleic acid sequences of the variant target nucleic acid chain segment are identical except that the nucleic acid sequence of the variant target nucleic acid chain segment contains a substitution, insertion or deletion of 1 to 100 nucleotides relative to the nucleic acid sequence of the reference target nucleic acid chain segment, or a combination thereof.

[0013] The composition comprises:

[0014] (a) a capture probe comprising a single-stranded oligonucleotide having a 5' end and a 3' end, the single-stranded oligonucleotide comprising a variant target domain, and either a 5' upstream toehold domain or a 3' downstream toehold domain adjacent to the variant target domain, but not both; and

[0015] (b) An enhancement probe comprising a single-stranded oligonucleotide having a 5' end and a 3' end, wherein the single-stranded oligonucleotide comprises a reference target domain, and either a 3' downstream toehold domain or a 5' upstream toehold domain adjacent to the reference target domain, but not both.

[0016] The nucleic acid sequence of the 5' upstream toehold domain is the reverse complementary sequence of the 3' subsequence of the nucleic acid sequence extending from the 3' end of the strand segment of the variant target nucleic acid or the reference target nucleic acid.

[0017] The nucleic acid sequence of the 3' downstream toehold domain is the reverse complementary sequence of the 5' subsequence of the nucleic acid sequence extending from the 5' end of the strand segment of the variant target nucleic acid or the reference target nucleic acid.

[0018] The nucleic acid sequence of the variant target domain is the reverse complementary sequence of the middle subsequence of the chain segment of the variant target nucleic acid, and the middle subsequence extends continuously between the 5' subsequence and the 3' subsequence of the chain segment of the variant target nucleic acid and contains nucleotide substitution, insertion or deletion or a combination thereof.

[0019] The nucleic acid sequence of the reference target domain is the reverse complementary sequence of the middle subsequence of the chain segment of the reference target nucleic acid, and the middle subsequence extends continuously between the 5' subsequence and the 3' subsequence of the chain segment of the reference target nucleic acid and does not contain nucleotide substitution, insertion or deletion or a combination thereof.

[0020] If the capture probe comprises the 5' upstream toehold domain, the enhancer probe comprises the 3' downstream toehold domain, and conversely, if the capture probe comprises the 3' downstream toehold domain, the enhancer probe comprises the 5' upstream toehold domain.

[0021] The nucleic acid sequences of the 5' upstream toehold domain and the 3' downstream toehold domain each comprise 2 to 100 nucleotides.

[0022] The composition does not require any other oligonucleotides complementary to the 5' subsequence, middle subsequence or 3' subsequence of the strand segment of the variant or reference target nucleic acid, and does not require any other nucleic acids complementary to the capture probe or the enhancer probe.

[0023] In some embodiments, the single-stranded oligonucleotide of the capture probe comprises one or more of DNA, RNA, locked nucleic acids, or peptide nucleic acids, or a combination thereof; the single-stranded oligonucleotide of the enhancement probe comprises one or more of DNA, RNA, locked nucleic acids, or peptide nucleic acids, or a combination thereof.

[0024] In some embodiments, the substitutions, insertions or deletions or a combination thereof comprise one or more of single-base substitutions, multiple-base substitutions, single-base insertions, multiple-base insertions, single-base deletions or multiple-base deletions.

[0025] In some embodiments, the composition further comprises a guanidinium salt. In some embodiments, the guanidinium salt comprises one or more of guanidine or guanidine derivatives, wherein the structure of the guanidine derivative is (R1R2N)(R3R4N)C=N-R5, wherein R1, R2, R3, R4 and R5 are each independently (i) hydrogen or (ii) a functional group containing 1 to 4 hydrogen-containing carbons, and the total number of carbon atoms in R1 to R5 is less than or equal to 15. Similarly, in some embodiments, the composition is an aqueous solution, and the guanidinium salt is present in the composition at a concentration of 0.05 to 8M.

[0026] In some embodiments, the nucleic acid sequence of the strand segment of the variant target nucleic acid or the reference target nucleic acid each comprises 15 to 400 nucleotides.

[0027] In some embodiments, the variant target domain and the reference target domain each comprise 1 to 200 nucleotides.

[0028] In some embodiments, the composition comprises only one capture probe specific for a single variant target nucleic acid and one enhancement probe specific for a single reference target nucleic acid.

[0029] In some embodiments, the composition comprises a plurality of capture probes, each capture probe being specific for a different variant target nucleic acid, and an enhancement probe being specific for a single reference target nucleic acid.

[0030] In some embodiments, the composition comprises a plurality of capture probes and a plurality of enhancement probes, wherein each capture probe is specific to a different variant target nucleic acid, and each enhancement probe is specific to a different reference target nucleic acid, wherein each reference target nucleic acid is a reference nucleic acid for one or more variant target nucleic acids.

[0031] In some embodiments, the composition does not comprise the variant target nucleic acid or the reference target nucleic acid.

[0032] In some embodiments, the composition comprises the one or more variant target nucleic acids and / or reference target nucleic acids.

[0033] In some embodiments, the capture probe comprises at least 6 pairs of adjacent matching nucleotides relative to the nucleic acid sequence of the chain segment of the variant target nucleic acid, and the enhancement probe comprises at least 6 pairs of adjacent matching nucleotides relative to the nucleic acid sequence of the chain segment of the reference target nucleic acid.

[0034] In some embodiments, the capture probes comprise only nucleotides that match the nucleic acid sequence of the strand segment of the variant target nucleic acid, and the booster probes comprise only nucleotides that match the nucleic acid sequence of the strand segment of the reference target nucleic acid.

[0035] In some embodiments, the composition does not comprise any other oligonucleotide complementary to the 5' subsequence, middle subsequence, or 3' subsequence of the stranded segment of the variant target nucleic acid or the reference target nucleic acid, and does not comprise any other nucleic acid complementary to the capture probe or the enhancer probe.

[0036] The present invention also provides a system for enriching, extracting and detecting variant target nucleic acids in a sample containing variant target nucleic acids and reference target nucleic acids. In the system, the variant target nucleic acid and the reference target nucleic acid each contain a nucleic acid chain segment having a 5' end, a 3' end and a nucleic acid sequence, and the nucleic acid sequences of the chain segments of the variant target nucleic acid and the reference target nucleic acid are identical except that the nucleic acid sequence of the variant target nucleic acid chain segment contains a substitution, insertion or deletion of 1 to 100 nucleotides relative to the nucleic acid sequence of the reference target nucleic acid chain segment, or a combination thereof.

[0037] The system comprises:

[0038] (a) the above composition; and

[0039] (b) A solid, on the surface of which the capture probe is immobilized.

[0040] The present invention also provides another system for enriching, extracting and detecting variant target nucleic acids in a sample containing variant target nucleic acids and reference target nucleic acids. In the system, the variant target nucleic acid and the reference target nucleic acid each contain a nucleic acid chain segment having a 5' end, a 3' end and a nucleic acid sequence, and the nucleic acid sequences of the chain segments of the variant target nucleic acid and the reference target nucleic acid are identical except that the nucleic acid sequence of the variant target nucleic acid chain segment contains a substitution, insertion or deletion of 1 to 100 nucleotides relative to the nucleic acid sequence of the reference target nucleic acid chain segment, or a combination thereof.

[0041] The system comprises:

[0042] (a) the above composition; and

[0043] (b) A solid.

[0044] The capture probe comprises at least one binding tag.

[0045] The solid comprises an extraction tag bound to the at least one binding tag.

[0046] The present invention also provides a method for enriching, extracting and detecting variant target nucleic acids in a sample containing variant target nucleic acids and reference target nucleic acids. The variant target nucleic acid and the reference target nucleic acid each contain a nucleic acid chain segment having a 5' end, a 3' end and a nucleic acid sequence, and the nucleic acid sequences of the chain segments of the variant target nucleic acid and the reference target nucleic acid are identical except that the nucleic acid sequence of the variant target nucleic acid chain segment contains a substitution, insertion or deletion of 1 to 100 nucleotides relative to the nucleic acid sequence of the reference target nucleic acid chain segment, or a combination thereof.

[0047] The method comprises the following steps:

[0048] (1) combining the sample, capture probe and enhancement probe to form a hybridization composition;

[0049] (2) incubating the hybridization composition at a certain temperature, at which the capture probe and the variant target nucleic acid can form a hybrid, and the enhancement probe and the reference target nucleic acid can form a hybrid by toehold displacement and / or toehold exchange;

[0050] (3) separating the hybrid formed by the capture probe from the hybrid formed by the enhancement probe;

[0051] (4) eluting the variant target nucleic acid from the hybrid of the capture probe and the variant target nucleic acid; and

[0052] (5) Detecting the variant target nucleic acid.

[0053] The capture probe comprises a single-stranded oligonucleotide having a 5' end and a 3' end, wherein the single-stranded oligonucleotide comprises a variant target domain, and a 5' upstream toehold domain or a 3' downstream toehold domain adjacent to the variant target domain.

[0054] The enhancement probe comprises a single-stranded oligonucleotide having a 5' end and a 3' end, wherein the single-stranded oligonucleotide comprises a reference target domain, and a 3' downstream toehold domain or a 5' upstream toehold domain adjacent to the reference target domain.

[0055] The nucleic acid sequence of the 5' upstream toehold domain is the reverse complementary sequence of the 3' subsequence of the nucleic acid sequence extending from the 3' end of the strand segment of the variant target nucleic acid or the reference target nucleic acid.

[0056] The nucleic acid sequence of the 3' downstream toehold domain is the reverse complementary sequence of the 5' subsequence of the nucleic acid sequence extending from the 5' end of the strand segment of the variant target nucleic acid or the reference target nucleic acid.

[0057] The nucleic acid sequence of the variant target domain is the reverse complementary sequence of the middle subsequence of the chain segment of the variant target nucleic acid, and the middle subsequence extends continuously between the 5' subsequence and the 3' subsequence of the chain segment of the variant target nucleic acid, and comprises the substitution, insertion or deletion of the nucleotides or a combination thereof.

[0058] The nucleic acid sequence of the reference target domain is the reverse complementary sequence of the middle subsequence of the chain segment of the reference target nucleic acid, and the middle subsequence extends continuously between the 5' subsequence and the 3' subsequence of the chain segment of the reference target nucleic acid and does not contain the substitution, insertion or deletion or a combination thereof.

[0059] If the capture probe comprises the 5' upstream toehold domain, the enhancer probe comprises the 3' downstream toehold domain, and conversely, if the capture probe comprises the 3' downstream toehold domain, the enhancer probe comprises the 5' upstream toehold domain.

[0060] The nucleic acid sequences of the 5' upstream toehold domain and the 3' downstream toehold domain each comprise 2 to 100 nucleotides.

[0061] The hybridization composition does not require any other oligonucleotides complementary to the 5' subsequence, middle subsequence or 3' subsequence of the stranded segment of the variant or reference target nucleic acid, and does not require any other nucleic acids complementary to the capture probe or the enhancer probe.

[0062] In some embodiments, the method further comprises a step (0) before step (1), namely combining the sample and the capture probe to form an initial sample-capture probe composition.

[0063] In some embodiments, the method further comprises a step (0) before step (1), namely combining the sample and the enhancement probe to form an initial sample-enhancement probe composition.

[0064] In some embodiments, (i) the method further comprises a step (0) before step (1), i.e., fixing the capture probe on a solid surface; and (ii) step (3) comprises separating the hybrid formed by the capture probe from the hybrid formed by the enhancement probe by separating the solid from the hybridization composition.

[0065] In some embodiments, (i) the capture probe comprises at least one binding tag; and (ii) step (3) comprises separating the hybrid formed by the capture probe from the hybrid formed by the enhancement probe by contacting the hybridization solution with a solid comprising an extraction tag bound to the at least one binding tag, and then separating the solid from the hybridization composition.

[0066] In some embodiments, step (5) comprises detecting the variant target nucleic acid by a DNA analysis method, wherein the DNA analysis method comprises one or more of real-time PCR, microarray, fragment size analysis, Sanger sequencing, next generation sequencing or digital PCR or a combination thereof.

[0067] In some embodiments, the oligonucleotide of the capture probe comprises one or more of DNA, RNA, locked nucleic acid or peptide nucleic acid, or a combination thereof; the oligonucleotide of the enhancement probe comprises one or more of DNA, RNA, locked nucleic acid or peptide nucleic acid, or a combination thereof.

[0068] In some embodiments, the substitution, insertion or deletion comprises one or more of a single base substitution, a multiple base substitution, a single base insertion, a multiple base insertion, a single base deletion or a multiple base deletion.

[0069] In some embodiments, the hybridization solution further comprises a guanidinium salt. In some embodiments, the guanidinium salt comprises one or more of guanidine or guanidine derivatives, wherein the structure of the guanidine derivative is (R1R2N)(R3R4N)C=N-R5, wherein R1, R2, R3, R4 and R5 are each independently (i) hydrogen or (ii) a functional group containing 1 to 4 hydrogen-containing carbons, and the total number of carbons in R1 to R5 is less than or equal to 15. Similarly, in some embodiments, the guanidinium salt is present in the hybridization composition at a concentration of 0.05 to 8M.

[0070] In some embodiments, the nucleic acid sequence of the strand segment of the variant target nucleic acid or the reference target nucleic acid each comprises 15 to 400 nucleotides.

[0071] In some embodiments, the variant target domain and the reference target domain each comprise 1 to 200 nucleotides.

[0072] In some embodiments, the composition comprises only one capture probe specific for a single variant target nucleic acid and one enhancement probe specific for a single reference target nucleic acid.

[0073] In some embodiments, wherein the composition comprises a plurality of capture probes and an enhancement probe, each capture probe is specific for a different variant target nucleic acid, and the enhancement probe is specific for a single reference target nucleic acid.

[0074] In some embodiments, the composition comprises a plurality of capture probes and a plurality of enhancement probes, wherein each capture probe is specific to a different variant target nucleic acid, and each enhancement probe is specific to a different reference target nucleic acid, wherein each reference target nucleic acid is a reference nucleic acid for one or more variant target nucleic acids.

[0075] In some examples, the capture probe comprises at least 6 pairs of adjacent matching nucleotides relative to the nucleic acid sequence of the strand segment of the variant target nucleic acid, and the booster probe comprises at least 6 pairs of adjacent matching nucleotides relative to the nucleic acid sequence of the strand segment of the reference target nucleic acid.

[0076] In some examples, the capture probe contains only nucleotides that match the nucleic acid sequence of the strand segment of the variant target nucleic acid, and the booster probe contains only nucleotides that match the nucleic acid sequence of the strand segment of the reference target nucleic acid.

[0077] In some embodiments, the hybridization composition does not require any other oligonucleotides complementary to the 5' subsequence, middle subsequence, or 3' subsequence of the strand segment of the variant target nucleic acid or the reference target nucleic acid, and does not require any other nucleic acid complementary to the capture probe or the enhancer probe. BRIEF DESCRIPTION OF THE DRAWINGS

[0078] The various technical features and advantages of the present invention may be better understood by reading the following detailed description with reference to the accompanying drawings.

[0079] Figure 1 Schematic representation of variant target sequences of a capture probe comprising a 5' upstream toehold domain and a reference target sequence of an enhancer probe comprising a 3' downstream toehold domain.

[0080] Figure 2 Schematic representation of variant target sequences of a capture probe comprising a 3' downstream toehold domain and a reference target sequence of an enhancer probe comprising a 5' upstream toehold domain.

[0081] Figure 3 Exemplary sequences of capture probes, variant target nucleic acids, enhancement probes, and reference target nucleic acids are shown. Figure 3 In (A), the capture probe (SEQ ID NO: 25) preferentially hybridizes to the variant target nucleic acid (SEQ ID NO: 26) and includes a 3' downstream toehold domain, while the enhancement probe (SEQ ID NO: 27) preferentially hybridizes to the reference target nucleic acid (SEQ ID NO: 28) and includes a 5' upstream toehold domain. Figure 3 In (B), the capture probe (SEQ ID NO:29) preferentially hybridizes to the variant target nucleic acid (SEQ ID NO:26) and includes a 5' upstream toehold domain, while the enhancement probe (SEQ ID NO:30) preferentially hybridizes to the reference target nucleic acid (SEQ ID NO:28) and includes a 3' downstream toehold domain. Figure 3 (A) and Figure 3(B) In these two figures, the portions of the capture probe and the enhancement probe corresponding to the 5' upstream toehold domain or the 3' downstream toehold domain are shown in italics, the portions of the chain segments of the variant target nucleic acid or the reference target nucleic acid are shown underlined, the portions of the identical intermediate subsequences between the chain segments of the variant target nucleic acid or the reference target nucleic acid are shown underlined, and the portions of the different intermediate subsequences are shown in bold.

[0082] Figure 4 Shown is a schematic diagram of hybridization in a method for enriching, extracting and detecting a variant target nucleic acid in a sample comprising a variant target nucleic acid and a reference target nucleic acid. The method includes contacting a sample comprising a variant target nucleic acid and a reference target nucleic acid with a nucleic acid probe composition comprising a capture probe and an enhancement probe to hybridize, wherein some capture probes bind variant target nucleic acids, and other capture probes bind reference target nucleic acids. In the same manner, some enhancement probes bind variant target nucleic acids, and other enhancement probes bind reference target nucleic acids. Then, an excess of free capture probes can replace the enhancement probe in the hybrid formed between the variant target nucleic acid and the enhancement probe, because the hybrid formed between the capture probe and the variant target nucleic acid is more stable than the hybrid formed between the enhancement probe and the variant target nucleic acid. In the same manner, an excess of free enhancement probes can replace the capture probe in the hybrid formed between the reference target nucleic acid and the enhancement probe, because the hybrid formed between the enhancement probe and the reference target nucleic acid is more stable than the hybrid formed between the capture probe and the reference target nucleic acid.

[0083] Figure 5 The fragment analysis results are shown. Figure 5 (A) shows the results of fragment analysis of an artificial DNA sample containing 10% mutant A7 DNA directly amplified without enrichment. Figure 5 (B) Shows the fragment analysis results obtained when the mutant A7 allele was enriched using capture beads. Figure 5 (C) shows the results of enriching mutant A7 alleles from artificial DNA samples using capture beads in the presence of a competing probe. Figure 5 (D) shows the results of enriching mutant A7 alleles from artificial DNA samples using capture beads in the presence of the enhancer probe.

[0084] Figure 6 The sequencing results are shown below. Figure 6 (A) shows the results of direct sequencing of an artificially synthesized DNA sample containing 2% mutant Braf V600E DNA without enrichment. Figure 6 (B) shows the sequencing results after enrichment of mutant Braf V600E DNA from an artificial DNA sample containing 2% mutant Braf V600E DNA using capture beads in the presence of enhanced probes.

[0085] Figure 7 The sequencing results are shown below. Figure 7 (A) shows the results of direct sequencing of an artificial DNA sample containing the G12D mutation without enrichment. Figure 7 (B) shows the results of enrichment of mutant G12D DNA from an artificial DNA sample containing 0.5% mutant G12D DNA using capture beads containing all seven capture probes in the presence of booster probes. Figure 7 (C) shows the results of direct sequencing of an artificial DNA sample containing the G12C mutation without enrichment. Figure 7 (D) shows the results of enrichment of mutant G12C DNA from an artificial DNA sample containing 0.5% mutant G12C DNA when using capture beads containing all seven capture probes in the presence of booster probes. Figure 7 (E) shows the results of direct sequencing of an artificial DNA sample containing the G13D mutation without enrichment. Figure 7 (F) shows the results of enrichment of mutant G13D from an artificial DNA sample containing 0.5% mutant G13D DNA using capture beads containing all seven capture probes in the presence of booster probes.

[0086] Figure 8 Shown are the sequencing results generated when four different hybridization buffers were used. Figure 8 The results in (A), 8(B), 8(C), and 8(D) were obtained using 2M GuSCN, 500 mM NaCl, 10 mM MgCl2, or 5x PBS buffer, respectively.

[0087] Fig. 9 The sequencing results are shown below. Fig. 9 (A) shows the results of direct sequencing without enrichment of an artificial DNA sample containing 2% mutant Braf V600E DNA. Fig. 9 (B), 9(C) and 9(D) show the results of enriching mutant Braf V600E DNA from an artificial DNA sample containing 2% mutant Braf V600E DNA using nucleic acid probe compositions, systems and methods involving liquid phase hybridization when hybridization buffers of 2M GuSCN, 500mM NaCl and 10mM MgCl2 were used, respectively.

[0088] Fig.10 The sequencing results are shown below. Fig.10 (A) shows the results when the enhancer probe was not present, where mutation G12D was not detected. Fig.10 (B) shows the results when the booster probe was present, where mutation G12D was detected.

[0089] Fig.11 The sequencing results are shown below. Fig.11 The results of (A) were obtained by mixing the capture probe (magnetic beads) with an artificial DNA sample containing 0.5% mutant G12D DNA for 60 min for hybridization without an enhancement probe. Then, the capture magnetic beads were separated and washed. Finally, the extracted DNA was eluted from the magnetic beads and subjected to Sanger sequencing. Fig.11 The results of (B) were obtained by mixing the capture probe (magnetic beads) with an artificial DNA sample containing 0.5% mutant G12D DNA for 60 min for hybridization, then adding the enhancement probe to the mixture and incubating for another 30 min. Then, the capture magnetic beads were separated and washed. Finally, the extracted DNA was eluted from the magnetic beads and subjected to Sanger sequencing.

[0090] Fig.12 The sequencing results are shown below. Fig.12 (A) shows the sequencing results of DNA extracted from FFPE samples that were not enriched by toehold replacement / toehold exchange. Fig.12 (B) shows the sequencing results of DNA extracted from FFPE samples enriched by toehold replacement / toehold exchange.

[0091] Fig.13 The sequencing results are shown below. Fig.13 (A) shows the sequencing results of DNA extracted from serum samples that were not enriched by toehold replacement / toehold exchange. Fig.13 (B) shows the sequencing results of DNA extracted from serum samples enriched by toehold replacement / toehold exchange.

[0092] Fig.14 The sequencing results are shown below. Fig.14 (A), 14(B), and 14(C) show the expression of the capture probe when it contains a mismatched nucleotide T ( Fig.14 (A))、C( Fig.14 (B)) and G( Fig.14 (C)) results. Fig.14 (D) shows the results when both the capture probe and the enhancement probe contain three (3) mismatched nucleotides. Fig.14 (E) shows the results when both the capture probe and the enhancement probe contain five (5) mismatched nucleotides. DETAILED DESCRIPTION

[0093] The present invention provides a kind of nucleic acid probe composition, for enriching, extracting and detecting variant target nucleic acid in the sample comprising variant target nucleic acid and reference target nucleic acid.In the case of not wishing to be bound by theory, we believe that by using nucleic acid probe composition disclosed herein, system and method, the analytical sensitivity of detecting variant target nucleic acid in the sample comprising variant target nucleic acid and reference target nucleic acid can be significantly improved.This improvement can be achieved by the following method: design capture probe and enhancement probe to hybridize with variant target nucleic acid and reference target nucleic acid respectively, wherein capture probe includes 5' upstream or 3' downstream foothold domain, and enhancement probe includes 3' downstream or 5' upstream foothold domain, and the binding strength of capture probe to variant target nucleic acid chain segment middle subsequence is higher than its binding strength with reference target nucleic acid chain segment middle subsequence, and enhancement probe to reference target nucleic acid chain segment middle subsequence binding strength is higher than its binding strength with variant target nucleic acid chain segment middle subsequence, then use capture probe and enhancement probe to enrich variant target nucleic acid in sample, then carry out variant target nucleic acid detection.These nucleic acid probe compositions, systems and methods can also be used for specific capture variant target nucleic acid or reference target nucleic acid, but will not capture both at the same time.

[0094] Importantly, only about 10-fold enrichment of the variant target nucleic acid relative to the reference target nucleic acid is sufficient for mutation analysis in biologically relevant samples such as blood samples, because the concentration of the variant target nucleic acid in these samples is too low to be accurately or precisely detected by conventional amplification methods.

[0095] Replication errors associated with amplification are a major factor limiting the analytical sensitivity of tests for detecting variant target nucleic acids that are present in a sample at lower concentrations relative to a reference target nucleic acid. Replication errors can alter the DNA sequence of the amplification product, thereby hampering the identification of targets present at low concentrations.

[0096] For example, in a test performed according to the method of the present invention, both mutant DNA and wild-type DNA are present in the original source, and the concentration of mutant DNA is much lower than that of wild-type DNA. If mutant DNA and wild-type DNA are extracted together from the original source to produce a purified DNA sample containing both mutant DNA and wild-type DNA, and then the purified DNA sample is amplified to determine whether mutant DNA is present, when the replication error associated with amplification is greater than the ratio of the concentration of mutant DNA to the concentration of wild-type DNA, the analytical sensitivity is limited.

[0097] However, if the concentration of the mutant DNA before amplification is increased to a level where the concentration ratio of the mutant DNA to the wild-type DNA is greater than the level of the replication error without changing the original DNA sequence, the impact of the replication error on the sensitivity of the analysis can be minimized. This can be achieved by using the nucleic acid probe compositions, systems and methods provided by the present invention, because these compositions, systems and methods can be used for the mutant DNA of the enriched sample without changing the original DNA sequence.

[0098] To further illustrate the effects of the nucleic acid probe compositions, systems and methods of the present invention, assume that 0.2% of mutant DNA needs to be detected (i.e., the ratio of the concentration of mutant DNA to the concentration of wild-type DNA is 0.002), but the replication error of the detection is 1%, then the replication error of the detection is too high to accurately and precisely detect the mutant DNA. However, if the mutant DNA is enriched by about 10 times (i.e., the concentration of mutant DNA is increased from 0.2% to 2%) using the nucleic acid probe compositions, systems and methods of the present invention before amplification, the mutant DNA can be accurately and precisely detected because the mutant DNA concentration is 2% at this time, which is greater than the replication error of 1%.

[0099] refer to Figure 1-4 The variant target nucleic acid and the reference target nucleic acid in the sample, the variant target nucleic acid and the reference target nucleic acid each contain a nucleic acid chain segment having a 5' end, a 3' end and a nucleic acid sequence. The chain segment of the variant target nucleic acid or the reference target nucleic acid can be, for example, a sequence segment within a larger nucleic acid molecule in the sample. For example, the chain segment of the variant target nucleic acid or the reference target nucleic acid can be a subsequence in the DNA sequence of a gene, a plasmid, a viral genome and / or a chromosome. Therefore, the nucleic acid probe composition, system and method of the present invention can be used to detect sequence variants in discrete segments of much larger nucleic acids. In addition, the chain segment of the variant target nucleic acid or the reference target nucleic acid can be a sequence segment separated and different from other nucleic acid molecules in the sample. For example, the chain segment of the variant target nucleic acid or the reference target nucleic acid can be a DNA fragment separated and different from other nucleic acid molecules in the sample. Therefore, the nucleic acid probe composition, system and method of the present invention can also be used to detect sequence variants occurring in short nucleic acid segments, which have, for example, a sequence of 100-200 nucleotides, which can be single-stranded or double-stranded.

[0100] Unless otherwise specified, a target nucleic acid refers to either or both a variant target nucleic acid or a reference target nucleic acid.

[0101] In some examples, the nucleic acid sequences of the strand segments of the variant target nucleic acid or the reference target nucleic acid each comprise 15 to 400 nucleotides, 18 to 250 nucleotides, 19 to 160 nucleotides, 21 to 110 nucleotides, 22 to 70 nucleotides, or 24 to 45 nucleotides. Variant target nucleic acids designated as having a narrower range (e.g., 24 to 45 nucleotides) may be easier to detect than strand segments of a wider range (e.g., 15 to 400 nucleotides).

[0102] The nucleic acid sequences of the strand segments of the variant target nucleic acid and the reference target nucleic acid are identical except that the nucleic acid sequence of the variant target nucleic acid strand segment comprises a substitution, insertion or deletion of 1 to 100 nucleotides, or a combination thereof, relative to the nucleic acid sequence of the reference target nucleic acid strand segment.

[0103] In some embodiments, the substitution, insertion or deletion comprises one or more of a single base substitution, a multiple base substitution, a single base insertion, a multiple base insertion, a single base deletion or a multiple base deletion.

[0104] In some embodiments, the substitution, insertion or deletion involves 1 to 90 nucleotides, 1 to 80 nucleotides, 1 to 70 nucleotides, 1 to 60 nucleotides, 1 to 50 nucleotides, 1 to 40 nucleotides, 1 to 30 nucleotides, 1 to 20 nucleotides, 1 to 10 nucleotides, 1 to 9 nucleotides, 1 to 8 nucleotides, 1 to 7 nucleotides, 1 to 6 nucleotides, 1 to 5 nucleotides, 1 to 4 nucleotides, 1 to 3 nucleotides, or 1 or 2 nucleotides.

[0105] Consider in detail a composition comprising a capture probe comprising a single-stranded oligonucleotide having a 5' end and a 3' end, the single-stranded oligonucleotide comprising a variant target domain, and either a 5' upstream toehold domain or a 3' downstream toehold domain adjacent to the variant target domain, but not both. The oligonucleotide of the capture probe is a single-stranded oligonucleotide, as opposed to a double-stranded oligonucleotide. With respect to the variant target domain adjacent to the 5' upstream toehold domain or the 3' downstream toehold domain, this means that for a capture probe comprising a single-stranded oligonucleotide comprising a 5' upstream toehold domain, the 5' upstream toehold domain is immediately upstream of the variant target domain, such that the variant target domain is directly attached to the 5' upstream toehold domain without any other sequence intervening. Whereas for a capture probe comprising a single-stranded oligonucleotide comprising a 3' downstream toehold domain, the 3' upstream toehold domain is immediately downstream of the variant target domain, such that the variant target domain is directly attached to the 3' downstream toehold domain without any other sequence intervening.

[0106] The composition also includes an enhancement probe, which includes a single-stranded oligonucleotide having a 5' end and a 3' end, the single-stranded oligonucleotide including a reference target domain, and either a 3' downstream toehold domain or a 5' upstream toehold domain adjacent to the reference target domain, but not both. Similar to the capture probe, the oligonucleotide of the enhancement probe is a single-stranded oligonucleotide, as opposed to a double-stranded oligonucleotide. Similarly, similar to the capture probe, for the enhancement probe comprising a single-stranded oligonucleotide containing a 5' upstream toehold domain, the 5' upstream toehold domain is immediately upstream of the reference target domain, such that the reference target domain is directly attached to the 5' upstream toehold domain without any other sequence intervening. Similarly, for the enhancement probe comprising a single-stranded oligonucleotide containing a 3' downstream toehold domain, the 3' downstream toehold domain is immediately downstream of the reference target domain, such that the reference target domain is directly attached to the 3' downstream toehold domain without any other sequence intervening.

[0107] In some examples, the variant target domain and the reference target domain each comprise 1 to 200 nucleotides, 2 to 150 nucleotides, 3 to 80 nucleotides, 5 to 50 nucleotides, 10 to 30 nucleotides, or 16 to 25 nucleotides. Variant target domains and reference target domains designated within a narrower range (e.g., 16 to 25 nucleotides) may be more suitable for detection than variant target domains and reference target domains within a wider range (e.g., 1 to 200 nucleotides).

[0108] In some embodiments, the capture probe and enhancement probe each comprise 7 to 300 nucleotides, 13 to 200 nucleotides, 17 to 120 nucleotides, 18 to 80 nucleotides, 19 to 50 nucleotides, or 20 to 35 nucleotides. Capture probes and enhancement probes designated within a narrower range (e.g., 20 to 35 nucleotides) may be more suitable for detection than capture probes and enhancement probes within a broader range (e.g., 7 to 300 nucleotides).

[0109] The single-stranded oligonucleotides of the capture probes and the enhancement probes may comprise, for example, DNA, RNA, locked nucleic acid, or peptide nucleic acid, or a combination thereof.

[0110] In some embodiments, the single-stranded oligonucleotide of the capture probe comprises one or more of DNA, RNA, locked nucleic acid, or peptide nucleic acid, or a combination thereof; the single-stranded oligonucleotide of the enhancement probe comprises one or more of DNA, RNA, locked nucleic acid, or peptide nucleic acid, or a combination thereof.

[0111] The nucleic acid sequence of the 5' upstream toehold domain is the reverse complementary sequence of the 3' subsequence extending from the 3' end in the nucleic acid sequence of the strand segment of the variant target nucleic acid or the reference target nucleic acid. Similarly, the nucleic acid sequence of the 3' downstream toehold domain is the reverse complementary sequence of the 5' subsequence extending from the 5' end in the nucleic acid sequence of the strand segment of the variant target nucleic acid or the reference target nucleic acid.

[0112] The nucleic acid sequence of the variant target domain is the reverse complement of the middle subsequence of the strand segment of the variant target nucleic acid, which extends continuously between the 5' subsequence and the 3' subsequence of the strand segment of the variant target nucleic acid and contains substitutions, insertions or deletions or a combination thereof.

[0113] The nucleic acid sequence of the reference target domain is the reverse complement of the middle subsequence of the strand segment of the reference target nucleic acid, which extends continuously between the 5' subsequence and the 3' subsequence of the strand segment of the reference target nucleic acid and does not contain substitutions, insertions or deletions or a combination thereof.

[0114] In some examples, the reverse complementary sequence can be a nucleic acid sequence that contains one or more mismatched nucleotides at positions other than the position where the substitution, insertion, or deletion occurs and is not completely complementary to the corresponding sequence of the variant target nucleic acid or the reference target nucleic acid sequence.

[0115] In other examples, the reverse complement sequence can be a nucleic acid sequence that is completely complementary to the corresponding sequence of a variant target nucleic acid or a reference target nucleic acid sequence.

[0116] For example, in some instances, the capture probe containing mismatched nucleotides comprises at least 6 pairs of adjacent matched nucleotides relative to the nucleic acid sequence of the chain segment of the corresponding variant target nucleic acid. The following example explains how to count the adjacent matched nucleotide pairs in the sequence. Assume that in the CTGA sequence, C, T and A are matched nucleotides, and G is a mismatched nucleotide. This sequence has only one pair of adjacent matched nucleotides (CT). In contrast, if in the CTGA sequence, C, T and G are matched nucleotides, and A is a mismatched nucleotide, there are two pairs of adjacent matched nucleotides (CT and TG). For the capture probe, whether the number of adjacent matched nucleotides is sufficient depends on the form of the capture probe. For the capture probe comprising locked nucleic acid, as long as 6 adjacent matched nucleotides may be sufficient. For the capture probe comprising GC-rich DNA (e.g., DNA with 100% GC content), as long as 8 adjacent matched nucleotides may be sufficient. For the capture probe comprising AT-rich DNA (e.g., DNA with less than 50% GC content), as long as 16 adjacent matched nucleotides may be sufficient.

[0117] Likewise, in some examples, the booster probe containing mismatched nucleotides comprises at least 6 pairs of adjacent matched nucleotides relative to the nucleic acid sequence of the strand segment of the corresponding reference target nucleic acid.

[0118] Likewise, in some examples, the capture probe contains only nucleotides that match the nucleic acid sequence relative to the strand segment of the corresponding variant target nucleic acid.

[0119] Likewise, in some examples, booster probes contain only nucleotides that match the nucleic acid sequence relative to the strand segment of the corresponding reference target nucleic acid.

[0120] Thus, in some examples, the capture probe comprises at least 6 pairs of adjacent matched nucleotides relative to the nucleic acid sequence of the strand segment of the variant target nucleic acid, and the booster probe comprises at least 6 pairs of adjacent matched nucleotides relative to the nucleic acid sequence of the strand segment of the reference target nucleic acid.

[0121] Likewise, in some examples, the capture probes contain only nucleotides that match the nucleic acid sequence of the strand segment of the variant target nucleic acid, and the booster probes contain only nucleotides that match the nucleic acid sequence of the strand segment of the reference target nucleic acid.

[0122] Similar to the variant target domain and the reference target domain, in some examples, the middle subsequence of the chain segment of the variant target nucleic acid and the middle subsequence of the chain segment of the reference target nucleic acid each contain 1 to 200 nucleotides, 2 to 150 nucleotides, 3 to 80 nucleotides, 5 to 50 nucleotides, 10 to 30 nucleotides, or 16 to 25 nucleotides.

[0123] If the capture probe comprises a 5' upstream toehold domain, the enhancer probe comprises a 3' downstream toehold domain, and if the capture probe comprises a 3' downstream toehold domain, the enhancer probe comprises a 5' upstream toehold domain.

[0124] The nucleic acid sequences of the 5' upstream toehold domain and the 3' downstream toehold domain each contain 2 to 100 nucleotides. As described above, toehold replacement involves the introduced nucleic acid chain competing with the original chain of the nucleic acid double strand, thereby replacing the original chain and forming a more matching double strand with the remaining complementary chain in the double strand, which is based on the introduced chain with a unique toehold domain, which includes about 4 to 10 nucleotides, is complementary to the remaining chain, and is not present in the original chain. Similarly, as described above, toehold replacement is controlled by the Gibbs free energy of hybridization, and the initial step of the introduced chain binding to the remaining chain through the toehold is endothermic and rate-limiting step. By changing the strength of the toehold domain, for example, based on changing its length and / or G / C content, this step can be adjusted within a range of six orders of magnitude. Similarly, the hybridization of the 5' upstream toehold domain and the 3' downstream toehold domain (each comprising 2 to 100 nucleotides) to the 3' and 5' subsequences of the strand segment of their respective variant target nucleic acid or reference target nucleic acid can be adjusted by changing the strength of the toehold domain, for example, based on changing its length and / or G / C content. For example, a shorter toehold domain (e.g., a toehold domain comprising only 2, 3 or 4 nucleotides), if prepared using G and / or C bases, can obtain a stronger toehold domain than a toehold domain obtained with the same number of A and / or T bases.

[0125] In some examples, the 5' upstream toehold domain and the 3' downstream toehold domain each comprise 2 to 90 nucleotides, 2 to 80 nucleotides, 2 to 70 nucleotides, 2 to 60 nucleotides, 2 to 50 nucleotides, 2 to 40 nucleotides, 3 to 30 nucleotides, 3 to 20 nucleotides, 4 to 16 nucleotides, 4 to 14 nucleotides, or 4 to 10 nucleotides. Lengths specified within a narrower range (e.g., 4 to 10 nucleotides) may be more suitable for detection than 5' upstream toehold domains and 3' downstream toehold domains whose lengths are specified within a wider range (e.g., 2 to 90 nucleotides).

[0126] The capture probe and the enhancement probe must be designed so that the capture probe (particularly the variant target domain of the capture probe) binds more strongly to the middle subsequence of the chain segment of the variant target nucleic acid than to the middle subsequence of the chain segment of the reference target nucleic acid, and vice versa, the enhancement probe (particularly the reference target domain of the enhancement probe) binds more strongly to the middle subsequence of the chain segment of the reference target nucleic acid than to the middle subsequence of the chain segment of the variant target nucleic acid. This can be achieved by analyzing the specific sequence of the relevant variant target nucleic acid or the reference target nucleic acid sequence, and designing the capture probe and the enhancement probe so that they can selectively bind to the middle subsequence of the chain segment of the variant target nucleic acid or the reference target nucleic acid, respectively.

[0127] In some examples, the composition can be used to detect a single variant target nucleic acid in a sample comprising a variant target nucleic acid and a single reference target nucleic acid. According to these examples, the composition can include a capture probe and an enhancement probe. In these examples, a single capture probe includes a variant target domain, and its nucleic acid sequence is the reverse complementary sequence of the middle subsequence of the chain segment of a single variant target nucleic acid, and the middle subsequence includes a substitution, insertion or deletion or a combination thereof of a single variant target nucleic acid. Similarly, in these examples, a single enhancement probe includes a reference target domain, and its nucleic acid sequence is the reverse complementary sequence of the middle subsequence of the chain segment of a single reference target nucleic acid, and the middle subsequence does not include a substitution, insertion or deletion or a combination thereof. Therefore, in some examples, the composition includes only a capture probe and an enhancement probe, wherein the capture probe is specific to a single variant target nucleic acid, and the enhancement probe is specific to a single reference target nucleic acid.

[0128] In some examples, the composition can be used to detect multiple variant target nucleic acids in a sample comprising multiple variant target nucleic acids and a single reference target nucleic acid. According to these examples, the composition can include multiple capture probes, such as 2, 3, 4 or more capture probes, each capture probe is specific to different variant target nucleic acids, and a single enhancement probe specific to a single reference target nucleic acid, wherein the single reference target nucleic acid is a reference nucleic acid in each different variant target nucleic acid. Therefore, in some examples, the composition includes multiple capture probes and an enhancement probe, wherein the various capture probes are specific to different variant target nucleic acids, and the enhancement probe is specific to a single reference target nucleic acid.

[0129] In some instances, the composition can be used to detect multiple variant target nucleic acids in a sample comprising multiple variant target nucleic acids and multiple reference target nucleic acids. According to these examples, the composition can include a variety of capture probes, such as 2, 3, 4 or more capture probes, each capture probe has specificity to different variant target nucleic acids, and a variety of enhancement probes, such as 2, 3, 4 or more enhancement probes, each enhancement probe has specificity to different reference target nucleic acids, wherein each reference target nucleic acid is a reference nucleic acid of one or more variant target nucleic acids. Therefore, in some instances, the composition includes a variety of capture probes and a variety of enhancement probes, wherein each capture probe has specificity to different variant target nucleic acids, and each enhancement probe has specificity to different reference target nucleic acids.

[0130] The composition does not require any other oligonucleotides complementary to the 5' subsequence, the middle subsequence or the 3' subsequence of the chain segment of the variant target nucleic acid or the reference target nucleic acid, and does not require any other nucleic acid complementary to the capture probe or the enhancement probe. This means that the composition can be used for enrichment, extraction and detection of one or more variant target nucleic acids in a sample containing one or more variant target nucleic acids and one or more reference target nucleic acids, without requiring any oligonucleotides complementary to the 5' subsequence, the middle subsequence or the 3' subsequence of the chain segment of the one or more variant target nucleic acids or the reference target nucleic acid in addition to the one or more capture probes and the one or more enhancement probes. This also means that the composition can be used for enrichment, extraction and detection of one or more variant target nucleic acids in a sample containing one or more variant target nucleic acids and one or more reference target nucleic acids, without requiring any nucleic acid complementary to the one or more capture probes or the one or more enhancement probes in addition to the chain segment of the one or more variant target nucleic acids or the reference target nucleic acids. For example, in some instances, the composition does not include any other oligonucleotides complementary to the 5' subsequence, the middle subsequence or the 3' subsequence of the chain segment of the variant target nucleic acid or the reference target nucleic acid, and does not include any other nucleic acid complementary to the capture probe or the enhancement probe. This facilitates the simplification of the preparation and use of compositions for enriching, extracting, and detecting variant target nucleic acids in a sample comprising the variant target nucleic acids and a reference target nucleic acid, particularly relative to previous methods using toehold domains.

[0131] In some instances, the capture probe and / or the enhancement probe comprise a short nucleotide sequence at their respective 3' ends, and the sequence is not the reverse complementary sequence of their respective variant target nucleic acid or reference target nucleic acid. Adding this short nucleotide sequence at the 3' end of the capture probe and / or the enhancement probe can help prevent the capture probe and / or the enhancement probe from being extended by PCR, so that PCR can be used in these methods, improving the accuracy and precision of these methods. In some instances, the capture probe and the enhancement probe comprise the same short nucleotide sequence at their respective 3' ends. In some instances, the capture probe and the enhancement probe comprise different short nucleotide sequences at their respective 3' ends. In some instances, the short nucleotide sequence includes 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides. In some instances, the short nucleotide sequence is TTTT or AAAA.

[0132] Likewise, in some examples, the capture probe and / or enhancement probe comprises one or more nucleotides at their respective 3' ends that are modified to prevent the capture probe and / or enhancement probe from being extended by PCR.

[0133] In some instances, the composition further comprises a guanidinium salt. We have found that, compared with conventional nucleic acid hybridization buffers (including sodium chloride (NaCl), magnesium chloride (MgCl2) and / or phosphate buffered saline (PBS)) lacking guanidinium salts for nucleic acid hybridization, the addition of guanidinium salts to the composition significantly improves the enrichment, extraction and detection effects of variant target nucleic acids. Without wishing to be bound by theory, we believe that the presence of guanidinium salts such as guanidine isothiocyanate (GuSCN) improves the enrichment effect, thereby improving detection.

[0134] In some embodiments, the guanidine salt comprises one or more of guanidine or guanidine derivatives, wherein the structure of the guanidine derivative is (R1R2N)(R3R4N)C=N-R5, wherein R1, R2, R3, R4 and R5 are each independently (i) hydrogen or (ii) a functional group containing 1 to 4 hydrogen-containing carbons, and the total number of carbons in R1 to R5 is less than or equal to 15.

[0135] Likewise, in some embodiments, the composition is an aqueous solution, and the guanidinium salt is present in the composition at a concentration of 0.05 to 8 M. The guanidinium salt can be present in the composition, for example, at a concentration of 0.5 to 4 M, 1.0 to 3.0 M, or 1.5 to 2.5 M, 1.6 to 2.4 M, 1.7 to 2.3 M, 1.8 to 2.2 M, 1.9 to 2.1 M, or about 2.0 M.

[0136] Likewise, in some embodiments, the guanidinium salt comprises guanidine isothiocyanate at a concentration of 0.05 to 8M, 0.5 to 4M, 1.0 to 3.0M, or 1.5 to 2.5M, 1.6 to 2.4M, 1.7 to 2.3M, 1.8 to 2.2M, 1.9 to 2.1M, or about 2.0M.

[0137] In some instances, the composition does not include variant target nucleic acid or reference target nucleic acid. When preparing a composition for storage and future use, this is advantageous. In some instances, the composition includes one or more of variant target nucleic acid and / or reference target nucleic acid. For using the composition to enrich, extract and detect the variant target nucleic acid in a sample comprising variant target nucleic acid and reference target nucleic acid, this is advantageous.

[0138] The present invention also provides a system for enriching, extracting and detecting variant target nucleic acids in samples containing variant target nucleic acids and reference target nucleic acids. The variant target nucleic acid or the reference target nucleic acid each comprises a nucleic acid chain segment having a 5' end, a 3' end and a nucleic acid sequence, and the nucleic acid sequences of the chain segments of the variant target nucleic acid and the reference target nucleic acid are identical except that the nucleic acid sequence of the variant target nucleic acid chain segment comprises a substitution, insertion or deletion of 1 to 100 nucleotides relative to the nucleic acid sequence of the reference target nucleic acid chain segment, or a combination thereof.

[0139] The system comprises:

[0140] (a) a composition for enriching, extracting and detecting variant target nucleic acids in the above-mentioned sample; and

[0141] (b) A solid.

[0142] The capture probes are immobilized on the solid surface.

[0143] The present invention also discloses another system for enriching, extracting and detecting variant target nucleic acids in samples containing variant target nucleic acids and reference target nucleic acids. The variant target nucleic acid or the reference target nucleic acid each comprises a nucleic acid chain segment having a 5' end, a 3' end and a nucleic acid sequence, and the nucleic acid sequences of the chain segments of the variant target nucleic acid and the reference target nucleic acid are identical except that the nucleic acid sequence of the nucleic acid chain segment of the variant target nucleic acid comprises a substitution, insertion or deletion of 1 to 100 nucleotides relative to the nucleic acid sequence of the nucleic acid chain segment of the reference target nucleic acid.

[0144] System includes:

[0145] (a) a composition for enriching, extracting and detecting variant target nucleic acids in the above-mentioned sample; and

[0146] (b) A solid.

[0147] The capture probe comprises at least one binding tag.

[0148] The solid comprises an extraction tag associated with at least one binding tag.

[0149] The present invention also provides a method for enriching, extracting and detecting variant target nucleic acids in a sample containing variant target nucleic acids and reference target nucleic acids. The variant target nucleic acid or the reference target nucleic acid each comprises a nucleic acid chain segment having a 5' end, a 3' end and a nucleic acid sequence, and the nucleic acid sequence of the chain segment of the variant target nucleic acid is identical to that of the chain segment of the reference target nucleic acid except that the nucleic acid sequence of the chain segment of the variant target nucleic acid comprises a substitution, insertion or deletion of 1 to 100 nucleotides relative to the nucleic acid sequence of the chain segment of the reference target nucleic acid.

[0150] The method comprises the following steps:

[0151] (1) combining a sample, a capture probe, and an enhancement probe to form a hybridization composition;

[0152] (2) incubating the hybridization composition at a certain temperature, at which the capture probe and the variant target nucleic acid can form a hybrid, and the enhancement probe and the reference target nucleic acid can form a hybrid by toehold displacement and / or toehold exchange;

[0153] (3) separating the hybrids formed by the capture probe from the hybrids formed by the enhancement probe;

[0154] (4) eluting the variant target nucleic acid from the hybrid of the capture probe and the variant target nucleic acid; and

[0155] (5) Detecting variant target nucleic acids.

[0156] The capture probe comprises a single-stranded oligonucleotide having a 5' end and a 3' end and comprising a variant target domain and either a 5' upstream toehold domain or a 3' downstream toehold domain adjacent to the variant target domain, but not both.

[0157] The enhancer probe comprises a single stranded oligonucleotide having a 5' end and a 3' end and comprising a reference target domain and either a 3' downstream toehold domain or a 5' upstream toehold domain adjacent to the reference target domain, but not both.

[0158] The nucleic acid sequence of the 5' upstream toehold domain is the reverse complement of the 3' subsequence extending from the 3' end in the nucleic acid sequence of the strand segment of the variant target nucleic acid or the reference target nucleic acid.

[0159] The nucleic acid sequence of the 3' downstream toehold domain is the reverse complement of the 5' subsequence extending from the 5' end in the nucleic acid sequence of the strand segment of the variant target nucleic acid or the reference target nucleic acid.

[0160] The nucleic acid sequence of the variant target domain is the reverse complement of the middle subsequence of the strand segment of the variant target nucleic acid, which extends continuously between the 5' subsequence and the 3' subsequence of the strand segment of the variant target nucleic acid and contains substitutions, insertions or deletions or a combination thereof.

[0161] The nucleic acid sequence of the reference target domain is the reverse complement of the middle subsequence of the strand segment of the reference target nucleic acid, which extends continuously between the 5' subsequence and the 3' subsequence of the strand segment of the reference target nucleic acid and does not contain substitutions, insertions or deletions or a combination thereof.

[0162] If the capture probe comprises a 5' upstream toehold domain, the enhancer probe comprises a 3' downstream toehold domain, and if the capture probe comprises a 3' downstream toehold domain, the enhancer probe comprises a 5' upstream toehold domain.

[0163] The nucleic acid sequences of the 5' upstream toehold domain and the 3' downstream toehold domain each contain 2 to 100 nucleotides.

[0164] The hybridization composition does not require any other oligonucleotides complementary to the 5' subsequence, middle subsequence, or 3' subsequence of the stranded segment of the variant target nucleic acid or the reference target nucleic acid, and does not require any other nucleic acids complementary to the capture probe or the enhancer probe.

[0165] In some examples, the method further comprises a step (0) before step (1), namely combining the sample and the capture probe to form an initial sample-capture probe composition.

[0166] In some examples, the method further comprises a step (0) before step (1), namely combining the sample and the enhancement probe to form an initial sample-enhancement probe composition.

[0167] In some examples, (i) the method further comprises a step (0) prior to step (1), namely, fixing the capture probe on a solid surface; and (ii) step (3) comprises separating the hybrid formed by the capture probe from the hybrid formed by the enhancement probe by separating the solid from the hybridization composition.

[0168] The method includes step (2), incubating the hybridization composition at a certain temperature, at which the capture probe and the variant target nucleic acid can be promoted to form a hybrid, and the enhancement probe and the reference target nucleic acid can be promoted to form a hybrid by toehold replacement and / or toehold exchange. Due to the complementarity of the capture probe and the enhancement probe with both the variant target nucleic acid and the reference target nucleic acid, the capture probe and the enhancement probe can each form a hybrid with the variant target nucleic acid or the reference target nucleic acid. Step (2) relies on toehold replacement and / or toehold exchange to promote the formation of a hybrid between the capture probe and the variant target nucleic acid, and the formation of a hybrid between the enhancement probe and the reference target nucleic acid.

[0169] Likewise, the method includes step (3) of separating the hybrids formed by the capture probes from the hybrids formed by the enhancement probes. The separation process increases the ratio of the concentration of the hybrids formed by the capture probes to the concentration of the hybrids formed by the enhancement probes.

[0170] In some instances, (i) the capture probe comprises at least one binding tag; and (ii) step (3) comprises separating hybrids formed by the capture probe from hybrids formed by the enhancement probe by contacting the hybridization solution with a solid comprising an extraction tag that is bound to at least one binding tag, and then separating the solid from the hybridization composition.

[0171] Similarly, the method includes step (4) of eluting the variant target nucleic acid from the hybrid of the capture probe and the variant target nucleic acid. The elution can be performed by various elution methods known in the art. The variant target nucleic acid obtained after elution is in a state suitable for subsequent detection.

[0172] Similarly, the method includes step (5), detecting the variant target nucleic acid. Detection can be accomplished by various DNA analysis methods known in the art. Therefore, in some instances, step (5) includes detecting the variant target nucleic acid by a DNA analysis method, and the DNA analysis method includes one or more or a combination thereof in real-time PCR, microarray, fragment size analysis, Sanger sequencing, next generation sequencing or digital PCR.

[0173] The method can be applied to the nucleic acid probe compositions and systems described above.

[0174] In some examples, the capture probe oligonucleotides comprise one or more of DNA, RNA, locked nucleic acid, or peptide nucleic acid, or a combination thereof; the enhancement probe oligonucleotides comprise one or more of DNA, RNA, locked nucleic acid, or peptide nucleic acid, or a combination thereof.

[0175] In some examples, the substitution, insertion or deletion comprises one or more of a single base substitution, a multiple base substitution, a single base insertion, a multiple base insertion, a single base deletion or a multiple base deletion.

[0176] In some examples, the hybridization solution further comprises a guanidinium salt. In some embodiments, the guanidinium salt comprises one or more of guanidine or guanidine derivatives, wherein the structure of the guanidinium derivative is (R1R2N)(R3R4N)C=N-R5, wherein R1, R2, R3, R4 and R5 are each independently (i) hydrogen or (ii) a functional group comprising 1 to 4 hydrogen-containing carbons, and the total number of carbons in R1 to R5 is less than or equal to 15. Similarly, in some embodiments, the guanidinium salt is present in the hybridization composition at a concentration of 0.05 to 8M. Similarly, in some embodiments, the guanidinium salt comprises guanidine isothiocyanate at a concentration of 0.05 to 8M, 0.5 to 4M, 1.0 to 3.0M or 1.5 to 2.5M, 1.6 to 2.4M, 1.7 to 2.3M, 1.8 to 2.2M, 1.9 to 2.1M or about 2.0M.

[0177] In some examples, the nucleic acid sequence of the strand segment of the variant target nucleic acid or the reference target nucleic acid each comprises 15 to 400 nucleotides.

[0178] In some examples, the variant target domain and the reference target domain each comprise 1 to 200 nucleotides.

[0179] In some instances, the composition comprises only one capture probe and one enhancement probe, wherein the capture probe is specific for a single variant target nucleic acid, and the enhancement probe is specific for a single reference target nucleic acid. In some instances, the composition comprises multiple capture probes, comprises only one enhancement probe, wherein each capture probe is specific for a different variant target nucleic acid, and the enhancement probe is specific for a single reference target nucleic acid. In some instances, the composition comprises multiple capture probes and multiple enhancement probes, wherein each capture probe is specific for a different variant target nucleic acid, and each enhancement probe is specific for a different reference target nucleic acid, wherein each reference target nucleic acid is a reference nucleic acid for one or more variant target nucleic acids.

[0180] In some examples, the capture probe comprises at least 6 pairs of adjacent matched nucleotides relative to the nucleic acid sequence of the strand segment of the variant target nucleic acid, and the booster probe comprises at least 6 pairs of adjacent matched nucleotides relative to the nucleic acid sequence of the strand segment of the reference target nucleic acid.

[0181] In some examples, the capture probes contain only nucleotides that match the nucleic acid sequence of the strand segment of the variant target nucleic acid, and the booster probes contain only nucleotides that match the nucleic acid sequence of the strand segment of the reference target nucleic acid.

[0182] In some examples, the hybridization composition does not require any other oligonucleotides complementary to the 5' subsequence, middle subsequence, or 3' subsequence of the stranded segment of the variant target nucleic acid or the reference target nucleic acid, and does not require any other nucleic acids complementary to the capture probe or the enhancer probe.

[0183] Examples

[0184] The following examples demonstrate the effectiveness of the nucleic acid probe composition, system and method of the present invention in enriching, extracting and detecting variant target nucleic acids.

[0185] Example 1: Enrichment of mutant DNA containing deletion mutations

[0186] In this example, we used nucleic acid probe compositions, systems and methods to enrich for mutant DNA containing deletion mutations, specifically the mutant "A7" allele in the wild-type "A8" allele background. The ACVR2a gene contains a series of eight A nucleotides, and by deleting one A nucleotide from this series of eight A nucleotides, it can be mutated to the A7 allele. This example also compares these compositions, systems and methods with compositions, systems and methods of the prior art.

[0187] In this study, we pre-immobilized a capture probe ([AmC6]GTTGTTGTGCATAAAAAAAGA) (SEQ ID NO: 1) specific for the mutant A7 allele on carboxylated magnetic beads to prepare capture magnetic beads for enrichment of mutant A7 alleles from artificial DNA samples containing 10% mutant A7 DNA. The AmC6 group of the capture probe provides a primary amine group, which can be immobilized by carbodiimide binding to the carboxyl group of the magnetic beads to form an amide bond between the primary amine group and the carboxyl group.

[0188] The artificial DNA sample was generated by mixing 3,000 parts of mutant A7 DNA and 27,000 parts of wild-type A8 DNA. Both mutant A7 and wild-type A8 DNA were gBIock gene fragment DNAs purchased from Integrated DNA Technologies.

[0189] Figure 5 (A) shows the fragment analysis results of an artificial DNA sample containing 10% mutant A7 DNA directly amplified without enrichment, which can be used as a reference to determine the degree of enrichment when using capture magnetic beads to enrich mutant A7 alleles. In the experiment, an artificial DNA sample containing 10% mutant A7 alleles was directly PCR amplified using 20 μL of LUNA universal probe qPCR Master Mix (New England Biolabs). The primers used were FAM-AAAGCTAACTGGATAACTTACAG (SEQ ID NO: 2) (forward) and ACATGCAGGAAGTTGTTGT (SEQ ID NO: 3) (reverse). The forward primer was labeled with FAM for detection. Finally, the PCR products were fragment analyzed using a SeqStudio electrophoresis-based sequencer (ThermoFisher). Figure 5 Two main peaks were observed in (A), one from the mutant A7 allele and the other from the wild-type A8 allele. Figure 5 The small peak in the sample is caused by PCR leakage.

[0190] Figure 5(B) shows the fragment analysis results obtained when the mutant A7 allele was enriched using capture magnetic beads. In the experiment, the capture magnetic beads were first mixed with the artificial DNA sample and incubated for hybridization at room temperature for one hour, using 2M guanidine isothiocyanate (GuSCN) as the hybridization buffer. After hybridization, the magnetic beads were captured and then washed with 2X 1M NaCl solution and 1X 50mMNaCl solution. Thereafter, the captured DNA was eluted from the capture magnetic beads, and a portion of it was PCR amplified using 20μL of LUNA universal probe qPCR MasterMix (New England Biolabs). The primers used were FAM-AAAGCTAACTGGATAACTTACAG (SEQ ID NO: 2) (forward) and ACATGCAGGAAGTTGTTGT (SEQ ID NO: 3) (reverse). The forward primer was labeled with FAM for detection. Finally, the PCR product was fragment analyzed using a SeqStudio electrophoresis-based sequencer (ThermoFisher). It can be seen that Figure 5 The peak intensity ratio of A7 to A8 in (B) is slightly higher than Figure 5 (A) shows that when mutant A7 alleles were enriched using capture beads containing capture probes specific for the mutant A7 allele, a certain degree of enrichment was achieved.

[0191] Subsequently, a competitive probe specific for the wild-type A8 allele was used to improve the enrichment effect of the mutant A7 allele, which is based on the method of Jeffreys et al. (2003). Jeffreys et al. (2003) reported a method for enriching mutant DNA, in which it was shown that in the presence of a competitive probe specific for the wild-type allele, the enrichment effect of mutant DNA can be improved. The sequence of the competitive probe used in the present invention is GTTGTTGCATAAAAAAAAGA (SEQ ID NO: 4). In the experiment, the competitive probe was mixed with the capture magnetic beads and the artificial DNA sample and incubated to hybridize at room temperature for one hour. 2M guanidine isothiocyanate (GuSCN) was used as the hybridization buffer. After hybridization, the magnetic beads were captured and then washed with 2X 1M NaCl solution and 1X 50mM NaCl solution. Afterwards, the captured DNA was eluted from the capture magnetic beads. Then, a portion of the eluted DNA was PCR amplified by 20 μL of LUNA universal probe qPCR Master Mix (New England Biolabs). The primers used were FAM-AAAGCTAACTGGATAACTTACAG (SEQ ID NO: 2) (forward) and ACATGCAGGAAGTTGTTGT (SEQ ID NO: 3) (reverse). The forward primer was labeled with FAM for detection. Finally, the PCR product was subjected to fragment analysis by using a sequencer based on SeqStudio electrophoresis (ThermoFisher).

[0192] Figure 5 (C) shows the results of enriching mutant A7 alleles from artificial DNA samples using capture beads in the presence of a competing probe. Figure 5 The peak intensity ratio of A7 to A8 in (C) is greater than Figure 5 (A) and Figure 5 (B) Both, indicating that better enrichment is indeed achieved in the presence of the competing probe, but the A7 peak intensity is still weaker than the A8 peak intensity.

[0193] In the process of enriching mutant A7 alleles, we found that the nucleic acid probe composition, system and method of the present invention have a much better enrichment effect on mutant A7 alleles than the method of Jeffreys et al. (2003). The present invention uses a new probe (named "enhanced probe") to replace the production Figure 5(C) Competitive probes for the results shown. The new enhanced probe has a sequence of CATAAAAAAAAGAGGCCTG (SEQ ID NO: 5) and is specific to the wild-type A8 allele of ACVR2a. In the experiment, the enhanced probe was mixed with the capture magnetic beads and the artificial DNA sample and incubated for hybridization at room temperature for one hour, using 2M GuSCN as the hybridization buffer. After hybridization, the magnetic beads were recovered and then washed with 2X 1MNaCl and 1X 50mM NaCl. Afterwards, the captured DNA was eluted from the capture magnetic beads. Then, a portion of the eluted DNA was PCR amplified by 20 μL of LUNA universal probe qPCR Master Mix (New England Biolabs). The primers used were FAM-AAAGCTAACTGGATAACTTACAG (SEQ ID NO: 2) (forward) and ACATGCAGGAAGTTGTTGT (SEQID NO: 3) (reverse). The forward primer was labeled with FAM for detection. Finally, the PCR products were subjected to fragment analysis by using a SeqStudio electrophoresis-based sequencer (ThermoFisher).

[0194] Figure 5 (D) shows the results of enriching mutant A7 alleles from artificial DNA samples using capture beads in the presence of enhanced probes. It can be seen that in the presence of enhanced probes, the peak intensity of A7 is stronger than the peak intensity of A8, indicating that the enhanced probe can better enrich mutant A7 alleles from artificial DNA samples containing 10% mutant A7 alleles.

[0195] Example 2: Enrichment of mutant DNA containing its substitution mutation

[0196] This example is used to demonstrate the effectiveness of the nucleic acid probe compositions, systems and methods of the present invention in enriching mutant DNA containing substitution mutations. Specifically, this example uses the compositions, systems and methods of the present invention to enrich mutant Braf (V600E) DNA in a wild-type Braf DNA background.

[0197] First, a capture probe (GAGATTTCTCTGTAGCTAGACCAAAATCAAAT) (SEQ ID NO: 6) specific to mutant Braf V600E DNA was pre-immobilized on magnetic beads to prepare capture magnetic beads for enriching mutant Braf V600E DNA. The short AAAT sequence at the 3' end of the capture probe (shown in italics in the capture probe sequence) is used to prevent the capture probe released from the capture magnetic beads from being amplified in the subsequent PCR process because this short sequence is not complementary to the target Braf sequence.

[0198] This example also uses an enhancement probe CTCCATCGAGATTTCACTGTAGCTATTTT (SEQ ID NO: 7) specific for wild-type Braf DNA. The short TTTT sequence at the 3' end of the enhancement probe (shown in italics in the enhancement probe sequence) is used to prevent the enhancement probe carried into the PCR from being extended during PCR because this short sequence is not complementary to the target Braf sequence.

[0199] This example enriched the mutant Braf V600E allele from an artificial DNA sample containing 2% mutant Braf V600E DNA. The artificial DNA sample was generated by mixing 600 mutant Braf V600E DNA and 29,400 wild-type Braf DNA. Both the mutant Braf V600E and wild-type Braf DNA were gBIock gene fragment DNAs purchased from Integrated DNA Technologies.

[0200] Figure 6 (A) shows the results of direct sequencing of an artificial DNA sample containing 2% mutant Braf V600E DNA without enrichment. This result is used as a reference to determine the degree of enrichment when using capture magnetic beads to enrich mutant Braf V600E DNA. In the experiment, an artificial DNA sample containing 2% mutant Braf V600E DNA was directly PCR amplified and sequenced by "Sanger sequencing". The primers used for PCR were GACCTCACAGTAAAAATAGGTG (SEQ ID NO: 8) (forward) and ATAGCCTCAATTCTTACCATC (SEQ ID NO: 9) (reverse). The primer used for Sanger sequencing is ATAGCCTCAATTCTTACCATC (SEQ ID NO: 9). Figure 6 (A) As can be seen, the wild-type nucleotide at the V600E mutation site is A, indicated by the triangle symbol. Obviously, without enrichment, the V600E mutation cannot be detected by Sanger sequencing from a DNA sample containing 2% mutant Barf V600E DNA.

[0201] Figure 6(B) shows the results when capture magnetic beads were used to enrich mutant Braf V600E DNA from an artificial DNA sample containing 2% mutant Braf V600E DNA in the presence of an enhanced probe. In the experiment, the capture magnetic beads, enhanced probes, and artificial DNA samples were mixed together and incubated for hybridization at room temperature for one hour, using 2M guanidine isothiocyanate (GuSCN) as a hybridization buffer. After hybridization, the magnetic beads were recovered and then washed with 2X 1M NaCl and 1X 50mM NaCl. Thereafter, the captured DNA was eluted from the capture magnetic beads. A portion of the eluted DNA was then subjected to PCR amplification and Sanger sequencing. It can be seen that after enrichment by the nucleic acid probe composition, system, and method of the present invention, Figure 6 The mutant nucleotide T indicated by the triangle symbol can be clearly seen in (B). In fact, the signal of T at the mutation site is at least twice as strong as that of the wild-type nucleotide A, indicating that the mutant Braf V600E DNA is significantly enriched from the artificial DNA sample containing 2% mutant Braf V600E DNA and can therefore be detected by Sanger sequencing. This result shows that the nucleic acid probe composition, system and method of the present invention also perform well when used to enrich and detect mutant DNA containing substitution mutations.

[0202] Example 3: Scanning the mutation status of multiple mutations

[0203] This example is intended to demonstrate the effectiveness of the nucleic acid probe composition, system and method of the present invention for scanning the mutation state of multiple potential mutations in a wild-type DNA background. Specifically, the nucleic acid probe composition, system and method of the present invention are used to scan the mutation state of seven mutations (G12D, G12V, G12A, G12C, G12R, G12S and G13D) of codons 12 and 13 of Kras in a wild-type DNA background. First, seven capture probes are pre-fixed on the same magnetic beads to prepare capture magnetic beads. Each capture probe is specific to a target mutation, respectively. Table 1 lists the sequence of each capture probe. The short TTTT sequence at the 3' end of each capture probe (shown in italics in each capture probe sequence) is used to prevent the capture probe released from the capture magnetic beads from being extended by PCR because the short sequence is not complementary to the target sequence.

[0204] In this example, an enhancement probe specific for wild-type Kras DNA was used to enhance the enrichment effect for each target mutation. The sequences of the enhancement probes are also listed in Table 1. The short TTTT sequence at the 3' end of the enhancement probe (also shown in italics in the enhancement probe sequence) is used to prevent the enhancement probe carried to PCR from being extended because this short sequence is not complementary to the target sequence.

[0205] Seven "mutant" gBIock gene fragments (one for each mutation) were used to simulate mutant Kras DNA, and one "wild-type" gBIock gene fragment was used to simulate wild-type DNA. The gBIock gene fragment DNA was purchased from Integrated DNA technologies. Each artificial DNA sample contained only one "mutant" gBIock gene fragment, which had a target mutation, and the abundance of the mutant DNA was 0.5%. Each artificial DNA sample was produced by mixing 600 parts of specific "mutant" gBIock gene fragments and 116,400 parts of wild-type gBIock gene fragments.

[0206] Table 1: Sequences of various Kras probes and primers

[0207]

[0208] Figure 7 (A) shows the results of direct sequencing of an artificial DNA sample containing a G12D mutation without enrichment. This result is used as a reference to determine the degree of enrichment when mutant G12D DNA is enriched by nucleic acid probe compositions, systems and methods. In the experiment, an artificial DNA sample containing 0.5% mutant G12D DNA was directly PCR amplified and subjected to Sanger sequencing. The primers used for PCR and Sanger sequencing are also listed in Table 1. The wild-type nucleotide at the G12D mutation site is C, indicated by a triangle symbol. Figure 7 (A) As can be seen, without enrichment, the G12D mutation could not be detected in the artificial DNA sample containing 0.5% mutant G12D DNA by Sanger sequencing.

[0209] Figure 7 (B) shows the results of enriching mutant G12D DNA from an artificial DNA sample containing 0.5% mutant G12D DNA using capture magnetic beads in the presence of enhanced probes. In the experiment, capture magnetic beads containing all seven capture probes, enhanced probes, and artificial DNA samples were mixed and incubated together for hybridization at room temperature for one hour, using 2M guanidine isothiocyanate (GuSCN) as a hybridization buffer. After hybridization, the magnetic beads were recovered and then washed with 2X 1M NaCl and 1X 50mM NaCl. Thereafter, the captured DNA was eluted from the capture magnetic beads. A portion of the eluted DNA was then subjected to PCR amplification and Sanger sequencing. After enrichment by the nucleic acid probe composition, system, and method of the present invention, it can be Figure 7The mutant nucleotide T indicated by the triangle symbol is clearly seen in (B). In fact, the signal of the mutant nucleotide T at this mutation site is even stronger than that of the wild-type nucleotide C, indicating that the mutant G12D DNA is effectively enriched, enabling the detection of the G12D mutation in an artificial DNA sample containing 0.5% mutant G12D DNA by Sanger sequencing.

[0210] Figure 7 (C) shows the results of direct sequencing of an artificial DNA sample containing a G12C mutation without enrichment. This result is used as a reference to determine the degree of enrichment when mutant G12C DNA is enriched by nucleic acid probe compositions, systems and methods. In the experiment, an artificial DNA sample containing 0.5% mutant G12C DNA was directly PCR amplified and Sanger sequenced. The PCR and Sanger sequencing primers used are the same as those listed in Table 1. The wild-type nucleotide at the G12C mutation site is a C indicated by a triangle symbol. Figure 7 (C) shows that the G12C mutation could not be detected by Sanger sequencing from an artificial DNA sample containing 0.5% mutant G12C DNA without enrichment.

[0211] Figure 7 (D) shows the results of enriching mutant G12C DNA from an artificial DNA sample containing 0.5% mutant G12C DNA using capture magnetic beads containing all seven capture probes in the presence of an enhancement probe. In the experiment, the capture magnetic beads, enhancement probes, and artificial DNA samples were mixed and incubated together for hybridization at room temperature for one hour, using 2M guanidine isothiocyanate (GuSCN) as a hybridization buffer. After hybridization, the magnetic beads were recovered and then washed with 2X 1M NaCl and 1X 50mM NaCl. Thereafter, the captured DNA was eluted from the magnetic beads. A portion of the eluted DNA was then subjected to PCR amplification and Sanger sequencing. After enrichment by the probe composition and method of the present invention, Figure 7 The mutant nucleotide A indicated by the triangle symbol can be clearly seen in (D). In fact, the signal of the mutant nucleotide A is even stronger than that of the wild-type nucleotide C, indicating that the mutant G12C DNA is effectively enriched by the nucleic acid probe composition, system and method, thereby enabling the detection of the G12C mutation from an artificial DNA sample containing 0.5% mutant G12C DNA by Sanger sequencing.

[0212] Figure 7(E) shows the results of direct sequencing of an artificial DNA sample containing a G13D mutation without enrichment. This result is used as a reference to determine the degree of enrichment of mutant G13D DNA by nucleic acid probe compositions, systems and methods. In the experiment, an artificial DNA sample containing 0.5% mutant G13D DNA was directly PCR amplified and Sanger sequenced. The wild-type nucleotide at the G13D mutation site is indicated by a triangle symbol C. Figure 7 (E) As shown, without enrichment, the G13D mutation could not be detected by Sanger sequencing from an artificial DNA sample containing 0.5% mutant G13D DNA.

[0213] Figure 7 (F) shows the results of enriching mutant G13D from an artificial DNA sample containing 0.5% mutant G13D DNA using capture magnetic beads in the presence of an enhanced probe. In the experiment, the capture magnetic beads, enhanced probes, and artificial DNA samples were mixed together for hybridization at room temperature for one hour, using 2M guanidine isothiocyanate (GuSCN) as a hybridization buffer. After hybridization, the magnetic beads were recovered and then washed with 2X 1M NaCl and 1X 50mM NaCl. Thereafter, the captured DNA was eluted from the magnetic beads. A portion of the eluted DNA was then subjected to PCR amplification and Sanger sequencing. After enrichment by the probe composition and method of the present invention, it can be Figure 7 The mutant nucleotide T indicated by the triangle symbol is clearly seen in (F). In fact, the signal of the mutant nucleotide T at the mutation site is even stronger than the signal of the wild-type nucleotide G, indicating that the mutant G13D DNA is effectively enriched by the nucleic acid probe composition, system and method, so that the G13D mutation can be detected from an artificial DNA sample containing 0.5% mutant G13D DNA by Sanger sequencing. It should be noted that the nucleic acid probe composition, system and method also produce a similar degree of enrichment effect on mutant G12A, G12V, G12S and G12R DNA (data not shown here), so that these Kras gene mutations can be detected by Sanger sequencing.

[0214] Example 4: Effect of hybridization buffer salt

[0215] This example aims to demonstrate that nucleic acid probe compositions supplemented with guanidinium salts (e.g., guanidine isothiocyanate (GuSCN)) can better enrich and detect mutant DNA compared to salts of conventional hybridization buffers (such as sodium chloride (NaCl), magnesium chloride (MgCl2) or phosphate buffered saline (PBS)). Specifically, the effects of four different hybridization buffers on enrichment and detection of Braf (V600E) mutations in the context of wild-type Braf DNA were compared. The artificial DNA sample used in this example was produced by mixing 1,200 portions of mutant gBIock gene fragment DNA containing the Braf (V600E) mutation and 58,800 portions of wild-type gBIock gene fragment DNA. Except for the hybridization buffer, the experimental steps in this example are the same as those in Example 2.

[0216] Figure 8 Shown are the results of Sanger sequencing using four different hybridization buffers. Figure 8 The results of (A), 8(B), 8(C), and 8(D) were obtained using 2 M guanidine isothiocyanate (GuSCN), 500 mM NaCl, 10 mM MgCl2, or 5x PBS buffer, respectively. The wild-type nucleotide at the mutation position is indicated by a triangle symbol A, while the mutant nucleotide at that position is indicated by a triangle symbol T. Figure 8 It can be seen that only 2M guanidine isothiocyanate (GuSCN) buffer enriched mutant DNA, allowing mutant Braf (V600E) DNA to be detected by Sanger sequencing from a sample containing 2% mutant Braf (V600E) DNA, while the other three buffers failed to fully enrich mutant Braf V600E DNA when using nucleic acid probe compositions, systems and methods. Even when using a hybridization buffer containing only 0.05M guanidine isothiocyanate (GuSCN), enrichment of mutant DNA can be achieved, but the enrichment effect is generally better when using 1-3M GuSCN.

[0217] Hybridization buffers containing NaCl, MgCl2, and PBS but without guanidinium salts are commonly used for nucleic acid hybridization. Buffers containing NaCl and MgCl2 but without guanidinium salts have also been used in previous methods involving hybridization of nucleic acid sequences including toehold domains, which can successfully enrich mutant DNA in the background of wild-type DNA (see, e.g., Zhang et al., Journal of the American Chemical Society 131: 17303-17314 (2009)).

[0218] It can be seen that compared with the NaCl, MgCl2 and PBS salts of conventional hybridization buffers, the results of enrichment and detection of mutant DNA are better when supplemented with guanidinium salts, especially guanidine isothiocyanate (GuSCN).

[0219] Example 5: Liquid Phase Hybridization

[0220] In all the above examples, the capture probes are pre-immobilized on magnetic beads before hybridization, which means that the enrichment process involves solid phase hybridization, i.e., the process of forming hybrids between the capture probes immobilized on a solid surface and the target DNA in solution. The magnetic beads are then separated from the solution (i.e., the supernatant), which allows the enrichment of mutant DNA and thus the detection of mutant DNA in a background of wild-type DNA.

[0221] This example is intended to demonstrate the effectiveness of nucleic acid probe compositions, systems and methods in enriching for mutant DNA when it involves liquid phase hybridization, ie, the process of forming hybrids between capture probes and target DNA in solution.

[0222] Specifically, first, in the presence of the enhancement probe, the capture probe is hybridized with the target DNA molecule in the solution. In this case, the capture probe also contains a capture tag, which can bind to certain surface molecules of solids such as magnetic beads, thereby being captured by the solid. After liquid phase hybridization, the solid is added to the above hybridization system, so that the capture probe and the hybrid formed by the capture probe can be separated by separating the solid from the solution (i.e., the supernatant), thereby achieving enrichment of mutant DNA.

[0223] In this example, we enriched for mutant Braf V600E DNA. The capture probe had the following sequence, GGTCAGG TTACCGCTGCGATCGCA GAGATTTCTCTGTAGCTAGACCAAAATCAAAT (SEQ ID NO: 20), which comprises three parts. The first part shown in bold is a capture sequence, which is complementary to the mutant DNA containing the Braf V600E mutation. The mutation of the mutant DNA corresponds to a single base substitution. The corresponding reverse complementary single base of the capture sequence is the T base shown in italics and bold in the first part. The underlined second part serves as a capture tag, which is complementary to the sequence of the extraction probe pre-fixed on the magnetic beads. Therefore, the capture probe and the hybrid formed with the capture probe can be separated by hybridization between the capture tag of the capture probe and the extraction probe pre-fixed on the magnetic beads. The sequence of the extraction probe pre-fixed on the magnetic beads is TGCGATCGCAGCGGTAACCTGACC (SEQ ID NO: 21). The third part is a short AAAT sequence (marked with italics) located at the 3' end of the capture probe, which is used to prevent the capture probe released from the capture magnetic beads from being extended by PCR.

[0224] In the experiment, we first mixed and incubated the capture probe, enhancement probe and artificial DNA sample containing 2% mutant Braf V600E DNA used in Example 2 for hybridization at room temperature, using 2M guanidine isothiocyanate (GuSCN) as a hybridization buffer. Afterwards, magnetic beads containing extraction probes were added to the above hybridization system to capture the capture probes and the hybrids formed with the capture probes by magnetic beads. Then, the magnetic beads were recovered and then washed with 2X 1M NaCl and 1X 50mM NaCl. Afterwards, the captured DNA was eluted from the magnetic beads. Then, a portion of the eluted DNA was subjected to PCR amplification and Sanger sequencing. The primers used in this example are the same as those in Example 2, and the artificial DNA sample used is the same as that used in Example 4, which contains 2% mutant BrafV600E DNA.

[0225] Fig. 9 (A) shows the results of our direct sequencing of an artificial DNA sample containing 2% mutant Braf V600E DNA without enrichment. This result was used as a reference to confirm the degree of enrichment when using nucleic acid probe compositions, systems and methods involving liquid phase hybridization to enrich mutant Braf V600E DNA. Similarly, without enrichment, the Braf V600E mutation was not detected from the sample containing 2% mutant Barf V600E DNA by Sanger sequencing.

[0226] Fig. 9 (B), 9(C) and 9(D) show the results when mutant Braf V600E DNA was enriched from an artificial DNA sample containing 2% mutant Braf V600E DNA using nucleic acid probe compositions, systems and methods involving liquid phase hybridization. Fig. 9 The results of (B), 9(C), and 9(D) were obtained when 2 M guanidine isothiocyanate (GuSCN), 500 mM NaCl, and 10 mM MgCl2 were used as hybridization buffers, respectively. Fig. 9 The mutant nucleotide T indicated by the triangle symbol at the mutation position can be clearly seen in (B). In fact, the signal of the mutant nucleotide T at the mutation site is stronger than that of the wild-type nucleotide A, indicating that the mutant Braf V600E DNA is significantly enriched and thus becomes detectable by Sanger sequencing.

[0227] This result shows that the nucleic acid probe compositions, systems and methods of the present invention can also be effectively used for enrichment of mutant DNA when liquid phase hybridization is involved.

[0228] Similarly, by comparing Fig. 9 (B) Fig. 9 (C) and Fig. 9(D) It can be seen that when the nucleic acid probe compositions, systems and methods involving liquid phase hybridization use guanidinium salts, especially guanidine isothiocyanate (GuSCN), instead of NaCl or MgCl2 in conventional hybridization buffers, the results of enriching and detecting mutant DNA are again better, which is consistent with previous results involving the role of hybridization buffer salts.

[0229] Example 6: Recovery of mutant DNA

[0230] This example is intended to demonstrate that the probe composition and method of the present invention can extract and enrich mutant DNA from samples containing mutant DNA, and have high recovery and high enrichment. Another problem with previous methods such as the method of Jeffreys et al. (2003) is that only a small portion of mutant DNA can be recovered during the enrichment process. The nucleic acid probe composition, system and method of the present invention can achieve a high recovery of mutant DNA while still maintaining a high degree of enrichment.

[0231] In this example, the experimental steps of Example 2 were used to enrich and recover mutant Braf V600E DNA from an artificial DNA sample containing 2% mutant Braf V600E DNA. After extraction and enrichment, a portion of the extracted DNA was subjected to Sanger sequencing as in Example 2, while another portion of the extracted DNA was subjected to quantitative polymerase chain reaction qPCR, which was performed in LUNA Universal qPCR Master Mix (New England Biolabs) to evaluate the recovery of mutant Braf V600E DNA. The primer pairs used in qPCR were the same as in Example 2. The same experiment was repeated five times to evaluate the repeatability of the nucleic acid probe composition, system and method. Table 2 shows the enrichment and recovery of each repeated experiment. The enrichment was estimated based on the ratio of the peak height of the mutant nucleotide to the peak height of the wild-type nucleotide. At the same time, the peak height ratio was also used to estimate the percentage of wild-type DNA in the extracted DNA. Since qPCR cannot distinguish between mutant DNA and wild-type DNA, the recovery listed in Table 2 is determined by deducting the estimated amount of wild-type DNA in the extracted DNA. The average enrichment and recovery rates of five replicate experiments were 2.8 and 65%, respectively, indicating that these nucleic acid probe compositions, systems and methods can be used to simultaneously extract and enrich mutant DNA from samples containing mutant DNA.

[0232] Table 2: Recovery of mutant Braf V600E DNA

[0233] experiment Enrichment Recovery rate (%) Repeat experiment 1 2.4 60 Repeat Experiment 2 2.1 64 Repeat experiment 3 3 67 Repeat experiment 4 2.6 65 Repeat experiment 5 4 71

[0234] Example 7: 1000-fold enrichment of mutant G12D Kras DNA

[0235] This example is intended to demonstrate that the nucleic acid probe compositions, systems and methods of the present invention can enrich mutant DNA by at least 1,000 times. In addition, this example also demonstrates that the nucleic acid probe compositions, systems and methods are effective when the toehold subsequence of the capture probe is located at the 5' or 3' position. In Example 3, the toehold subsequence of the capture probe used is at the 5' position, while the toehold subsequence of the enhancement probe is at the 3' position. In this example, the toehold subsequence of the capture probe enriched for mutant G12D Kras DNA is at the 3' position ( TTGGAGCTGATGGCGTAGGCA AGAGTGCAAAA) (SEQ ID NO: 22), and the toehold subsequence of the enhancer probe is at the 5' end position (GTGGTAG TTGGAGCTGGTGGCGTAGGC TTTT) (SEQ ID NO: 23). The sequences shown in italics in both probes are the respective toehold subsequences. The short TTTT and AAAA sequences shown in bold are used to prevent the capture and booster probes from being extended by PCR, as these TTTT and AAAA sequences are not complementary to the target sequence.

[0236] We used the "G12D" gBIock gene fragment to simulate mutant G12D Kras DNA, and used the "wild-type" gBIock gene fragment to simulate wild-type DNA. The "G12D" gBIock gene fragment and the "wild-type" gBIock gene fragment were mixed at a ratio of 1 / 1000 (i.e., the ratio of mutant to wild-type DNA was 0.1%) to prepare an artificial DNA sample containing mutant G12D KrasDNA. The primers used for PCR and Sanger sequencing are the same as those listed in Table 1. In this example, we only fixed the capture probe specific to mutant G12D Kras DNA on magnetic beads to make capture magnetic beads, and the remaining experimental conditions were similar to those used in Example 3.

[0237] Fig.10 (A) shows the results when the enhancer probe was absent, in which mutation G12D was not detected, whereas Fig.10 (B) shows the results when the enhanced probe is present. Fig.10 The mutant nucleotide T indicated by the triangle symbol is clearly seen in (B). In fact, the signal of the mutant nucleotide T at this mutation site is almost identical to that of the wild-type nucleotide C, indicating that the mutant G12D DNA is enriched 1000-fold by toehold exchange.

[0238] Example 8: Order of mixing capture probes, enhancement probes and DNA samples

[0239] This example is intended to demonstrate that when the order of mixing capture probes (magnetic beads), enhancement probes and DNA samples, i.e., the sequence, is changed, the nucleic acid probe composition, system and method of the present invention still perform well. In the above example, the capture probe (magnetic beads), enhancement probe and DNA sample are mixed together at the same time for hybridization and foothold replacement / foothold exchange. In this example, the capture probe (magnetic beads) and DNA sample are first mixed together for incubation, and then the enhancement probe is added to the mixture for incubation. In this example, we used the same probe used in Example 7 to enrich mutant G12D KrasDNA. In short, an artificial DNA sample containing mutant G12D Kras DNA was prepared by mixing the "G12D" gBIock gene fragment and the "wild-type" gBIock gene fragment at a ratio of 1 / 200 (i.e., the ratio of mutant to wild-type DNA is 0.5%). In this example, only the capture probe specific for mutant G12D Kras DNA is fixed on the magnetic beads to make capture magnetic beads. The primers used for PCR and Sanger sequencing are the same as those listed in Table 1.

[0240] Fig.11 The results of (A) were obtained by mixing the capture probe (magnetic beads) with an artificial DNA sample containing 0.5% mutant G12D DNA for 60 min for hybridization in the absence of the enhancement probe. Then, the capture magnetic beads were separated and washed. Finally, the extracted DNA was eluted from the magnetic beads and subjected to Sanger sequencing. Fig.11 As shown in (A), mutation G12D was not detected.

[0241] Fig.11 The results of (B) were obtained by mixing the capture probe (magnetic beads) with the same artificial DNA sample for 60 min for hybridization, then adding the enhancement probe to the mixture and incubating for another 30 min. Then, the capture magnetic beads were separated and washed. Finally, the extracted DNA was eluted from the magnetic beads and subjected to Sanger sequencing. Fig.11 In (B), the mutant nucleotide T indicated by the triangle symbol can be clearly seen, and the signal of the mutant nucleotide T at the mutation site is almost the same as the signal of the wild-type nucleotide C. This example clearly shows that the nucleic acid probe composition, system and method still perform well when the order of mixing the capture probe (magnetic beads), enhancement probe and DNA sample is changed.

[0242] Example 9: Mutation analysis of formalin-fixed paraffin-embedded tumor tissue

[0243] Mutational analysis of formalin-fixed paraffin-embedded ("FFPE") tumor tissue can reveal the presence of relevant mutations in the tumor, which is critical for assessing whether a patient is a candidate for targeted therapy and is therefore an example of mutational analysis of a biologically relevant sample.

[0244] This example is intended to demonstrate that the nucleic acid probe compositions, systems and methods of the present invention are compatible with FFPE samples and can enrich mutant DNA from FFPE samples, and therefore can be used for mutation analysis of these biologically relevant samples.

[0245] The FFPE tumor tissue sample used in this example contains 5% mutant Kras G12D mutation. First, the nucleic acid probe composition, system and method of the present invention are used to extract / enrich mutant DNA containing Kras G12D mutation from the FFPE sample, and then the extracted DNA is subjected to Sanger sequencing to determine whether there is mutant Kras G12D DNA in the FFPE sample.

[0246] The sequences of the capture probe and enhancement probe used were TTGGAGCTGATGGCGTAGGC AAGAGTGCAAAA (SEQ ID NO:22) and GTGGTAG TTGGAGCTGGTGGCGTAGGC TTTT (SEQ ID NO: 23).

[0247] In the capture probe and enhancement probe, the underlined sequences are the variant target domain and the reference target domain, respectively, the sequences shown in italics are the toehold subsequences, and the short TTTT and AAAA sequences shown in bold are used to prevent the capture and enhancement probes from being extended by PCR. The capture probes were pre-immobilized on magnetic beads to prepare capture magnetic beads. The same primers listed in Table 1 were used for PCR and Sanger sequencing.

[0248] Fig.12 The results of Sanger sequencing of DNA extracted from the FFPE sample are shown, wherein (A) was not enriched by toehold replacement / toehold exchange, and (B) was enriched by toehold replacement / toehold exchange. Fig.12 As shown, the antisense strand was sequenced, and the wild-type and mutant nucleotides at the mutation site are C indicated by a triangle symbol and T indicated by a triangle symbol, respectively. Obviously, without enrichment, mutant Kras G12D DNA ( Fig.12 (A)), while when the mutant DNA was enriched / extracted from the same FFPE sample using the nucleic acid probe compositions, systems and methods of the present invention, the mutant Kras G12D DNA was clearly detected ( Fig.12 (B)).

[0249] This example demonstrates that the nucleic acid probe compositions, systems and methods of the present invention are compatible with FFPE samples, meaning that they are effective when used to enrich / extract mutant DNA from FFPE samples.

[0250] Example 10: Mutation analysis of serum samples

[0251] Mutation analysis of serum samples is another example of mutation analysis in biologically relevant samples.

[0252] This example is intended to demonstrate that the nucleic acid probe compositions, systems and methods of the present invention are compatible with serum and can enrich mutant DNA from serum, and therefore can be used for mutation analysis of such biologically relevant samples.

[0253] The serum sample used in this example was collected from a lung cancer patient, and analysis of the patient's tumor tissue revealed that the lung cancer patient's tumor contained a Kras G12C mutation. First, the nucleic acid probe composition, system, and method of the present invention were used to extract / enrich mutant DNA containing the Kras G12C mutation from the serum sample, and then the extracted DNA was subjected to Sanger sequencing to detect whether the mutant Kras G12C DNA was present in the serum sample. The sequences of the capture probe and the enhancement probe used in this example are respectively TTGGAGCTTGTGGCGTAGGC AAGAGTGCAAAA (SEQ ID NO:24) and GTGGTAG TTGGAGCTGGTGGCGTAGGC TTTT (SEQ ID NO: 23). The underlined sequences in the capture probe and the enhancement probe are the variant target domain and the reference target domain, respectively, the sequences shown in italics are the toehold subsequences, and the short TTTT and AAAA sequences shown in bold are used to prevent the capture and enhancement probes from being extended by PCR. The capture probes were pre-fixed on magnetic beads to prepare capture magnetic beads. The same primers listed in Table 1 were used for PCR and Sanger sequencing.

[0254] Fig.13 Sanger sequencing results of DNA extracted from this serum sample are shown, where (A) it was not enriched by toehold exchange and (B) it was enriched by toehold exchange. Fig.13 As shown, the antisense strand was sequenced, and the wild-type and mutant nucleotides at the mutation site were C indicated by a triangle symbol and A indicated by a triangle symbol, respectively. Obviously, without enrichment, mutant Kras G12C DNA could not be detected from the serum sample ( Fig.13 (A)), while when the mutant DNA was enriched / extracted from the same serum sample using the nucleic acid probe composition, system and method of the present invention, the mutant Kras G12C DNA was clearly detected ( Fig.13 (B)).

[0255] This example demonstrates that the nucleic acid probe compositions, systems and methods of the present invention are compatible with serum, meaning that they are effective when used to enrich / extract mutant DNA from serum.

[0256] Example 11: Capture probes and booster probes containing mismatched nucleotides

[0257] This example is intended to demonstrate that the probe compositions, systems and methods of the present invention for enriching, extracting and detecting variant target nucleic acids in samples containing variant target nucleic acids and reference target nucleic acids perform well even when the capture probe and / or enhancement probe contain one or more mismatched nucleotides. A mismatched nucleotide refers to a nucleotide in a capture probe or enhancement probe that is not complementary to the corresponding nucleotide of the target nucleic acid and is not located at a site where an insertion, deletion or substitution occurs.

[0258] First, it was determined whether the probe compositions, systems and methods of the present invention were still effective when the enhancement probe contained mismatched nucleotides but the capture probe did not. In this case, the mutant G12D Kras DNA was enriched, wherein the sequence of the capture probe was TTGGAGCTGATGGCGTAGGCAAGAGTGC AAAA (SEQ ID NO: 22), the sequence of the enhanced probe containing the mismatched nucleotide is GTGGTAGATGGAGCTGGTGGCGTAGGC TTTT (SEQ ID NO:31),GTGGTAGCTGGAGCTGGTGGCGTAGGC TTTT (SEQ ID NO:32) or GTGGTAGGTGGAGCTGGTGGCGTAGGC TTTT (SEQ ID NO:33). Among them, the nucleotides A / C / G shown in bold are mismatched nucleotides, and the underlined short TTTT and AAAA sequences are used to prevent the capture probe and the enhancement probe from being extended by PCR because these sequences are not complementary to the target sequence. In the experiment, we used the "G12D" gBIock gene fragment to simulate the mutant G12DKras DNA, and used the "wild type" gBIock gene fragment to simulate the wild type DNA. An artificial DNA sample containing mutant G12D Kras DNA was prepared by mixing the "G12D" gBIock gene fragment and the "wild type" gBIock gene fragment at a ratio of 1 / 50 (i.e., the ratio of mutant to wild type DNA is 2%). The primers used for PCR and Sanger sequencing are the same as those listed in Table 1, and the remaining experimental conditions are similar to those used in Example 7. Fig.14 (A), 14(B), and 14(C) show the results of using booster probes containing mismatched nucleotides A, C, or G, respectively, during enrichment. Fig.14The mutant nucleotide T indicated by the arrow can be clearly seen in (A), 14(B) and 14(C), indicating that when the enhanced probe used contains a mismatched nucleotide, the mutant G12D DNA is successfully enriched by the probe composition, system and method of the present invention.

[0259] This example also studies whether the probe composition, system and method of the present invention are effective when the capture probe contains mismatched nucleotides and the enhancement probe does not have mismatched nucleotides. In this case, the probe composition, system and method of the present invention also successfully enriched mutant DNA. In addition, when both the capture probe and the enhancement probe contain mismatched nucleotides, mutant DNA can also be successfully enriched by the probe composition, system and method of the present invention.

[0260] Next, it was investigated whether the probe compositions, systems and methods of the present invention were effective when the enhancement probe contained multiple mismatched nucleotides. This example has investigated the enrichment effect of the probe compositions, systems and methods of the present invention on mutant DNA when both the capture and enhancement probes contained up to five (5) mismatched nucleotides. Fig.14 (D) shows the results when both the capture probe and the booster probe contain three (3) mismatched nucleotides. The sequences of the capture and booster probes are TAGGTGCTGATGGCGTATGCAAGAGTGC AAAA (SEQ ID NO:34) or TGGTAGTAGGTGCTGGTGGCGTATGCTTTT (SEQ ID NO:35). Among them, the nucleotides shown in bold are mismatched nucleotides, and the underlined short TTTT and AAAA sequences are used to prevent the capture and enhancement probes from being extended by PCR because these sequences are not complementary to the target sequence. In the experiment, the "G12D" gBIock gene fragment was used to simulate the mutant G12D Kras DNA, and the "wild type" gBIock gene fragment was used to simulate the wild type DNA. An artificial DNA sample containing mutant G12D Kras DNA was prepared by mixing the "G12D" gBIock gene fragment and the "wild type" gBIock gene fragment at a ratio of 1 / 50 (i.e., the ratio of mutant to wild type DNA is 2%). The primers used for PCR and Sanger sequencing are the same as those listed in Table 1, and the remaining experimental conditions are similar to Example 7. Fig.14 The mutant nucleotide T indicated by the arrow can be clearly seen in (D), indicating that when the capture probe and boost probe used both contain three (3) mismatched nucleotides, mutant G12D DNA is successfully enriched by the probe composition, system and method of the present invention.

[0261] Fig.14(E) shows the results when both the capture probe and the booster probe contain five (5) mismatched nucleotides. The sequences of the capture and booster probes are TAGGTGCCGATGGCGAATGCAAGAGTGC AAAA (SEQ ID NO:36) or TGGTAGTAGGTGCCGGTGGCGAATGC TTTT (SEQ ID NO:37). Among them, the nucleotides shown in bold are mismatched nucleotides, and the underlined short TTTT and AAAA sequences are used to prevent the capture and enhancement probes from being extended by PCR because these sequences are not complementary to the target sequence. In the experiment, the "G12D" gBIock gene fragment was used to simulate the mutant G12D Kras DNA, and the "wild type" gBIock gene fragment was used to simulate the wild type DNA. An artificial DNA sample containing mutant G12DKras DNA was prepared by mixing the "G12D" gBIock gene fragment and the "wild type" gBIock gene fragment at a ratio of 1 / 50 (i.e., the ratio of mutant to wild type DNA is 2%). The primers used for PCR and Sanger sequencing are the same as those listed in Table 1, and the remaining experimental conditions are similar to Example 7. Fig.14 The mutant nucleotide T indicated by the arrow can be clearly seen in (D), indicating that mutant G12D DNA is successfully enriched by the probe compositions, systems and methods of the present invention when both the capture and boost probes used contain five (5) mismatched nucleotides.

[0262] Reference to a "Sequence Listing" submitted as an XML file

[0263] This invention references material contained in an XML file named "GLC-65843WO-Sequence-Listing.xml," which was created on August 12, 2023 and is 45,056 bytes in size.

Claims

1. A nucleic acid probe composition for enriching, extracting and detecting variant target nucleic acids in a sample containing variant target nucleic acids and reference target nucleic acids, wherein the variant target nucleic acid and the reference target nucleic acid each comprise a nucleic acid chain segment having a 5' end, a 3' end and a nucleic acid sequence, and the nucleic acid sequences of the chain segments of the variant target nucleic acid and the reference target nucleic acid are identical except that the nucleic acid sequence of the variant target nucleic acid chain segment comprises a substitution, insertion or deletion of 1 to 100 nucleotides or a combination thereof relative to the nucleic acid sequence of the reference target nucleic acid chain segment, the composition comprising: (a) a capture probe comprising a single-stranded oligonucleotide having a 5' end and a 3' end, and comprising a variant target domain, and a 5' upstream toehold domain or a 3' downstream toehold domain adjacent to the variant target domain; and (b) an enhancement probe comprising a single-stranded oligonucleotide having a 5' end and a 3' end and comprising a reference target domain and a 3' downstream toehold domain or a 5' upstream toehold domain adjacent to the reference target domain, wherein (i) the nucleic acid sequence of the 5' upstream toehold domain is the reverse complementary sequence of the 3' subsequence of the nucleic acid sequence extending from the 3' end of the strand segment of the variant target nucleic acid or the reference target nucleic acid; (ii) the nucleic acid sequence of the 3' downstream toehold domain is the reverse complementary sequence of the 5' subsequence of the nucleic acid sequence extending from the 5' end of the strand segment of the variant target nucleic acid or the reference target nucleic acid; (iii) the nucleic acid sequence of the variant target domain is the reverse complementary sequence of the middle subsequence of the strand segment of the variant target nucleic acid, the middle subsequence extends continuously between the 5' subsequence and the 3' subsequence of the strand segment of the variant target nucleic acid, and comprises the substitution, insertion or deletion or a combination thereof; (iv) the nucleic acid sequence of the reference target domain is the reverse complementary sequence of the middle subsequence of the strand segment of the reference target nucleic acid, the middle subsequence extends continuously between the 5' subsequence and the 3' subsequence of the strand segment of the reference target nucleic acid, and does not contain the substitution, insertion or deletion or a combination thereof; (v) if the capture probe comprises the 5' upstream toehold domain, the enhancer probe comprises the 3' downstream toehold domain, and conversely, if the capture probe comprises the 3' downstream toehold domain, the enhancer probe comprises the 5' upstream toehold domain; (vi) the nucleic acid sequences of the 5' upstream toehold domain and the 3' downstream toehold domain each comprise 2 to 100 nucleotides; and (vii) The composition does not require any other oligonucleotide complementary to the 5' subsequence, middle subsequence or 3' subsequence of the strand segment of the variant target nucleic acid or the reference target nucleic acid, and does not require any other nucleic acid complementary to the capture probe or the enhancer probe.

2. The composition according to claim 1, wherein: The single-stranded oligonucleotide of the capture probe comprises one or more of DNA, RNA, locked nucleic acid or peptide nucleic acid or a combination thereof; and The single-stranded oligonucleotide of the enhancement probe comprises one or more of DNA, RNA, locked nucleic acid or peptide nucleic acid or a combination thereof.

3. The composition of claim 1, wherein the substitution, insertion or deletion or a combination thereof comprises one or more of a single base substitution, a multiple base substitution, a single base insertion, a multiple base insertion, a single base deletion or a multiple base deletion.

4. The composition of claim 1, further comprising a guanidinium salt.

5. The composition of claim 4, wherein the guanidinium salt comprises one or more of guanidine or guanidine derivatives, wherein the structure of the guanidine derivative is (R1R2N)(R3R4N)C=N-R5, R1, R2, R3, R4 and R5 are each independently (i) hydrogen or (ii) a functional group containing 1 to 4 hydrogen-containing carbons, and the total number of carbons in R1 to R5 is less than or equal to 15.

6. The composition according to claim 4, wherein the composition is an aqueous solution, and the concentration of the guanidinium salt in the composition is 0.05 to 8M.

7. The composition of claim 1, wherein the nucleic acid sequence of the strand segment of the variant target nucleic acid or the reference target nucleic acid each comprises 15 to 400 nucleotides.

8. The composition of claim 1, wherein the variant target domain and the reference target domain each comprise 1 to 200 nucleotides.

9. The composition of claim 1, wherein the composition comprises only one capture probe specific for a single variant target nucleic acid and one enhancement probe specific for a single reference target nucleic acid.

10. The composition of claim 1, wherein the composition comprises a plurality of capture probes, each capture probe being specific for a different variant target nucleic acid, and an enhancement probe being specific for a single reference target nucleic acid.

11. A composition according to claim 1, wherein the composition comprises a plurality of capture probes and a plurality of enhancement probes, wherein each capture probe is specific to a different variant target nucleic acid, and each enhancement probe is specific to a different reference target nucleic acid, wherein each reference target nucleic acid is a reference nucleic acid for one or more variant target nucleic acids.

12. The composition of claim 1, wherein the composition does not comprise the variant target nucleic acid or the reference target nucleic acid.

13. The composition of claim 1, wherein the composition comprises one or more of the variant target nucleic acid and / or the reference target nucleic acid.

14. A composition according to claim 1, wherein the capture probe comprises at least 6 pairs of adjacent matching nucleotides relative to the nucleic acid sequence of the chain segment of the variant target nucleic acid, and the enhancement probe comprises at least 6 pairs of adjacent matching nucleotides relative to the nucleic acid sequence of the chain segment of the reference target nucleic acid.

15. The composition of claim 1, wherein the capture probe contains only nucleotides that match the nucleic acid sequence of the strand segment of the variant target nucleic acid, and the enhancement probe contains only nucleotides that match the nucleic acid sequence of the strand segment of the reference target nucleic acid.

16. The composition of claim 1, wherein the composition does not comprise any other oligonucleotide complementary to the 5' subsequence, middle subsequence or 3' subsequence of the strand segment of the variant target nucleic acid or the reference target nucleic acid, and does not comprise any other nucleic acid complementary to the capture probe or the enhancement probe.

17. A system for enriching, extracting and detecting variant target nucleic acids in a sample comprising variant target nucleic acids and reference target nucleic acids, wherein the variant target nucleic acids and the reference target nucleic acids each comprise a nucleic acid chain segment having a 5' end, a 3' end and a nucleic acid sequence, and the nucleic acid sequences of the chain segments of the variant target nucleic acid and the reference target nucleic acid are identical except that the nucleic acid sequence of the variant target nucleic acid chain segment comprises a substitution, insertion or deletion of 1 to 100 nucleotides or a combination thereof relative to the nucleic acid sequence of the reference target nucleic acid chain segment, the system comprising: (a) the composition according to claim 1; and (b) A solid, wherein the capture probe is immobilized on the surface of the solid.

18. A system for enriching, extracting and detecting variant target nucleic acids in a sample comprising variant target nucleic acids and reference target nucleic acids, wherein the variant target nucleic acids and the reference target nucleic acids each comprise a nucleic acid chain segment having a 5' end, a 3' end and a nucleic acid sequence, and the nucleic acid sequences of the chain segments of the variant target nucleic acid and the reference target nucleic acid are identical except that the nucleic acid sequence of the variant target nucleic acid chain segment comprises a substitution, insertion or deletion of 1 to 100 nucleotides or a combination thereof relative to the nucleic acid sequence of the reference target nucleic acid chain segment, the system comprising: (a) the composition according to claim 1; and (b) a solid, wherein: (i) the capture probe comprises at least one binding tag; and (ii) the solid comprises an extraction tag bound to the binding tag.

19. A method for enriching, extracting and detecting variant target nucleic acids in a sample comprising variant target nucleic acids and reference target nucleic acids, wherein the variant target nucleic acids and the reference target nucleic acids each comprise a nucleic acid chain segment having a 5' end, a 3' end and a nucleic acid sequence, and the nucleic acid sequences of the chain segments of the variant target nucleic acid and the reference target nucleic acid are identical except that the nucleic acid sequence of the variant target nucleic acid chain segment comprises a substitution, insertion or deletion of 1 to 100 nucleotides or a combination thereof relative to the nucleic acid sequence of the reference target nucleic acid chain segment, the method comprising the following steps: (1) combining the sample, capture probe and enhancement probe to form a hybridization composition; (2) incubating the hybridization composition at a certain temperature, at which the capture probe and the variant target nucleic acid can be promoted to form a hybrid, and the enhancement probe and the reference target nucleic acid can be promoted to form a hybrid through toehold replacement and / or toehold exchange; (3) separating the hybrid formed by the capture probe from the hybrid formed by the enhancement probe; (4) eluting the variant target nucleic acid from the hybrid of the capture probe and the variant target nucleic acid; and (5) detecting the variant target nucleic acid, wherein: (a) the capture probe comprises a single-stranded oligonucleotide having a 5' end and a 3' end, and comprising a variant target domain, and a 5' upstream toehold domain or a 3' downstream toehold domain adjacent to the variant target domain; and (b) the enhancement probe comprises a single-stranded oligonucleotide having a 5' end and a 3' end, and comprising a reference target domain, and a 3' downstream toehold domain or a 5' upstream toehold domain adjacent to the reference target domain, wherein (i) the nucleic acid sequence of the 5' upstream toehold domain is the reverse complementary sequence of the 3' subsequence of the nucleic acid sequence extending from the 3' end of the strand segment of the variant target nucleic acid or the reference target nucleic acid; (ii) the nucleic acid sequence of the 3' downstream toehold domain is the reverse complementary sequence of the 5' subsequence of the nucleic acid sequence extending from the 5' end of the strand segment of the variant target nucleic acid or the reference target nucleic acid; (iii) the nucleic acid sequence of the variant target domain is the reverse complementary sequence of the middle subsequence of the strand segment of the variant target nucleic acid, the middle subsequence extends continuously between the 5' subsequence and the 3' subsequence of the strand segment of the variant target nucleic acid, and comprises the substitution, insertion or deletion or a combination thereof; (iv) the nucleic acid sequence of the reference target domain is the reverse complementary sequence of the middle subsequence of the strand segment of the reference target nucleic acid, the middle subsequence extends continuously between the 5' subsequence and the 3' subsequence of the strand segment of the reference target nucleic acid, and does not contain the substitution, insertion or deletion or a combination thereof; (v) if the capture probe comprises the 5' upstream toehold domain, the enhancer probe comprises the 3' downstream toehold domain, and conversely, if the capture probe comprises the 3' downstream toehold domain, the enhancer probe comprises the 5' upstream toehold domain; (vi) the nucleic acid sequences of the 5' upstream toehold domain and the 3' downstream toehold domain each comprise 2 to 100 nucleotides; and (vii) The hybridization composition does not require any other oligonucleotides complementary to the 5' subsequence, middle subsequence or 3' subsequence of the strand segment of the variant target nucleic acid or the reference target nucleic acid, and does not require any other nucleic acid complementary to the capture probe or the enhancer probe.

20. The method of claim 19, wherein the method further comprises a step (0) prior to step (1), namely combining the sample and the capture probe to form an initial sample-capture probe composition.

21. The method of claim 19, wherein the method further comprises a step (0) prior to step (1), namely combining the sample and the enhancement probe to form an initial sample-enhancement probe composition.

22. The method of claim 19, wherein: (i) the method further comprises a step (0) before step (1), namely, immobilizing the capture probe on a solid surface; and (ii) Step (3) comprises separating the hybrid formed by the capture probe from the hybrid formed by the enhancement probe by separating the solid from the hybridization composition.

23. The method of claim 19, wherein: (i) the capture probe comprises at least one binding tag; and (ii) Step (3) comprises separating hybrids formed by the capture probes from hybrids formed by the enhancement probes by contacting the hybridization solution with a solid comprising an extraction tag that binds to the binding tag, and then separating the solid from the hybridization composition.

24. The method of claim 19, wherein step (5) comprises detecting the variant target nucleic acid by a DNA analysis method comprising one or more of real-time PCR, microarray, fragment size analysis, Sanger sequencing, next generation sequencing or digital PCR or a combination thereof.

25. The method of claim 19, wherein: The oligonucleotide of the capture probe comprises one or more of DNA, RNA, locked nucleic acid or peptide nucleic acid or a combination thereof; the oligonucleotide of the enhancement probe comprises one or more of DNA, RNA, locked nucleic acid or peptide nucleic acid or a combination thereof.

26. The method of claim 19, wherein the substitution, insertion or deletion comprises one or more of single-base substitution, multiple-base substitution, single-base insertion, multiple-base insertion, single-base deletion or multiple-base deletion.

27. The method of claim 19, wherein the hybridization solution further comprises a guanidinium salt.

28. The method of claim 27, wherein the guanidinium salt comprises one or more of guanidine or a guanidine derivative, wherein the structure of the guanidine derivative is (R1R2N)(R3R4N)C=N-R5, wherein R1, R2, R3, R4 and R5 are each independently (i) hydrogen or (ii) a functional group containing 1 to 4 hydrogen-containing carbons, and the total number of carbons in R1 to R5 is less than or equal to 15.

29. The method of claim 27, wherein the concentration of the guanidinium salt in the hybridization composition is 0.05 to 8 M.

30. The method of claim 19, wherein the nucleic acid sequence of the strand segment of the variant target nucleic acid or the reference target nucleic acid each comprises 15 to 400 nucleotides.

31. The method of claim 19, wherein the variant target domain and the reference target domain each comprise 1 to 200 nucleotides.

32. The method of claim 19, wherein the composition comprises only one capture probe specific for a single variant target nucleic acid and one enhancement probe specific for a single reference target nucleic acid.

33. The method of claim 19, wherein the composition comprises a plurality of capture probes, each capture probe being specific for a different variant target nucleic acid, and an enhancement probe being specific for a single reference target nucleic acid.

34. A method according to claim 19, wherein the composition comprises a plurality of capture probes and a plurality of enhancement probes, wherein each capture probe is specific to a different variant target nucleic acid, and each enhancement probe is specific to a different reference target nucleic acid, wherein each reference target nucleic acid is a reference nucleic acid for one or more variant target nucleic acids.

35. A method according to claim 19, wherein the capture probe comprises at least 6 pairs of adjacent matching nucleotides relative to the nucleic acid sequence of the chain segment of the variant target nucleic acid, and the enhancement probe comprises at least 6 pairs of adjacent matching nucleotides relative to the nucleic acid sequence of the chain segment of the reference target nucleic acid.

36. The method of claim 19, wherein the capture probe contains only nucleotides that match the nucleic acid sequence of the strand segment of the variant target nucleic acid, and the booster probe contains only nucleotides that match the nucleic acid sequence of the strand segment of the reference target nucleic acid.

37. The method of claim 19, wherein the hybridization composition does not require any other oligonucleotides complementary to the 5' subsequence, middle subsequence or 3' subsequence of the strand segment of the variant target nucleic acid or the reference target nucleic acid, and does not require any other nucleic acid complementary to the capture probe or the enhancement probe.

Images