Application of recombinant adeno-associated virus in intervention of expression of Bmal1
By targeting the choroid plexus of type 2/5 recombinant adeno-associated virus to intervene in the expression of Bmal1, the lack of effective treatment of Alzheimer's disease in the prior art has been solved, and the effect of improving AD-related pathology has been achieved.
Patent Information
- Application Number
- CN202411907440.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-24
- Publication Date
- 2025-03-28
AI Technical Summary
The prior art lacks effective methods for treating Alzheimer's disease (AD), especially with limited treatment methods for Bmal1.
Intervention of Bmal1 expression by targeting the choroid plexus using type 2/5 recombinant adenoassociated virus (AAV) to improve amyloid plaque deposition, Aβ pathology, and dystrophic neurite pathology.
Experimental results show that by intervening in the expression of choroid plexus Bmal1, amyloid plaque deposition, Aβ pathology and dystrophic neurite pathology can be alleviated in AD model mice, thus providing a new way of treating AD.
Smart Images
Figure CN119700836A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of virus targeted therapy, and in particular to the application of type 2 / 5 recombinant adeno-associated virus in intervening the expression of Bmal1. Background Art
[0002] Alzheimer's disease (AD) is the world's leading neurodegenerative disease, with pathological features of amyloid plaque deposition and neurofibrillary tangles in the brain. Its clinical manifestations are progressive cognitive decline1.
[0003] BMAL1 is a core gene that regulates circadian rhythms, and changes in its rhythmic expression are closely related to AD. Studies have reported that by constructing AD transgenic mice carrying the cre enzyme, interfering with the expression of BMAL1 in astrocytes can improve the Aβ pathology of AD model mice3, but there is still a lack of drugs targeting Bmal1 to treat AD. The choroid plexus is located in the roof of the third and fourth ventricles and part of the lateral ventricle wall. The choroid tissue is composed of the pia mater and its blood vessels and the ependymal epithelium. Its main function is to produce cerebrospinal fluid, transport metabolic waste and nutrients, and release ions and hormones4. The function of the choroid plexus is rhythmic, and changes in the rhythmic expression of Bmal1 in the choroid plexus are related to the pathological progression of AD5. Recombinant adeno-associated virus (AAV) type 2 / 5 can infect the choroid plexus and can interfere with the expression of related genes by carrying shRNA with specific sequences.
[0004] Therefore, it is expected that the intervention of Bmal1 expression by recombinant adeno-associated virus type 2 / 5 targeting the choroid plexus will become a new treatment method for AD. In view of this, the purpose of the present invention is to provide an application method: using recombinant adeno-associated virus type 2 / 5 to target the choroid plexus to intervene in the expression of Bmal1 to improve amyloid plaque deposition, Aβ pathology, and dystrophic neurite pathology. Summary of the invention
[0005] The purpose of the present invention is to provide an application of type 2 / 5 recombinant adeno-associated virus in intervening the expression of Bmal1, and use type 2 / 5 recombinant adeno-associated virus to target the choroid plexus to intervene in the expression of Bmal1 to improve amyloid plaque deposition, Aβ pathology, and dystrophic neurite pathology.
[0006] In order to achieve the above object, the present invention adopts the following technical solutions:
[0007] The present invention provides application of type 2 / 5 recombinant adeno-associated virus in intervening the expression of Bmal1.
[0008] Furthermore, the application method is:
[0009] The type 2 / 5 recombinant adenovirus is used to target the choroid plexus and interfere with the expression of Bmal1.
[0010] Furthermore, the target sequence of interference of the type 2 / 5 recombinant adeno-associated virus is:
[0011] CACGCAATAGATGGGAAATTT;
[0012] The shRNA sequence of the 2 / 5 type recombinant adeno-associated virus is as follows:
[0013] Justice Chain:
[0014] 5'-CACCGCACGCAATAGATGGGAAATTTCAAGAGAATTTCCCA TCTATTGCGTGTTTTTTG-3';
[0015] Antisense strand:
[0016] 5'-GATCCAAAAAACACGCAATAGATGGGAAATTCTCTTGAAAT TTCCCATCTATTGCGTGC-3'.
[0017] The present invention provides the use of type 2 / 5 recombinant adeno-associated virus in at least one of the following:
[0018] (1) Improve amyloid plaque deposition;
[0019] (2) Aβ pathology;
[0020] (3) Malnutrition neurite pathology.
[0021] The present invention has at least the following beneficial effects:
[0022] The present invention uses type 2 / 5 recombinant adeno-associated virus to target the choroid plexus to intervene in the expression of Bmal1 to improve amyloid plaque deposition, Aβ pathology, and malnutrition-induced neurite pathology; through experimental verification, when 5×FAD mice are 36 days old, the expression of choroid plexus Bmal1 is intervened by intracerebroventricular injection of type 2 / 5 recombinant adeno-associated virus to affect the function of the choroid plexus, thereby changing the progression of AD pathology; when the mice are 130 days old, pathological section staining shows that amyloid plaque deposition, Aβ pathology, and malnutrition-induced neurite pathology are improved; at the animal experimental level, it is proved that targeting the choroid plexus to interfere with the expression of Bmal1 can alleviate AD pathology, thereby providing a new idea for the treatment of AD and laying a foundation for the preparation of drugs targeting the choroid plexus to treat AD. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying any creative work.
[0024] Figure 1 The area ratios of X34 and Aβ in the brain of the control group and the experimental group.
[0025] Figure 2 is the ratio of LAMP1 to X34 in the brain of the control group and the experimental group. DETAILED DESCRIPTION
[0026] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.
[0027] The main purpose of the present invention is to provide an application of a recombinant adeno-associated virus type 2 / 5 in intervening the expression of Bmal1, specifically as follows:
[0028] A method for improving amyloid plaque deposition, Aβ pathology, and dystrophic neurite pathology by targeting the choroid plexus with a recombinant adeno-associated virus type 2 / 5. The titer of the recombinant adeno-associated virus type 2 / 5 is 5*10^12 vg / ml. The steps are as follows:
[0029] A. 5×FAD (Tg6799) was used as an AD model mouse. This strain of mice began to accumulate high levels of intraneuronal Aβ42 at around 1.5 months of age, and began to show extracellular amyloid deposition at around 2 months of age.
[0030] B. Stereotaxic injection of virus in 5×FAD mice at 36 days of age. Mice were anesthetized with isoflurane anesthesia and maintained under isoflurane supply using an anesthesia mask. Hair on the head of the mouse was removed using an electric shaver. The mouse was placed in the center of the stereotaxic apparatus, with the front teeth fixed to the front clamp and tightened to ensure stability. The ear bar was gently inserted into the ear canal to stabilize the head, avoiding damage to the inner ear by inserting too deeply. The surgical area was cleaned and disinfected, first wiped with 75% ethanol several times, and then coated with iodine. Using a scalpel, an incision was made from about 1.5 cm above the ear toward the nose, extending to about 0.5 cm below the ear, and then vertically downward to the center of the mouse head to expose the anterior bregma. After exposing the anterior bregma, the thin membrane on the surface of the skull was gently removed with a sterile cotton swab. Drill holes at the coordinate points for lateral ventricular injection until resistance is reduced, taking care to avoid drilling into the brain and causing cortical damage. Coordinate points: ML value (X axis) is -1, AP value (Y axis) is -0.3. Use a microsyringe to draw 5 microliters of virus, making sure there are no bubbles. Slowly insert the syringe into the mouse brain through the hole to a depth of 2.5 mm, and inject at a rate of 500 nl / min. After the injection is completed, leave the needle in place for about 5 minutes and then slowly lift the syringe out to ensure that the virus is fully absorbed. After the injection is completed, suture the scalp and disinfect it.
[0031] C. Take brain tissue samples when 5×FAD mice are 130 days old. Bury the conical bottle containing PBS in ice and put it into the peristaltic pump tube. Grab the mouse and inject 0.8% sodium pentobarbital intraperitoneally. After the mouse is anesthetized for a few minutes, put the mouse on a foam board and clamp the mouse's limbs with tweezers. After the mouse has no reaction, fix the mouse's limbs on the foam board with four needles. Cut the mouse's skin and ribs to expose the liver and heart, empty the air in the peristaltic pump, insert the needle on the peristaltic pump into the left ventricle, cut the right atrial appendage, and turn on the peristaltic pump. As PBS flows in, the liver and tongue become lighter in color, the liver turns brown, the tongue turns pale, and the limbs become lighter in color. After the peristaltic pump perfuses 65 ml of PBS, remove the mouse and cut off the mouse's head with scissors. Cut two cuts along the two ends of the mouse's ear pit from the foramen magnum, and then cut one cut along the sagittal suture at the foramen magnum. Slightly insert the scissors into the bone suture where the mouse olfactory bulb is located, open the scissors from the coronal direction of the mouse to break open the skull, use forceps to cut the neural connection at the bottom of the mouse brain, and take out the mouse brain and put it on an ice box. Take the left hemibrain and fix it in 4% PFA. After 24 hours, replace 4% PFA with 30% sucrose.
[0032] D. Use a flat-push microtome to make frozen sections of the mouse brain. Place an appropriate amount of dry ice on the microtome tray to create a low-temperature freezing environment, freeze the bottom of the mouse brain on the tray with PBS, slice the brain slices from the olfactory bulb to the appearance of the cerebellum with a thickness of 50 microns per slice, place the cut brain slices in a 24-well plate filled with freezing solution, and store the 24-well plate with brain slices in a -20℃ environment.
[0033] E.X34 staining: Use X34 dye to mark amyloid plaque deposits. Permeabilize tissue with TBS-0.25% TritonX-100 for 30 minutes at room temperature; prepare sufficient staining buffer: 40% ethanol, 60% TBS, 10NNaOH by volume at 1:500; dilute the 10mM concentration of X-34 DMSO stock solution with the above staining buffer at a ratio of 1:5000; incubate tissue in X-34 / staining buffer at room temperature for 20 minutes; wash 3 times with 40% ethanol + 60% TBS, 2 minutes each wash; wash 3 times in 1X TBS, 5 minutes each wash.
[0034] F. Staining of Aβ and dystrophic neurites: The brain slices after X34 staining were immersed in 5% BSA for 1 hour; Aβ was labeled with 6E10 antibody, and dystrophic neurites were labeled with LAMP1 antibody. Prepare primary antibody staining solution: Aβ primary antibody and LAMP1 primary antibody were diluted in 5% BSA at a ratio of 1:500; the blocked brain slices were immersed in the primary antibody staining solution and incubated overnight at 4°C for 12 hours; the brain slices were picked out of the primary antibody staining solution and washed in PBS for 3 times, 5 minutes each time; prepare secondary antibody staining solution: donkey anti-mouse secondary antibody and donkey anti-rat secondary antibody were diluted in PBS at a ratio of 1:500; the washed brain slices were immersed in the secondary antibody staining solution and incubated at room temperature for 1 hour; the brain slices were picked out of the secondary antibody staining solution and washed in PBS for 3 times, 5 minutes each time.
[0035] The washed brain slices were attached to the slides one by one, dried and placed in pure water for a few seconds to wash away the salt solution, dried again and then dripped with sealing agent on the slides, and the cover glass was slowly lowered to cover the brain slices, and nail polish was applied around the cover glass to fix the cover glass. The preparation of the pathological tissue specimen was completed.
[0036] The following will be combined with the accompanying drawings Figure 1 and Figure 2 , Figure 1 The area ratios of X34 and Aβ in the brain of the control group and the experimental group. Figure 2 The ratio of LAMP1 to X34 in the brain of the control group and the experimental group is shown in Table 1. The effect of type 2 / 5 recombinant adeno-associated virus interfering with choroid plexus Bmal1 in the treatment of AD and its effects are described as follows:
[0037] The type 2 / 5 recombinant adeno-associated virus in the present invention was customized by Wuhan Shumi Brain Science Technology Co., Ltd.; X34 was purchased from Sigma-Aldrich, item number: SML1954; 6E10 antibody was purchased from Covance, item number: #9320-500; LAMP1 antibody was purchased from Developmental Studies Hybridoma Bank, item number: #1D4B; mounting medium was purchased from Thermo Fisher, item number: P36934; isoflurane was purchased from Reward, model R510-22-10; anesthesia evaporator was purchased from Reward, model: R583S; stereotaxic instrument was purchased from Reward, model: 68507; flat push slicer was purchased from Leica, model: SM2010R; peristaltic pump was purchased from Shenchen Fluid Technology Co., Ltd., model: LabV6-Ⅲ; confocal microscope was purchased from Olympus, model: Olympus / Spin SR; The mice used in the experiment were bred and raised at the Animal Experiment Center of Chongqing Medical University and maintained in a light-dark alternating environment of 12 hours of light and 12 hours of darkness.
[0038] Use type 2 / 5 recombinant adeno-associated virus to target the choroid plexus to intervene in the expression of Bmal1 to improve amyloid plaque deposition, Aβ pathology, and dystrophic neurite pathology. The specific steps are as follows:
[0039] A. 5×FAD (Tg6799) was used as an AD model mouse. This strain of mice began to accumulate high levels of intraneuronal Aβ42 at around 1.5 months of age, and extracellular amyloid protein deposition began to appear at around 2 months of age. 5×FAD mice were bred at the Animal Experimental Center of Chongqing Medical University, and the resulting mice were randomly assigned to the control group and the experimental group.
[0040] B. Design the AAV element structure, determine the required serology is type 2 / 5, entrust Wuhan Shumi Brain Science Technology Co., Ltd. to manufacture AAV, the target sequence of interference is CACGCAATAGATGGGAAATTT, the AAV titer is 5*10^12vg / ml, the AAV structure is: experimental group rAAV-U6-shRNA (Bmal1)-CMV-EGFP-SV40-polyA, control group rAAV-U6-shRNA (Screamble)-CMV-EGFP-SV40-polyA, shDNA sequence is:
[0041] S:
[0042] 5'-CACCGCACGCAATAGATGGGAAATTTCAAGAGAATTTCCCAT CTATTGCGTGTTTTTTG-3'
[0043] A:
[0044] 5'-GATCCAAAAAACACGCAATAGATGGGAAATTCTCTTGAAATT TCCCATCTATTGCGTGC-3'
[0045] C. Stereotaxic injection of virus in 5×FAD mice at 36 days of age. Mice were anesthetized with isoflurane anesthesia and maintained under isoflurane supply using an anesthesia mask. Hair on the head of the mouse was removed using an electric shaver. The mouse was placed in the center of the stereotaxic apparatus, with the front teeth fixed to the front clamp and tightened to ensure stability. The ear bar was gently inserted into the ear canal to stabilize the head, avoiding damage to the inner ear by inserting too deeply. The surgical area was cleaned and disinfected, first wiped with 75% ethanol several times, and then coated with iodine. Using a scalpel, an incision was made from about 1.5 cm above the ear toward the nose, extending to about 0.5 cm below the ear, and then vertically downward to the center of the mouse head to expose the anterior bregma. After exposing the anterior bregma, the thin membrane on the surface of the skull was gently removed with a sterile cotton swab. Drill holes at the coordinate points for lateral ventricle injection until resistance is reduced, taking care to avoid drilling into the brain and causing cortical damage. Coordinate points: ML value (X axis) is -1, AP value (Y axis) is -0.3. Use a microsyringe to draw 5 microliters of virus, making sure there are no bubbles. Slowly insert the syringe into the mouse brain through the hole to a depth of 2.5 mm, and inject at a rate of 500 nl / min. After the injection is completed, leave the needle in place for about 5 minutes and then slowly lift the syringe out to ensure that the virus is fully absorbed. After the injection is completed, suture the scalp and disinfect it.
[0046] D. Take brain tissue samples when the 5×FAD mice are 130 days old. Bury the conical bottle containing PBS in ice and put it into the peristaltic pump tube. Grab the mouse and inject 0.8% sodium pentobarbital intraperitoneally. After the mouse is anesthetized for a few minutes, put the mouse on a foam board and clamp the mouse's limbs with tweezers. After the mouse has no reaction, fix the mouse's limbs on the foam board with four needles. Cut the mouse's skin and ribs to expose the liver and heart, empty the air in the peristaltic pump, insert the needle on the peristaltic pump into the left ventricle, cut the right atrial appendage, and turn on the peristaltic pump. As PBS flows in, the liver and tongue become lighter in color, the liver turns brown, the tongue turns pale, and the limbs become lighter in color. After the peristaltic pump perfuses 65 ml of PBS, remove the mouse and cut off the mouse's head with scissors. Cut two cuts along the two ends of the mouse's ear pit from the foramen magnum, and then cut one cut along the sagittal suture at the foramen magnum. Slightly insert the scissors into the bone suture where the mouse olfactory bulb is located, open the scissors from the coronal direction of the mouse to break open the skull, use forceps to cut the neural connection at the bottom of the mouse brain, and take out the mouse brain and put it on an ice box. Take the left hemibrain and fix it in 4% PFA. After 24 hours, replace 4% PFA with 30% sucrose.
[0047] E. Use a flat-push microtome to make frozen sections of the mouse brain. Place an appropriate amount of dry ice on the microtome tray to create a low-temperature freezing environment, freeze the bottom of the mouse brain on the tray with PBS, slice the brain slices from the olfactory bulb to the appearance of the cerebellum with a thickness of 50 microns per slice, place the cut brain slices in a 24-well plate filled with freezing solution, and store the 24-well plate with brain slices in a -20℃ environment.
[0048] F.X34 staining: Use X34 dye to mark amyloid plaque deposits. Permeabilize tissue with TBS-0.25% TritonX-100 for 30 minutes at room temperature; prepare sufficient staining buffer: 40% ethanol, 60% TBS, 10NNaOH by volume at 1:500; dilute the 10mM concentration of X-34 DMSO stock solution with the above staining buffer at a ratio of 1:5000; incubate tissue in X-34 / staining buffer at room temperature for 20 minutes; wash 3 times with 40% ethanol + 60% TBS, 2 minutes each wash; wash 3 times in 1X TBS, 5 minutes each wash.
[0049] G. Staining of Aβ and dystrophic neurites: The brain slices after X34 staining were immersed in 5% BSA for 1 hour; Aβ was labeled with 6E10 antibody, and dystrophic neurites were labeled with LAMP1 antibody. Preparation of primary antibody staining solution: Aβ primary antibody and LAMP1 primary antibody were diluted in 5% BSA at a ratio of 1:500; the blocked brain slices were immersed in the primary antibody staining solution and incubated overnight at 4°C for 12 hours; the brain slices were picked out of the primary antibody staining solution and washed in PBS for 3 times, 5 minutes each time; preparation of secondary antibody staining solution: donkey anti-mouse secondary antibody and donkey anti-rat secondary antibody were diluted in PBS at a ratio of 1:500; the washed brain slices were immersed in the secondary antibody staining solution and incubated at room temperature for 1 hour; the brain slices were picked out of the secondary antibody staining solution and washed in PBS for 3 times, 5 minutes each time.
[0050] H. Stick the washed brain slices onto the slides one by one, dry them and place them in pure water for a few seconds to wash off the salt solution, dry them again and drop the sealing agent on the slides, slowly lower the cover glass to cover the brain slices, and apply nail polish around the cover glass to fix the cover glass. The preparation of the pathological tissue specimen is completed.
[0051] I. Use an Olympus confocal microscope to perform scanning imaging of immunofluorescence staining and obtain scanning images of pathological tissues.
[0052] J. Confocal scan images were analyzed using Image J 1.46r software, and statistical data were calculated using Graphpad Pism9.5.
[0053] Combination Figure 1 and Figure 2The final statistical results showed that compared with the control group, the area ratio of X34 in the brain of the experimental group mice was reduced, the area ratio of Aβ was reduced, and the value of LAMP1 / X34 was reduced in the female mice of the experimental group. Recombinant adeno-associated virus type 2 / 5 targeted the choroid plexus to intervene in the expression of Bmal1 to improve amyloid plaque deposition, Aβ pathology, and dystrophic neurite pathology.
[0054] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions only describe the principles of the present invention. The present invention may be subject to various changes and improvements without departing from the spirit and scope of the present invention. These changes and improvements fall within the scope of the present invention. The scope of protection claimed by the present invention is defined by the attached claims and their equivalents.
Claims
Application of recombinant adeno-associated virus type 1.2 / 5 in intervening in the expression of Bmal1.
2. The use according to claim 1, characterized in that: The application method is: The expression of Bmal1 was interfered by targeting the choroid plexus through type 2 / 5 recombinant adenovirus.
3. The use according to claim 1, wherein the target sequence of interference of the type 2 / 5 recombinant adeno-associated virus is: CACGCAATAGATGGGAAATTT; The shRNA sequence of the 2 / 5 recombinant adeno-associated virus is as follows: Justice Chain: 5'-CACCGCACGCAATAGATGGGAAATTTCAAGAGAATTTCCCATCTATTGCGTGTTTTTTG-3'; Antisense strand: 5'-GATCCAAAAAACACGCAATAGATGGGAAATTCTCTTGAAAT TTCCCATCTATTGCGTGC-3'. Use of recombinant adeno-associated virus type 4.2 / 5 in at least one of the following: (1) Improve amyloid plaque deposition; (2) Aβ pathology; (3) Malnutrition neurite pathology.