Type II polyketone compound and preparation method thereof

Abstract

The invention discloses a type II polyketone compound and a preparation method thereof. According to the present invention, discovery and separation identification of Xylanmycin are achieved by overexpressing a streptomycete antibiotic regulatory factor (SARP) in a silent gene cluster xy1 in actinomycete Amycolaopsis xylanica KCTC 19581, the molecular formula of the Xylanmycin is C31H36O15, the chemical structure is represented by formula (I): # imgabs0 #, the novel type-2 polyketone compound xylanmycin is discovered and identified, the compound has a unique chemical structure, the molecular formula is C31H36O15, and the compound can be used for the preparation of the novel type-2 polyketone compound, such that the novel type-2 polyketone compound can be used for the preparation of the novel type-2 polyketone compound, such that the novel type-2 polyketone compound, such that the novel type-2 A new active substance is provided for the field of medicine.

Description

Technical Field

[0001] The present invention relates to the field of medical technology, and in particular to a novel type II polyketide compound (named by the inventor as xylanmycin) produced by actinomycete Amycolatopsis xylanica KCTC19581 and a preparation method thereof. Background Art

[0002] Aromatic polyketides (type II polyketides) are important and structurally diverse bacterial secondary metabolites. The "minimal PKS" composed of β-ketoacyl synthase (ketosynthase, KSα), chain length factor (CLF) and acyl carrier protein (ACP) iteratively catalyzes the decarboxylation Claisen condensation of the initiator unit and the extension unit to form polyketide linear intermediates of different lengths, which fold in different ways under the action of aromatase and cyclase to form products with diverse ring systems, and then are modified by post-modification enzymes such as glycosyltransferases and oxidoreductases to form a complex and diverse class of natural products. Aromatic polyketides are an important component of small molecule chemical drugs. Many aromatic polyketides or their semi-synthetic derivatives have become clinically used drugs or promising candidate drugs, such as the broad-spectrum antibiotic tetracycline, the antitumor drug epirubicin, and mithramycin with good antitumor activity.

[0003] Actinomycetes are rich in resources and have strong biosynthetic capabilities. They are an important source of type II polyketide antibiotics such as tetracycline and daunorubicin. The inventors have found that Amycolatopsisxylanica KCTC 19581 can produce a new type II polyketide compound by using extensive screening and activation of silent gene clusters. Its antibacterial and anticancer activities are still being tested, and it is urgent to provide patent protection for its source, preparation method and structure. Summary of the invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a novel type II polyketide compound xylanmycin and a preparation method thereof.

[0005] In order to achieve the above application objectives, the technical solutions adopted in this application are as follows: In the first aspect, this application provides a novel type II polyketone compound. In the second aspect, this application provides a preparation method of the prepared type II polyketone compound.

[0006] In a first aspect, the present application provides a type II polyketone compound, the chemical structure of the type II polyketone compound is shown in formula (I):

[0007]

[0008] The second aspect of the present application provides a method for preparing a type II polyketone compound, characterized by comprising the following steps:

[0009] (1) The actinomycete Amycolatopsis xylanica KCTC 19581 strain was cultured on MS plates at 30°C for 3 days;

[0010] (2) cutting the culture obtained in step (1) into 50 mL of tryptone soy broth (TSB) medium, culturing at 30° C. and 220 rpm for 2 days, collecting the cells, and extracting the genome;

[0011] (3) PCR amplification of the target SARP gene: using the genome extracted in step (2) as a template, add 2 μL of 10 mM dNTP; 5 μL of 10 μM upstream and downstream primers; 1 μL of Phanta Super-Fidelity DNA Polymerase, 50 μL of 2×Phanta Max Buffer; 5 μL of DMSO, add sterile water to 100 μL, mix well, and divide into eight PCR tubes. The PCR reaction program is: 95°C for 3 min, 95°C for 15 s, 58°C for 15 s, 72°C for 1 min, continue for 34 cycles, 72°C for 10 min, and recover the product gel for later use;

[0012] (4) Ligation: Add 1 μL of the product recovered in step (3), 1 μL of the linearized pSET152 plasmid, 5 μL of multi-fragment ligase 2*CE mix, and ddH2O to make up to 10 μL, incubate at 37°C for 30 min, transform into E. coli DH5α for plasmid amplification, extract the plasmid, and verify whether it is correct by restriction digestion;

[0013] (5) The correct plasmid was transformed into E. coli ET12567 after restriction digestion, and then transferred into wild-type Amycolatopsis xylanica KCTC 19581 and plated in 60 mM Ca 2+ After culturing at 30°C for 16 hours on MS plates, cover the plate surface with sterile water containing apramycin and nalidixic acid, continue culturing for 3-6 days until a single clone grows, and purify the grown positive clone on MS plates with apramycin.

[0014] (6) The purified strain was inoculated into 250 mL of tryptone soy broth (TSB) medium and cultured at 30°C and 220 rpm for 2 days;

[0015] (7) inoculating the seed solution cultured in step (6) into a rice culture medium and culturing at 30° C. for 8 days;

[0016] (8) The solid fermentation product obtained in step (7) was transferred to a bucket, extracted three times with an equal amount of ethyl acetate, and concentrated under reduced pressure to obtain a crude paste F1;

[0017] (9) The crude paste F1 was separated using a medium pressure liquid chromatography (MPLC) system using a Biotage SNAP Ultra C18 column (60 g) to obtain a total of 32 components;

[0018] (10) HPLC detected the target absorption in the 12-15 segment. After concentration, it was separated and purified by semi-preparative HPLC to obtain 4.2 mg of the target compound, a novel type II polyketide compound, which was named xylanmycin.

[0019] Xylanmycin compound structure analysis: yellow amorphous powder, high-resolution electrospray ionization mass spectrometry (HR-ESI-MS) test shows that its molecular ion peak m / z is 647.1956 [MH] - The molecular formula is estimated to be C 31 H 36 O 15 (The calculated value is 647.2054 [MH] - ), with an unsaturation of 14.

[0020] Furthermore, in step (1), the strain is an actinomycete strain, the deposited name is Amycolatopsisxylanica KCTC 19581, deposited in the Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences, and the deposited address is China Pharmaceutical Microbiological Culture Collection Center CPCC; deposit date: January 8, 2009; deposit number: CPCC 202699T.

[0021] Furthermore, in step (5), the culture condition of the SARP complementation strain is 30° C. for 3 days.

[0022] Furthermore, in step (9), the MPLC chromatographic conditions are: using a reverse phase chromatographic column Biotage SNAP Ultra C18 column 60 g, mobile phase A: water, mobile phase B: acetonitrile, and a gradient elution program: the mass percentage of mobile phase B is 20%-100%, the flow rate is 55 mL / min, and 12 column volumes; 100% mobile phase B, 4 column volumes.

[0023] Further, in step (10), the HPLC separation and purification process is as follows: HPLC semi-preparative reverse phase high performance liquid chromatography RR-HPLC Agilent1200 HPLC: Agilent Eclipse XDB-C18 reverse column (9.4×250mm, 5μm, AgilentTechonologies), the mobile phase is: 31% acetonitrile, with a gradient elution at a flow rate of 2.2mL / min for 12 minutes; the pump model can be Hitachi pump L-7100, and the ultraviolet lamp model can be UV detector L-7400.

[0024] Beneficial effects: The present invention discovered and identified a new type of di-polyketide compound xylanmycin, which has a unique chemical structure and a molecular formula of C 31 H 36 O 15 , providing a new active substance for the medical field.

[0025] Compared with the prior art, the present invention has the following advantages:

[0026] (1) The present invention develops an innovative preparation method, which realizes the discovery and isolation and identification of xylanmycin by overexpressing the Streptomyces antibiotic regulatory factor (SARP) in the silent gene cluster xyl in the actinomycete Amycolatopsisxylanica KCTC 19581. This method provides a new technical means for activating silent gene clusters and discovering new compounds.

[0027] (2) The preparation method of the present invention includes a series of detailed steps, from culturing actinomycetes, extracting genomes, PCR amplification, ligation, transformation, fermentation, extraction to chromatographic separation and purification, which provides a feasible process flow for the large-scale production of xylanmycin.

[0028] (3) The present invention realizes the efficient separation and purification of xylanmycin through medium pressure liquid chromatography (MPLC) system and semi-preparative HPLC separation and purification technology, thereby improving the recovery rate and purity of the target compound.

[0029] (4) The present invention provides a detailed analysis of the structure of xylanmycin, including high-resolution electrospray ionization mass spectrometry (HR-ESI-MS) and nuclear magnetic resonance (NMR) data, which provides a scientific basis for further research on its properties and applications.

[0030] (5) The present invention verifies the feasibility and repeatability of the method of the present invention through test examples and embodiments, and provides a reference for actual production and application. The novel type II polyketide compound xylanmycin and its preparation method of the present invention provide potential application prospects for the development of new antibiotics, anti-tumor drugs, etc., and help promote the research and development and innovation of related pharmaceutical products. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0032] Figure 1-Figure 7 The xylanmycin nuclear magnetic resonance data and mass spectrum data spectrum of the present invention are shown. DETAILED DESCRIPTION

[0033] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0034] In this application, the term "and / or" describes the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B can mean: A exists alone, A and B exist at the same time, and B exists alone. A and B can be singular or plural. The character " / " generally indicates that the associated objects are in an "or" relationship.

[0035] In the present application, "at least one" means one or more, and "plurality" means two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single items or plural items. For example, "at least one of a, b, or c", or "at least one of a, b, and c" can all represent: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, and c can be single or multiple, respectively.

[0036] The first aspect of the embodiment of the present application provides a prepared type II polyketone compound, and the chemical structure of the type II polyketone compound is shown in formula (I):

[0037]

[0038] The second aspect of the embodiment of the present application provides a method for preparing a type II polyketone compound, comprising the following steps:

[0039] (1) culturing the actinomycete Amycolatopsis xylanica KCTC19581 strain according to claim 1 on an MS plate and culturing at 30° C. for 3 days;

[0040] (2) cutting the culture obtained in step (1) into 50 mL of tryptone soy broth (TSB) medium, culturing at 30° C. and 220 rpm for 2 days, collecting the cells, and extracting the genome;

[0041] (3) PCR amplification of the target SARP gene: using the genome extracted in step (2) as a template, add 2 μL of 10 mM dNTP; 5 μL of 10 μM upstream and downstream primers; 1 μL of Phanta Super-Fidelity DNA Polymerase, 50 μL of 2×Phanta Max Buffer; 5 μL of DMSO, add sterile water to 100 μL, mix well, and divide into eight PCR tubes. The PCR reaction program is: 95°C for 3 min, 95°C for 15 s, 58°C for 15 s, 72°C for 1 min, continue for 34 cycles, 72°C for 10 min, and recover the product gel for later use;

[0042] (4) Ligation: Add 1 μL of the product recovered in step (3), 1 μL of the linearized pSET152 plasmid, 5 μL of multi-fragment ligase 2*CE mix, and ddH2O to make up to 10 μL, incubate at 37°C for 30 min, transform into E. coli DH5α for plasmid amplification, extract the plasmid, and verify whether it is correct by restriction digestion;

[0043] (5) The correct plasmid was transformed into E. coli ET12567 after restriction digestion, and then transferred into wild-type Amycolatopsis xylanica KCTC 19581 and plated in 60 mM Ca 2+ After culturing at 30°C for 16 hours on MS plates, cover the plate surface with sterile water containing apramycin and nalidixic acid, continue culturing for 3-6 days until a single clone grows, and purify the grown positive clone on MS plates with apramycin.

[0044] (6) The purified strain was inoculated into 250 mL of tryptone soy broth (TSB) medium and cultured at 30°C and 220 rpm for 2 days;

[0045] (7) inoculating the seed solution cultured in step (6) into a rice culture medium and culturing at 30° C. for 8 days;

[0046] (8) The solid fermentation product obtained in step (7) was transferred to a bucket, extracted three times with an equal amount of ethyl acetate, and concentrated under reduced pressure to obtain a crude paste F1;

[0047] (9) The crude paste F1 was separated using a medium pressure liquid chromatography (MPLC) system using a Biotage SNAP Ultra C18 column (60 g) to obtain a total of 32 components;

[0048] (10) HPLC detected the target absorption in the 12-15 segment, which was concentrated and separated and purified by semi-preparative HPLC to obtain the target compound, a novel type II polyketide compound, named xylanmycin;

[0049] Xylanmycin compound structure analysis: yellow amorphous powder, high-resolution electrospray ionization mass spectrometry (HR-ESI-MS) test shows that its molecular ion peak m / z is 647.1956 [MH] - The molecular formula is estimated to be C 31 H 36 O 15 (The calculated value is 647.2054 [MH] - ), with an unsaturation of 14.

[0050] In some embodiments, in step (1), the strain is an actinomycete strain, the deposited name is Amycolatopsis xylanica KCTC 19581, deposited in the Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences, and the deposited address is China Pharmaceutical Microbiological Culture Collection Center CPCC; deposit date: January 8, 2009; deposit number: CPCC 202699T.

[0051] In some embodiments, in step (5), the culture condition of the SARP complementing strain is 30° C. for 3 days.

[0052] In some embodiments, in step (9), the MPLC chromatographic conditions are: using a reverse phase chromatography column Biotage SNAP Ultra C18 column (60 g), mobile phase A: water, mobile phase B: acetonitrile, and a gradient elution program: the mass percentage of mobile phase B is 20%-100%, the flow rate is 55 mL / min, and 12 column volumes; 100% mobile phase B, 4 column volumes.

[0053] In some embodiments, in step (10), the HPLC separation and purification process is as follows: HPLC semi-preparative reverse phase high performance liquid chromatography RR-HPLC Agilent1200 HPLC: Agilent Eclipse XDB-C18 reverse column (9.4×250mm, 5μm, Agilent Technologies), the mobile phase is: 31% acetonitrile, gradient elution at a flow rate of 2.2mL / min for 12 minutes; the pump model can be Hitachi pump L-7100, and the ultraviolet lamp model can be UV detector L-7400.

[0054] Example 1

[0055] The novel type II polyketide compound xylanmycin of the present invention has a chemical structural formula as shown in formula (I):

[0056]

[0057] The preparation method of the novel type II polyketide compound xylanmycin of the present invention comprises the following steps:

[0058] (1) The actinomycete Amycolatopsis xylanica KCTC 19581 strain was cultured on MS plates at 30°C for 3 days;

[0059] (2) cutting the culture obtained in step (1) into 50 mL of tryptone soy broth (TSB) medium, culturing at 30° C. and 220 rpm for 2 days, collecting the cells, and extracting the genome;

[0060] (3) PCR amplification of the target SARP gene: using the genome extracted in step (2) as a template, add 2 μL of 10 mM dNTP; 10 μM upstream and downstream primers (19581-SARP-F: gtactagtctgacatatgcatcgcgtgcataggttc, 19581-SARP-R: tgacatgattacgaattcctggcgcgcaaagaaagc) 5 μL each; 1 μL of Phanta Super-Fidelity DNA Polymerase; 50 μL of 2×Phanta Max Buffer; 5 μL of DMSO; add sterile water to 100 μL, mix well, and dispense into eight PCR tubes. PCR reaction program: 95°C 3 min, 95°C 15 s, 58°C 15 s, 72°C 1 min, continue 34 cycles, 72°C 10 min, recover the product gel and set aside.

[0061] (4) Ligation: Add 1 μL of the product recovered in step (3), 1 μL of the linearized pSET152 plasmid, 5 μL of multi-fragment ligase 2*CE mix, and ddH2O to make up to 10 μL. Incubate at 37°C for 30 min, and transform into E. coli DH5α for plasmid amplification. Extract the plasmid and verify whether it is correct by restriction digestion.

[0062] (5) The correct plasmid was transformed into E. coli ET12567 after restriction digestion, and then transferred into wild-type Amycolatopsis xylanica KCTC 19581 and plated in 60 mM Ca 2+ After inverted culture at 30°C for 16 hours, cover the surface of the plate with sterile water containing apramycin and nalidixic acid, continue to culture for 3-6 days until a single clone grows, and purify the grown positive clone on the MS plate with apramycin.

[0063] (6) The purified strain was selected and inoculated into 250 mL of tryptone soy broth (TSB) medium and cultured at 30°C and 220 rpm for 2 days to serve as seed solution.

[0064] (7) The seed solution cultured in step (6) was inoculated into a rice culture medium and cultured at 30° C. for 8 days.

[0065] (8) The solid fermentation product obtained in step (7) was transferred to a bucket, extracted three times with an equal amount of ethyl acetate, and concentrated under reduced pressure to obtain a crude paste F1;

[0066] (9) The crude paste F1 was separated using a medium pressure liquid chromatography (MPLC) system using a Biotage SNAP Ultra C18 column (60 g) to obtain a total of 32 components.

[0067] (10) HPLC detected the target absorption in segments 11-14. After concentration, semi-preparative HPLC separation and purification were performed to obtain the target compound, which was named xylanmycin.

[0068] Xylanmycin compound structure analysis: yellow amorphous powder, high-resolution electrospray ionization mass spectrometry (HR-ESI-MS) test shows that its molecular ion peak m / z is 647.1956 [MH] - The molecular formula is estimated to be C 31 H 36 O 15 (The calculated value is 647.2054 [MH] - ), with an unsaturation of 14.

[0069] The strain of the present invention was purchased from the collection center. Aerobic bacteria, spore-forming bacteria, Gram-positive bacteria; collection name: Amycolatopsis xylanica KCTC 19581; collection number: CPCC 202699; collection location: China Pharmaceutical Microbiological Culture Collection Center (CPCC), China, Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences; collection date: January 8, 2009.

[0070] The invention discloses an Amycolatopsis xylanica KCTC 19581 strain bacterial agent prepared by using the Amycolatopsis xylanica KCTC 19581 strain.

[0071] Example 2

[0072] The difference between Example 2 and Example 1 is that the method for preparing the novel type II polyketide compound xylanmycin of the present invention comprises the following steps:

[0073] In step (5), the culture conditions of the SARP complementation strain are 30° C. for 3 days.

[0074] In step (10), the MPLC chromatographic conditions are: using a 60 g reverse phase chromatography column Biotage SNAP Ultra C18 column (60 g), mobile phase A: water, mobile phase B: acetonitrile, and a gradient elution program: the volume percentage of mobile phase B is 20%-100%, the flow rate is 55 mL / min, and 12 column volumes; the volume percentage of mobile phase B is 100%, the flow rate is 55 mL / min, and 4 column volumes.

[0075] In step (10), the HPLC separation and purification process is as follows: HPLC semi-preparative reverse phase high performance liquid chromatography RR-HPLC Agilent 1200 HPLC: Agilent Eclipse XDB-C18 reverse phase column (9.4×250 mm, 5 μm, Agilent Technologies), the mobile phase is: 31% acetonitrile, with a gradient elution at a flow rate of 2.2 mL / min for 12 minutes; the pump model can be Hitachi pump L-7100, and the ultraviolet lamp model can be UV detector L-7400.

[0076] Test Example 1

[0077] Activation of Amycolatopsis xylanica KCTC 19581 strain.

[0078] The freeze-dried powder of the actinomycete Amycolatopsis xylanica KCTC 19581 strain was spread on MS plate culture medium (20 g soybean powder, 20 g mannitol, 20 g agar, 1 L distilled water) and cultured in a 30°C incubator for 3 days until mycelium grew out. On the MS plate, the mycelium in the base was white at the beginning of the culture, and a single colony was produced. After 3 days, the mycelium in the base turned red, and the aerial mycelium turned white.

[0079] Test Example 2

[0080] Fermentation of actinomycete Amycolatopsis xylanica KCTC 19581 in rice medium.

[0081] The actinomycete Amycolatopsis xylanica KCTC 19581 was inoculated into 250 mL of tryptone soy broth (TSB) medium, and cultured at 30° C., 220 rpm for 2-3 days as seed solution. The cultured seed solution was inoculated into rice medium (33 g of rice + 50 mL of SSM liquid, wherein the SSM liquid includes 20 g of bean cake powder, 10 g of sucrose, 1 g of skim milk powder, 1 g of dipotassium hydrogen phosphate, 3 g of calcium carbonate, 0.1 g of ferrous sulfate heptahydrate, and 1 L of water), and cultured at 30° C. for 8 days.

[0082] Test Example 3

[0083] Extraction and separation of xylanmycin.

[0084] The rice culture medium obtained in Test Example 2 was extracted 3 times with ethyl acetate and concentrated under reduced pressure to obtain crude paste F1. The crude paste F1 was separated using a medium pressure liquid chromatography (MPLC) system with a Biotage SNAP Ultra C18 column (60 g), mobile phase A: water, mobile phase B: acetonitrile, and the gradient elution program was: the volume percentage of mobile phase B was 20%-100%, the flow rate was 55 mL / min, and eluted 12 column volumes; the volume percentage of mobile phase B was 100%, the flow rate was 55 mL / min, and eluted 4 column volumes, and a total of 32 components were obtained. HPLC detected that the target absorption was detected in the 11th to 14th sections, and after concentration, it was separated and purified by semi-preparative HPLC to obtain 5.4 mg of the target compound. The HPLC separation and purification process is as follows: HPLC semi-preparative reverse phase high performance liquid chromatography RR-HPLC Agilent 1200 HPLC: Agilent Eclipse XDB-C18 reverse column (9.4×250 mm, 5 μm, Agilent Technologies), the mobile phase is: 31% acetonitrile, with a gradient elution at a flow rate of 2.2 mL / min for 12 minutes; the pump model can be Hitachi pump L-7100, and the ultraviolet lamp model can be UV detector L-7400.

[0085] Test Example 4

[0086] Structural identification of xylanmycin: yellow amorphous powder, high-resolution electrospray ionization mass spectrometry (HR-ESI-MS) test shows that its molecular ion peak m / z is 647.1956 [MH] - The molecular formula is estimated to be C 31 H 36 O 15 (The calculated value is 647.2054 [MH] - ), with an unsaturation of 14.

[0087] Xylanmycin 1 H and 13 The data attribution of C NMR and two-dimensional spectra are shown in Table 1:

[0088] Table 1

[0089]

[0090]

[0091] The structure of xylanmycin is as follows:

[0092]

[0093] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, and the scope of protection of the present invention is defined by the attached claims, description and their equivalents.

Claims

1. A type II polyketone compound, characterized in that: The chemical structural formula of the second type polyketone compound is shown in formula (I):

2. The method for preparing the second type polyketone compound according to claim 1, characterized in that The steps include: (1) The actinomycete Amycolatopsis xylanica KCTC 19581 strain was cultured on MS plates at 30°C for 3 days; (2) cutting the culture obtained in step (1) into 50 mL of tryptone soy broth (TSB) medium, culturing at 30° C. and 220 rpm for 2 days, collecting the cells, and extracting the genome; (3) PCR amplification of the target SARP gene: using the genome extracted in step (2) as a template, add 2 μL of 10 mM dNTP; 5 μL of 10 μM upstream and downstream primers; 1 μL of Phanta Super-Fidelity DNA Polymerase, 50 μL of 2×PhantaMax Buffer; 5 μL of DMSO, add sterile water to 100 μL, mix well, and divide into eight PCR tubes. The PCR reaction program is: 95°C for 3 min, 95°C for 15 s, 58°C for 15 s, 72°C for 1 min, continue for 34 cycles, 72°C for 10 min, and recover the product gel for later use; (4) Ligation: Add 1 μL of the product recovered in step (3), 1 μL of the linearized pSET152 plasmid, 5 μL of multi-fragment ligase 2*CEmix, and ddH2O to make up to 10 μL, incubate at 37°C for 30 min, transform into E. coli DH5α for plasmid amplification, extract the plasmid, and verify whether it is correct by enzyme digestion; (5) The correct plasmid was transformed into E. coli ET12567 after restriction digestion, and then transferred into wild-type Amycolatopsis xylanica KCTC 19581 and plated in 60 mM Ca 2+ After culturing at 30°C for 16 hours on MS plates, cover the plate surface with sterile water containing apramycin and nalidixic acid, continue culturing for 3-6 days until a single clone grows, and purify the grown positive clone on MS plates with apramycin. (6) The purified strain was inoculated into 250 mL of tryptone soy broth (TSB) medium and cultured at 30°C and 220 rpm for 2 days; (7) inoculating the seed solution cultured in step (6) into a rice culture medium and culturing at 30° C. for 8 days; (8) The solid fermentation product obtained in step (7) was transferred to a bucket, extracted three times with an equal amount of ethyl acetate, and concentrated under reduced pressure to obtain a crude paste F1; (9) The crude paste F1 was separated using a 60 g Biotage SNAP Ultra C18 column and a total of 32 components were obtained; (10) HPLC detected the target absorption in the 12-15 segment. After concentration, it was separated and purified by semi-preparative HPLC to obtain 4.2 mg of the target compound, a novel type II polyketide compound, which was named xylanmycin.

3. The method for preparing type II polyketone compound according to claim 2, characterized in that: In step (1), the strain is an actinomycete strain, the deposited name is Amycolatopsis xylanica KCTC 19581, deposited in the Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences, and the deposited address is China Pharmaceutical Microbiological Culture Collection Center CPCC; deposit date: January 8, 2009; deposit number: CPCC 202699T.

4. The method for preparing type II polyketone compound according to claim 2, characterized in that: In step (5), the culture conditions of the SARP complementation strain are 30° C. for 3 days.

5. The method for preparing type II polyketone compound according to claim 2, characterized in that: In step (9), the MPLC chromatographic conditions are: using a reverse phase chromatographic column Biotage SNAP Ultra C18 column 60 g, mobile phase A: water, mobile phase B: acetonitrile, and a gradient elution program: the mass percentage of mobile phase B is 20%-100%, the flow rate is 55 mL / min, and 12 column volumes; 100% mobile phase B, 4 column volumes.

6. The method for preparing type II polyketone compound according to claim 2, characterized in that: In step (10), the HPLC separation and purification process is as follows: HPLC semi-preparative reverse phase high performance liquid chromatography RR-HPLC Agilent1200 HPLC: Agilent Eclipse XDB-C18 reverse phase column, 9.4×250mm, 5μm, Agilent Technologies, the mobile phase is: 31% acetonitrile, gradient elution at a flow rate of 2.2mL / min for 12 minutes; the pump model can be Hitachi pump L-7100, and the ultraviolet lamp model can be UV detector L-7400.

Images