Recombinant human collagen as well as preparation method and application thereof

Abstract

The invention relates to the technical field of genetic engineering, in particular to recombinant human collagen as well as a preparation method and application thereof. The recombinant human collagen provided by the invention is a polypeptide containing an amino acid sequence such as SEQ ID No.1. The recombinant human collagen disclosed by the invention is expressed at a high level outside cells, the culture is easy to amplify, the target protein can be produced at high yield by utilizing a high-density fermentation mode, secretory expression is beneficial to separation and purification of an expression product and reduction of production cost, and the recombinant human collagen has a certain post-translational modification function, such as glycosylation and the like, on the expressed foreign protein.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, and in particular to a recombinant human collagen protein and a preparation method and application thereof. Background Art

[0002] In the cosmetics field, collagen is widely used due to its unique biological activity and skin affinity. Collagen is the main structural protein in the skin and has multiple functions such as moisturizing, softening, anti-oxidation and UV protection. As we age, collagen in the skin is gradually lost, causing the skin to lose elasticity and luster, and even develop aging phenomena such as spots. Therefore, collagen supplementation is essential for skin health and beauty.

[0003] Hydrophilicity is one of the important properties of collagen in cosmetics. Hydrophilic collagen has good water solubility and film-forming properties, which can retain moisture in the stratum corneum and provide a lasting moisturizing effect for the skin. In addition, hydrophilic collagen can also promote the skin's absorption of other nutrients and enhance the overall skin care effect of cosmetics.

[0004] Compared with collagen traditionally extracted from animal tissues, recombinant collagen produced through bioengineering technology has higher safety, stability and biocompatibility. In addition, during the production process of recombinant collagen, genetic engineering can be used to optimize the amino acid sequence of collagen and enhance its hydrophilic properties, thereby improving its application effect in cosmetics. Summary of the invention

[0005] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a recombinant human collagen and a preparation method and use thereof, so as to solve the problems of the prior art.

[0006] To achieve the above object and other related objects, the present invention provides a recombinant human collagen protein, wherein the recombinant human collagen protein comprises a polypeptide having an amino acid sequence as shown in SEQ ID No.1.

[0007] The present invention also provides an isolated polynucleotide, wherein the polynucleotide encodes the aforementioned recombinant human collagen.

[0008] The present invention also provides a nucleic acid construct, which comprises the aforementioned polynucleotide and a backbone plasmid.

[0009] The present invention also provides a cell, wherein the cell contains the aforementioned polynucleotide or the aforementioned nucleic acid construct.

[0010] The present invention also provides a method for preparing the aforementioned recombinant human collagen, the preparation method comprising the following steps:

[0011] 1) culturing the aforementioned cells;

[0012] 2) Inducing the expression of the target gene in the cells in step 1) to obtain recombinant human collagen;

[0013] 3) Isolating and purifying the recombinant human collagen in step 2).

[0014] The present invention also provides use of the aforementioned recombinant human collagen, the aforementioned nucleic acid construct, the aforementioned polynucleotide or the aforementioned cell in preparing skin care products or tissue materials.

[0015] As described above, the recombinant human collagen and its preparation method and use of the present invention have the following beneficial effects:

[0016] (1) By utilizing the characteristics of the human collagen gene sequence, recombinant human collagen can exhibit excellent properties similar to those of natural human collagen; (2) By constructing a tandem gene recombinant plasmid containing different copy numbers, the production of recombinant human collagen can be achieved in the yeast expression system, and its molecular weight is close to the larger molecular weight of natural human collagen; (3) The construction process of the tandem gene recombinant plasmid is simple, and the target gene (recombinant human collagen gene) can be repeatedly connected multiple times only through PCR amplification and homologous recombination technology; (4) Through the induced expression of Pichia pastoris engineered strains, recombinant human collagen can be efficiently synthesized extracellularly, and its culture process is easy to scale up, and the yield can be increased through high-density fermentation technology, simplifying the downstream separation and purification steps and reducing production costs. At the same time, the system can also perform certain post-translational modifications on exogenous proteins, such as glycosylation. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 It shows the gel image of PCR tandem nucleic acid electrophoresis detection of recombinant human collagen in the present invention, Line 1: Marker, Line 2 to Line 3: pPIC9K-E as template, Line 4: pPIC9K as template.

[0018] Figure 2 It shows the SDS-PAGE gel image of the recombinant human collagen of the present invention, Line 1: Marker, Line 2: GS115-pPIC9K induced for 96 hours, Line 3: GS115-pPIC9K-E induced for 48 hours, Line 4: GS115-pPIC9K-E induced for 72 hours, Line 5: GS115-pPIC9K-E induced for 96 hours.

[0019] Figure 3Shown is the SDS-PAGE gel image of the recombinant human collagen of the present invention, Line 1: Marker, Line 5: GS115-pPIC9K-6*E induced for 48 hours, Line 6: GS115-pPIC9K-6*E induced for 72 hours, Line 7: GS115-pPIC9K-6*E induced for 48 hours.

[0020] Figure 4 Shown is the liquid chromatography chart of the recombinant human collagen of the present invention.

[0021] Figure 5 Shown are the hydrophilicity analysis results of the recombinant human collagen sequence of the present invention and other collagen sequences.

[0022] Figure 6 Shown is the nucleic acid electrophoresis diagram of the same direction tandem gene fragments of different genes of the present invention.

[0023] Figure 7 It shows the gel electrophoresis diagram of recombinant human collagen formed by the same-direction series connection of different peptide segments of the present invention.

[0024] Figure 8 Shown is a diagram of the BMGY medium composition of the present invention.

[0025] Fig. 9 Shown is a diagram of the composition of the BMMY culture medium of the present invention.

[0026] Fig.10 Shown is the MD flat plate formulation diagram of the present invention.

[0027] Fig.11 Shown is a YPD plate formulation of the present invention.

[0028] Fig.12 Shown is a schematic diagram of the structure of the recombinant plasmid pPIC9K-C+E of the present invention.

[0029] Fig.13 Shown are the results of contact angle experiments between the recombinant human collagen of the present invention and other collagens.

[0030] Fig.14 The results are shown in the experiment on the recombinant collagen of the present invention stimulating the production of type I collagen.

[0031] Fig.15 The results are shown in the experiment on the recombinant collagen of the present invention promoting cell proliferation and migration. DETAILED DESCRIPTION

[0032] The present invention provides a recombinant human collagen protein, wherein the recombinant human collagen protein comprises a polypeptide having an amino acid sequence as shown in SEQ ID No. 1.

[0033] In some specific embodiments, the recombinant human collagen comprises a polypeptide composed of one or more amino acid sequences such as the polypeptides shown in SEQ ID No.1 connected in series. More specifically, the recombinant human collagen comprises 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid sequences such as the polypeptides shown in SEQ ID No.1 connected in series; 1, 2, 3, 4 or 5 amino acid sequences such as the polypeptides shown in SEQ ID No.1 connected in series. Preferably, the recombinant human collagen comprises a polypeptide composed of 1-6 amino acid sequences such as the polypeptides shown in SEQ ID No.1 connected in series.

[0034] In some embodiments, the recombinant human collagen further comprises an amino acid sequence containing a secretion tag, which directs the collagen to the periplasmic space of host cells.

[0035] Further, the signal peptide can be selected from the disulfide isomerase DsbA involved in the correct folding of proteins and the formation of disulfide bonds, the signal peptide PelB of pectate lyase for guiding the secretion of recombinant proteins in Escherichia coli, the thermovariable outer membrane protein OmpA, the assembly of outer membrane proteins and the maintenance of bacterial cell integrity of TolB, the maltose binding protein MalE, the lipoprotein lpp involved in cell wall synthesis and bacterial defense, the inulinase signal peptide INU1A, the acid phosphatase signal peptide PHO1, the sucrase signal peptide (SUCZ), the Killer toxin signal peptide, a-factor or a hybrid secretion tag. In the present invention, the secretion tag is linked to the collagen, but the secretion tag does not affect the function of the recombinant collagen, and the secretion tag is used to assist the production of recombinant collagen and subsequent purification and separation.

[0036] In some embodiments, the recombinant human collagen comprises a histidine tag. A histidine tag or a polyhistidine tag is a sequence of 2 to 20 histidine residues attached to the collagen. The histidine tag can be used to purify the protein by a chromatography method using a nickel-based chromatography medium.

[0037] In some embodiments, the recombinant collagen further comprises a fluorescent protein fragment. The fluorescent protein can be selected from green fluorescent protein GFP, red fluorescent protein RFP, yellow fluorescent protein YFP or blue fluorescent protein BFP. In the present invention, the fluorescent protein fragment is linked to the recombinant collagen, but the fluorescent protein fragment does not affect the function of the recombinant collagen, and the secretion tag is used to assist collagen production and subsequent purification and separation.

[0038] In some embodiments, the recombinant human collagen further comprises a protease cleavage site. The protease cleavage site can be used to cleave the recombinantly produced collagen to remove a portion of the polypeptide. The removable portion of the polypeptide includes a secretion tag, a histidine tag, a fluorescent protein fragment and / or a beta-lactamase. The protease is selected from one or more of an endoprotease, an exoprotease, a serine protease, a cysteine ​​protease, a threonine protease, an aspartic protease, a glutamic protease and a metalloprotease.

[0039] The present invention also provides an isolated polynucleotide, wherein the polynucleotide encodes the aforementioned recombinant human collagen.

[0040] In the present invention, the polynucleotide corresponding to the amino acid sequence SEQ ID No.1, i.e., the polynucleotide encoding the aforementioned recombinant human collagen, includes one or more. In some specific embodiments, the nucleotide sequence of the polynucleotide is shown as SEQ ID No.2.

[0041] In some specific embodiments, the polynucleotide comprises a polynucleotide composed of one or more nucleotide sequences such as the polynucleotide shown in SEQ ID No. 2 in series. More specifically, the polynucleotide comprises a polynucleotide composed of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotide sequences such as the polynucleotide shown in SEQ ID No. 2 in series. Preferably, the polynucleotide comprises a polynucleotide composed of 1-6 nucleotide sequences such as the polynucleotide shown in SEQ ID No. 2 in series.

[0042] The term "polynucleotide" as used herein refers to a polynucleotide formed by the polymerization of deoxyribonucleotides or ribonucleotides. The term "nucleic acid" as used herein also refers to a "polynucleotide".

[0043] The present invention also provides a nucleic acid construct, which comprises the aforementioned polynucleotide and a backbone plasmid.

[0044] In some specific embodiments, the backbone plasmid is selected from pPIC9K, pPICZα or pGAPZαC.

[0045] In the present application, a backbone plasmid may also be referred to as a "plasmid backbone", which is a circular DNA molecule or a linear DNA molecule that can autonomously replicate and express an inserted target gene in a cell. The backbone plasmid may contain regulatory sequences such as promoters, replicons, transcription and translation start and stop codons. The backbone plasmid is usually connected to the target gene to form a complete expression vector that can express a specific output in a cell.

[0046] The present invention also provides a cell, wherein the cell contains the aforementioned nucleic acid construct or the aforementioned polynucleotide.

[0047] In some embodiments, the cell is selected from bacteria or yeast cells. More specifically, the bacteria is selected from Escherichia coli, Lactobacillus, Bacillus licheniformis, Bacillus subtilis or Streptomyces; the yeast cell is selected from Saccharomyces cerevisiae, Candida, Torulopsis, Rhodotorula, Hansenula, Pichia pastoris or Kluyveromyces. Preferably, the cell is selected from Pichia pastoris.

[0048] The present invention also provides a method for preparing the aforementioned recombinant human collagen, the method comprising one or more of the following steps:

[0049] 1) culturing the aforementioned cells;

[0050] 2) Inducing the expression of the target gene in the cells in step 1) to obtain recombinant human collagen;

[0051] 3) Isolating and purifying the recombinant human collagen in step 2).

[0052] In some embodiments, the culturing process in step 1) comprises one or more of the following features:

[0053] 1) The culture temperature is 20-35°C; more specifically, the culture temperature is 20-22°C, 22-25°C, 25-27°C, 27-30°C, 30-33°C or 33-35°C; preferably, the culture temperature is 25-30°C;

[0054] 2) The pH of the culture is 3-8; more specifically, the pH of the culture is 3-4, 4-5, 5-6, 6-7 or 7-8; preferably, the pH of the culture is 5-6;

[0055] 3) The culture medium contains one or more of the following components: phosphate, calcium salt, potassium salt, magnesium salt, inorganic base, glycerol and trace elements.

[0056] In some embodiments, the process induced in step 2) comprises one or more of the following features:

[0057] 1) The substance inducing the expression of the target gene in the host cell contains methanol;

[0058] 2) The induction time is 72-144 h; more specifically, the induction time is 72-84 h, 84-96 h, 96-108 h, 108-120 h, 120-132 h or 132-144 h; preferably, the induction time is 96-120 h.

[0059] In some embodiments, the separation and purification process in step 3) comprises one or more of the following features:

[0060] 1) The temperature of separation and purification is 0-15°C; more specifically, the temperature of separation and purification is 0-2°C, 2-4°C, 4-6°C, 6-8°C, 8-10°C, 10-12°C or 12-15°C; preferably, the temperature of separation and purification is 4-10°C;

[0061] 2) The separation and purification process includes ultrafiltration membrane concentration; more specifically, the molecular size filtered by the ultrafiltration membrane is 20-25kDa, 25-30kDa, 30-35kDa or 35-40kDa; preferably, the molecular size filtered by the ultrafiltration membrane is 25-35kDa;

[0062] 3) The separation and purification process comprises a chromatography process; more specifically, the chromatography process is selected from adsorption chromatography, partition chromatography, affinity chromatography, gel chromatography or ion exchange chromatography.

[0063] The present invention provides use of the aforementioned recombinant human collagen, the aforementioned nucleic acid construct, the aforementioned polynucleotide or the aforementioned cell in preparing skin care products or tissue materials.

[0064] In some embodiments, the skin care product is a product having one or more of the following functions:

[0065] 1) Stimulate the production of type Ⅰ collagen;

[0066] 2) Promote fibroblast migration.

[0067] In some embodiments, the skin care product is a personal care product. Specifically, the personal care product is selected from a facial mask, a skin cleanser such as a soap, a cleansing cream, a cleansing lotion, a cleansing milk, a cleansing puff, a cleansing milk, a shampoo, a conditioner or a shower gel.

[0068] In some embodiments, the tissue material is selected from a hydrogel or a collagen sponge.

[0069] The present invention also provides a composition comprising the aforementioned recombinant human collagen and at least one other component, wherein the other component comprises a topical carrier or a preservative.

[0070] In some embodiments, the topical carrier comprises a topical carrier selected from liposomes, biodegradable microcapsules, emulsions, sprays, aerosols, powders, biodegradable polymers, mineral oils, triglyceride oils, silicone oils, glycerin, glyceryl monostearate, alcohols, emulsifiers, liquid petroleum, white petrolatum, propylene glycol, polyoxyethylene, polyoxypropylene, waxes, sorbitan monostearate, polysorbates, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol, cyclomethicone, cyclopentasiloxane, and water. Preservatives include preservatives selected from tocopherol, diiodomethyl-p-tolylsulfone, 2-bromo-2-nitropropane-1,3-diol, cis-isomer 1-(3-chloroallyl)-3,5,7-triaza-1-azoniaadamantane chloride, glutaraldehyde, 4,4-dimethyloxazolidine, 7-ethylbicyclooxazolidine, methylparaben, sorbic acid, Germaben II, rosemary extract and EDTA.

[0071] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0072] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0073] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0074] Example 1 Construction of monomeric collagen strain and shake flask fermentation

[0075] Genetic Screening:

[0076] The natural human collagen amino acid sequence Nature (GenBank: AGL34959.1) was screened from the NCBI database for hydrophobicity analysis, and the amino acid sequence with strong water solubility and stability was selected. The integrated new protein was the monomer gene E of the recombinant human collagen strain of the invention, and the amino acid sequence is shown in SEQ ID NO.1.

[0077] Construction of host bacteria expressing collagen:

[0078] The coding gene of the integrated monomer gene E was sent to Jiangsu Saisuofei Biotechnology Co., Ltd. for synthesis and cloned into the plasmid pPIC9K. The nucleotide sequence was shown in SEQ ID NO.9 to form a recombinant vector (prepared by the laboratory of the biological department of Shanghai Yusong Pharmaceutical Technology Co., Ltd.). The recombinant vector was linearized by Sac I and then transformed into the GS115 host. The corresponding engineered bacteria were obtained after antibiotic screening. The specific operation steps are as follows:

[0079] (1) Electroporation of Pichia pastoris GS115 cells

[0080] Place the electroporation cup in an ice bath, add 10μL of the linearized plasmid into a 1.5mL EP tube containing 80μL of Pichia competent cells, mix well and transfer to an electroporation cup with a diameter of 0.2cm, then place the electroporation cup in an ice bath for 5 minutes. The electroporation conditions are: voltage 1.5kV; capacitance 25μF; resistance 200Ω, and the electroporation time is 4 to 10msec. After the electroporation is completed, add 650μL of 1M sorbitol solution pre-cooled on ice into the electroporation cup, and use a gun tip to gently blow the solution evenly. Transfer all the liquid in the electroporation cup to a new 2mL EP tube and incubate at 30℃ for 2h. Collect the bacteria by low-speed centrifugation and spread them all on MD plates (composition as shown in Fig.10 The culture was carried out at 30°C for 3 to 4 days.

[0081] (2) Antibiotic screening

[0082] When colonies grow on the plate, pick up the single bacteria growing on the plate with an inoculation loop, copy it onto a YPD solid plate containing 0.5g / L~4g / L G418, and culture at 30℃ for 3~4 days.

[0083] (3) Small-scale expression identification

[0084] Induce expression: Take a single colony that can tolerate 4g / L G418 and inoculate it into a medium containing 5mL YPD (composition as Fig.11 The cells were cultured overnight at 30°C and 220 rpm in a 0.01% inoculum containing 10 mL of BMGY (composition as shown in Figure 8 The conical flask was incubated at 30°C and 220 rpm overnight and shaken until OD 600= 2-6 (logarithmic growth, about 16-18h); centrifuge at 5000rpm for 5min at room temperature, collect the cells, remove the supernatant, and use BMMY (composition as Fig. 9 The cells were resuspended to OD600-1 and induced to express; methanol was added to a final concentration of 1% every 24 hours for continued induction, and the total induction time was 96 hours. Collagen was highly produced, and its polyacrylamide electrophoresis, i.e., SDS-PAGE, was shown in FIG. Figure 2 .

[0085] Example 2 Construction of tandem fragments and strains in the same direction

[0086] The recombinant plasmid pPIC9K-E was transformed into Escherichia coli DH5α by the CaC12 method. After screening on an LB plate containing Kan, the recombinant Escherichia coli containing the plasmid pPIC9K-E was obtained and named DH5α / pPIC9K-E. DH5α / pPIC9K-E was cultured in liquid LB medium overnight to extract the plasmid to obtain a large amount of pPIC9K-E. PCR was performed using primers containing the vector fragment (E-F+ER, the nucleotide sequence is shown in SEQ ID No.7-8). The nucleic acid electrophoresis diagram is shown in FIG. Figure 1 , gel excision was performed to recover fragments with 2 and 3 repeats;

[0087] SEQ ID No.7:EF GAGAGGCTGAAGCTTACGTAGAATTC GGTGCTAGAGGTAA

[0088] SEQ ID No.8:ER CCGTCATTACCTCTAGCACCTGG TTGACCTCTTGGACCAG

[0089] The three repeated fragments were recombined into linearized pPIC9K (linearized by EcoR I digestion) to obtain a strain containing pPIC9K-3*E, and the plasmid was extracted to obtain pPIC9K-3*E.

[0090] The two repeated fragments obtained by PCR were recombined with the linearized pPIC9K-3*E to obtain the plasmid pPIC9K-5*E; the three repeated fragments obtained by PCR were recombined with the linearized pPIC9K-3*E to obtain pPIC9K-6*E, which were spread on LB plates containing Kan to screen positive clones. The plasmids of the screened positive clones were extracted and subjected to enzyme electrophoresis to check the length of the plasmid, and the number of repeats of the human-like collagen gene monomer contained in the plasmid contained in the recombinant Escherichia coli was determined.

[0091] The constructed tandem gene with an appropriate number of repeats is cloned into a selected expression plasmid to obtain a recombinant plasmid that can be used to transform host cells for expression. The plasmid is extracted to obtain a large number of plasmids that can be used to transform Pichia Pastoris.

[0092] Transformation of Pichia pastoris:

[0093] The pPIC9K-6*E plasmid successfully constructed above was linearized with Sac I and transformed into GS115. The methanol utilization fast type (Mut + ) Recombinant yeast. Colony PCR showed that the linearized pPIC9K-6*E had been transformed into Pichia pastoris GS115 and homologously recombined into the chromosome of GS115.

[0094] Electroporation transformation MD was plated onto YPD plates containing different concentrations of G418 (see recipe for Fig.11 ), and a multi-copy recombinant yeast strain with an anti-G418 concentration of 4.00 g / L was obtained. One of the strains was selected for expression experiment. Its polyacrylamide electrophoresis pattern, i.e., SDS-PAGE, is shown in Figure 3 .

[0095] Example 3 Construction of tandem fragments of different genes and strains

[0096] The recombinant plasmids pPIC9K-C (i.e., the plasmid containing the DNA of the nucleotide sequence shown in SEQ ID No.4) and pPIC9K-E were transformed into Escherichia coli DH5α by the CaC12 method, and the recombinant Escherichia coli containing the plasmids pPIC9K-C and pPIC9K-E were obtained after screening on an LB plate containing Kan, and were named DH5α / pPIC9K-C and DH5α / pPIC9K-E. DH5α / pPIC9K-C and DH5α / pPIC9K-E were cultured in liquid LB medium overnight, and the plasmids were extracted to obtain a large amount of pPIC9K-C and pPIC9K-E as templates. The homology arm of E was first added to the end of C using primers F (wherein the underlined portion in SEQ ID No.10 is the homology arm portion of the C fragment) and R1 (wherein the underlined portion in SEQ ID No.11 is a homology arm portion of the E fragment), and the C fragment containing the E homology arm and the E fragment were used as templates. The primers F and R2 (wherein the underlined portion in SEQ ID No.11 is the homology arm portion of the E fragment) were used to generate the nucleotide sequence of the recombinant E-containing plasmids. The underlined part in ID No. 12 is another homology arm of the E fragment) was PCR-generated to obtain a large fragment with C+E connected together (see the nucleic acid electrophoresis diagram for details). Figure 6 ), gel cutting and recovery to obtain C+E fragments;

[0097] SEQ ID No.10: F

[0098] GAGAGGCTGAAGCTTACGTAGAATTC GGTTTGAGAGGTGGAGCTGGAC

[0099] SEQ ID No.11: R1

[0100] CCGTCATTACCTCTAGCACC TTGTGGACCTGGTGGACCTC

[0101] SEQ ID No.12: R2

[0102] GAATTAATTCGCGGCCGCCTA TGGTTGACCTCTTGGACCAGATG

[0103] The C+E fragment (its nucleotide sequence is shown in SEQ ID No. 13, wherein the ununderlined portion is the C fragment) was recombined into the linearized pPIC9K (linearized by EcoR I digestion) to obtain the pPIC9K-C+E strain, and the plasmid was extracted to obtain pPIC9K-C+E, whose structure is shown in Fig.12 shown.

[0104] Will Fig.12 The recombinant plasmid pPIC9K-C+E shown was linearized by Sac I and then transformed into GS115 host, and the corresponding engineered bacteria were obtained after antibiotic screening, and fermented and cultured (the specific operation process is the same as that of Example 1 and Example 2), and one of the strains was selected for expression experiment. The amino acid sequence of the obtained recombinant human collagen is shown in SEQ ID No. 14, and its polyacrylamide electrophoresis diagram, i.e., SDS-PAGE, is shown in FIG. Figure 7 .

[0105] Example 4 Fermentation and post-processing process of collagen strain

[0106] (1) The fermentation culture conditions of genetically engineered bacteria and the induction expression conditions of recombinant human collagen are as follows:

[0107] The Pichia pastoris cultured in the seed culture medium was added to the fermentation tank containing the batch fermentation medium at a 10% inoculation rate to start the culture, and the stirring speed was adjusted to 100 rpm to 600 rpm, the tank pressure to 0.03 to 0.07 MPa, and the air flow rate to 0.2 m 3 / h~0.6m 3 / h, so that the dissolved oxygen>30%.

[0108] The seed culture medium formula is: 100 mL pH 6.0 phosphate buffer, 1.34% YNB, 4×10 -5 % biotin, 1% v / v glycerol.

[0109] The basic culture medium formula of the fermentation tank is: 85% H3PO4 26.7mL / L; CaSO4 0.93g / L; K2SO418.2g / L; MgSO4·7H2O 14.9g / L; KOH 4.13g / L; glycerol 40.0g / L, and PTMI trace elements are added after sterilization; the PTMI trace elements are: CuSO4·5H2O 6.0g / L; NaI 0.08g / L; MnSO4·H2O 3.0g / L; Na2MoO4·2H2O0.2g / L; H3BO3 0.02g / L; CoCl 0.5g / L; ZnC12 20.0g / L; FeSO4·7H2O 65.0g / L; Biotin 0.2g / L; H2SO4 5.0mL / L, sterilize by filtration with a 0.2μm filter membrane, and store at -4℃.

[0110] When the carbon source is exhausted, the dissolved oxygen rises suddenly, and the feed growth medium is started to be fed at a rate to maintain the dissolved oxygen>20% until the wet weight of the bacteria reaches 180-220g / L, and then the addition of glycerol is stopped. The feed growth medium formula is: 50% w / v glycerol, containing 12mL of PTMI trace elements per liter;

[0111] After the glycerol is exhausted, the fermentation induction medium is added to induce expression. The dissolved oxygen is made greater than 20% by adjusting the rotation speed, tank pressure, air flow rate and methanol addition rate. After 96 to 120 hours of induction fermentation, the fermentation is terminated and the fermentation liquid is collected. The formula of the fermentation induction medium is: 100% methanol, containing 12 mL of PTMI trace elements per liter.

[0112] (2) The extraction and purification of recombinant human collagen is as follows

[0113] The fermentation broth is centrifuged to collect the supernatant, which is filtered through a filter membrane, separated and purified by gel column chromatography, and then freeze-dried to obtain the finished product. The specific purification steps of the above human recombinant collagen are as follows:

[0114] The fermentation broth was centrifuged at 6500 rpm for 20 min, and the supernatant was collected.

[0115] The supernatant was concentrated and washed with an ultrafiltration membrane to remove salt and pigment, and the final collagen solution had a conductivity of 1.77 ms / cm.

[0116] Take an appropriate amount of the above collagen solution and separate and purify it by UniGel-80SP resin column chromatography produced by NanoMicro, collect the eluate containing collagen, wash, desalt and concentrate the eluate with an ultrafiltration membrane, and finally obtain a conductivity of 0.48 ms / cm.

[0117] The target protein was collected by freeze drying with a freeze dryer, and the purity was 98%. Figure 4.

[0118] Example 5 Comparison of hydrophilicity between recombinant human collagen and natural collagen

[0119] The amino acid sequences of recombinant and natural human collagen were submitted to the ProtScale server (https: / / web.expasy.org / protscale / ) for hydrophobicity calculation. The default Hphob. / Kyte&Doolittle calculation parameters were used, the sliding window size was 9, and the linear weighted model was used to analyze the hydrophobicity of the amino acid sequences of recombinant human collagen and natural human type III α-chain collagen (GenBank accession number: AGL34959.1). The evaluation results are shown in the figure. Figure 5 As shown, the blue bar graph represents natural collagen, and the orange broken line represents the artificially designed recombinant E collagen fragment. Hydrophilicity is represented by negative values, and hydrophobicity is represented by positive values. The lower the hydrophilicity evaluation score, the better the hydrophilicity. That is, the recombinant E collagen represented by the orange broken line is significantly more hydrophilic than natural collagen.

[0120] Comparison of the actual hydrophilicity of recombinant human collagen and other collagens. Fig.13 The results of the hydrophilicity test between the samples purified from GS115 / pPIC9K-E and the collagen samples available on the market

[0121] Experimental principle: Wetting is a common phenomenon in nature and production processes. The process in which the solid-gas interface is replaced by the solid-liquid interface is usually called wetting. When a liquid is dropped on a solid surface, some will spread out, while others will adhere to the surface in the shape of a plano-convex lens due to different properties. This phenomenon is called wetting. The former is called spreading wetting, and the latter is called adhesion wetting. For example, water drops on a clean glass plate can produce spreading wetting. If the liquid does not adhere but remains in an ellipsoidal shape, it is called non-wetting. For example, mercury drops on a glass plate or water drops on a waterproof cloth. In addition, if a solid that can be wetted by a liquid is completely immersed in the liquid, it is called wetting.

[0122] Experimental design: 100 mg of each of GS115 / pPIC9K-E and the collagen sample on sale (MercK Collagen No. C4407, CAS No. 9007-34-5) was taken and pressed into tablets using an infrared tablet press. The surface tension was tested using water as the medium.

[0123] Experimental results: The θc values ​​of GS115 / pPIC9K-E samples were 41.45, 47.05 and 51.64, respectively, and the θc values ​​of the collagen samples on sale were 70.24, 59.48 and 66.21, respectively.

[0124] Judgment criteria: 1) When θc = 0, complete wetting; 2) When θc < 90°, partial wetting or wetting, hydrophilic; 3) When θc = 90°, it is the dividing line between wetting and not wetting; 4) When θc > 90°, non-wetting, hydrophobic; 5) When θc = 180°, completely non-wetting.

[0125] Result analysis: The minimum θc value of the GS115 / pPIC9K-E sample is 41.45, and its hydrophilicity is higher than that of the collagen samples on sale.

[0126] Example 6 Verification of the effect of recombinant collagen on stimulating type I collagen production

[0127] In this embodiment, human fibroblasts are used as a test system, and whether the sample to be tested has anti-wrinkle and firming effects is evaluated based on the effect of the sample on the content of type I collagen (Collagen I) in the human fibroblasts.

[0128] The groups in the specific experiment are as follows: BC is a blank control (untreated human fibroblasts), NC is a negative control (human fibroblasts after UVA radiation), PC is a positive control (human fibroblasts after UVA radiation were added with 1 mL of culture medium containing 100 μg / mL VC and 7 μg / mL VE), experimental group 1 is human fibroblasts after UVA radiation added with 1 mL of L sample (recombinant collagen of patent application number 2023111103388), experimental group 2 is human fibroblasts after UVA radiation added with 1 mL of E sample (recombinant collagen corresponding to SEQ ID No. 1 in this application)

[0129] The specific experimental steps are as follows:

[0130] (1) Cell seeding: According to the appropriate seeding density (8×10 4 Cells were inoculated into 24-well plates and incubated overnight in an incubator (37°C, 5% CO2).

[0131] (2) Experimental grouping: The experiment set up a blank control group, a negative control group, a positive control group and a sample group. The sample group was set up with three concentration gradients.

[0132] (3) Solution preparation: Prepare working solutions of the test substance of different concentrations according to the test concentration setting table.

[0133] (4) Radiation: When the cell plating rate in the 24-well plate reached 40% to 60%, irradiation was performed. The negative control group, positive control group and sample group received a dose of 9 J / cm 2 At the same time, the blank control group was placed in the same environment (UVA radiation dose of 0 J / cm 2 ).

[0134] (5) Administration: Administration was carried out after the irradiation was completed. 1 mL of cell culture medium was added to each well of the blank control group and the negative control group; 1 mL of culture medium containing 100 μg / mL VC and 7 μg / mL VE was added to each well of the positive control group; and 1 mL of culture medium containing the test substance at the corresponding concentration was added to each well of the sample group.

[0135] (6) Collecting cell supernatant: After 24 h of incubation, collect the cell culture supernatant into an EP tube.

[0136] (7) Collagen I detection: Detect and analyze the content of Collagen I according to the operating instructions of the ELISA detection kit.

[0137] The above experimental results are as follows Fig.14 Compared with the NC group, sample E significantly increased the content of Collagen Ⅰ produced by human fibroblasts, indicating that it has anti-wrinkle and firming effects, and the effect of sample E is more obvious.

[0138] Example 7 Verification of the effect of recombinant collagen on promoting cell proliferation and migration

[0139] In this example, human fibroblasts were used as the research object, and the repair efficacy of the samples was evaluated by detecting the effect of the samples on the migration of human fibroblasts.

[0140] The groups in the specific experiment are as follows: BC is a blank control (no FBS culture medium), PC is a positive control (containing 10% FBS culture medium), experimental group 1 is 0.059% (m / V) commercially available collagen (MercK company's product number is C4407, CAS number: 9007-34-5 collagen), experimental group 2 is 0.059% (m / V) E sample (the recombinant collagen corresponding to SEQ ID No. 1 in this application)

[0141] The specific experimental steps are as follows:

[0142] (1) Collect cells in the logarithmic growth phase and set the cell density at 2×10 5 Each well was inoculated into a 24-well culture plate.

[0143] (2) After culturing in an incubator (37°C, 5% CO2) for 24 h, a 200 μL pipette tip was used to make horizontal scratches perpendicular to the 24-well plate, and the cells were washed three times with PBS to remove the scratched cells.

[0144] (3) After loading the sample at 0.059% (m / V), the cells were placed in an incubator (37°C, 5% CO2) and cultured for 24 h. Three parallel sets were set up for each group.

[0145] The data processing method in this embodiment is as follows: each group of migrated cells is photographed using an inverted microscope, and the average scratch area is calculated using Image Pro Plus software: Healing rate (%) = (initial scratch area - current scratch area) / initial scratch area * 100%.

[0146] The above experimental results are as follows Fig.15 As shown, in the cell migration test, the cell healing level of the PC group was significantly higher than that of the BC group (p<0.01), indicating that the positive control test was effective; after sample E was treated at a concentration of 0.059% (m / V) for 24 hours, the cell healing rate of human fibroblasts was significantly improved, and there was a statistical difference compared with the BC group (p<0.01), indicating that the sample can promote the cell healing of human fibroblasts, has a repair effect and is better than the collagen on sale.

[0147] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and the variations of the methods in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of the present invention.

Claims

1. A recombinant human collagen, characterized in that: The recombinant human collagen comprises a polypeptide having an amino acid sequence as shown in SEQ ID No.

1.

2. The recombinant human collagen according to claim 1, characterized in that: The recombinant human collagen contains 2-6 segments of amino acid sequences as shown in SEQ ID No.

1.

3. An isolated polynucleotide, characterized in that The polynucleotide encodes the recombinant human collagen according to claim 1 or 2.

4. The polynucleotide according to claim 3, characterized in that The nucleotide sequence of the polynucleotide is shown as SEQ ID No.

2.

5. A nucleic acid construct, characterized in that The nucleic acid construct comprises the polynucleotide according to claim 3 or 4 and a backbone plasmid.

6. A cell, characterized in that The cell contains the polynucleotide of claim 3 or 4 or the nucleic acid construct of claim 5.

7. The cell according to claim 6, characterized in that The cells are selected from bacteria or yeast cells.

8. The cell according to claim 7, characterized in that The bacteria are selected from Escherichia coli, Lactobacillus, Bacillus licheniformis, Bacillus subtilis or Streptomyces; and / or the yeast cells are selected from Saccharomyces cerevisiae, Candida, Torulopsis, Rhodotorula, Hansenula, Pichia pastoris or Kluyveromyces.

9. The method for preparing recombinant human collagen according to claim 1 or 2, characterized in that: The preparation method comprises the following steps: 1) Cultivating the cell according to any one of claims 6 to 8; 2) Inducing the expression of the target gene in the cells in step 1) to obtain recombinant human collagen; 3) Isolating and purifying the recombinant human collagen in step 2).

10. Use of the recombinant human collagen according to any one of claims 1 or 2, the polynucleotide according to claim 3 or 4, the nucleic acid construct according to claim 5, or the cell according to any one of claims 6 to 8 in the preparation of skin care products or tissue materials.

11. The use according to claim 10, characterized in that The skin care product is a product having one or more of the following functions: 1) Stimulate the production of type Ⅰ collagen; 2) Promote fibroblast migration.

Images