Porphyromonas gingivalis outer membrane vesicle antibody and preparation method thereof

Abstract

The invention provides a porphyromonas gingivalis outer membrane vesicle antibody and a preparation method thereof, and belongs to the technical field of biological medicines. According to the invention, the porphyromonas gingivalis outer membrane vesicle antibody which is constructed based on the porphyromonas gingivalis with the preservation number of ATCC 33277 and is based on the bacterium outer membrane vesicle can enable the porphyromonas gingivalis outer membrane vesicle in a tissue slice to be conveniently observed under a microscope, and also can mark the surface markers Rgp and Kgp of the porphyromonas gingivalis outer membrane vesicle at the same time; accurate quantitative analysis is carried out on aggregation of the periodontitis in all organs, the workload is reduced, and the chronic periodontitis diagnosis efficiency is improved.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to an antibody against the outer membrane vesicles of Porphyromonas gingivalis and a preparation method thereof. Background Art

[0002] In addition to causing oral problems such as bleeding gums, loose teeth, and tooth loss, periodontitis is also closely related to systemic diseases, including but not limited to diabetes, cardiovascular disease, rheumatoid arthritis, Alzheimer's disease, and non-alcoholic fatty liver disease. Therefore, early detection and diagnosis of periodontitis is very important.

[0003] Porphyromonas gingivalis (Porphyromonas gingivalis, P.gingivalis) is a non-fermenting saccharolytic Gram-negative anaerobic cocci. It is one of the important factors causing chronic periodontitis pathogens. Studies have shown that it has a potential correlation with systemic diseases. With the deepening of research, people have found that the outer membrane vesicles of Porphyromonas gingivalis play an important role in the pathological state of periodontitis, and compared with Porphyromonas gingivalis, the effect of Porphyromonas gingivalis outer membrane vesicles on systemic diseases is more significant than that of Porphyromonas gingivalis. In recent years, the main methods for observing the outer membrane vesicles of Porphyromonas gingivalis include transmission electron microscopy, cell immunofluorescence (IF), and in vivo imaging technology. Although these methods can observe outer membrane vesicles, transmission electron microscopy cannot observe the outer membrane vesicles of Porphyromonas gingivalis in tissue sections, cell immunofluorescence has the risk of fluorescence quenching, and in vivo imaging technology cannot directly observe the cell location where the outer membrane vesicles of Porphyromonas gingivalis enter, so this semi-quantitative method has defects.

[0004] Based on this, if the biological distribution of Porphyromonas gingivalis outer membrane vesicles in the body can be determined, it will be helpful to analyze the correlation between Porphyromonas gingivalis outer membrane vesicles and systemic diseases. Currently, there are no antibodies that can accurately quantify Porphyromonas gingivalis outer membrane vesicles, which limits the study of the relationship between Porphyromonas gingivalis outer membrane vesicles and systemic diseases. Summary of the invention

[0005] In view of the defects of the prior art, the present invention prepares an antibody against the outer membrane vesicles of Porphyromonas gingivalis, which can accurately quantify the accumulation of the outer membrane vesicles of Porphyromonas gingivalis in various organs through Elisa technology and has good specificity.

[0006] In order to achieve the above purpose, the present invention solves the technical problem by adopting the following technical solutions:

[0007] In a first aspect, the present invention provides an antibody against outer membrane vesicles of Porphyromonas gingivalis. The preparation of the antibody against outer membrane vesicles of Porphyromonas gingivalis comprises the following steps:

[0008] S1. Inserting the target gene into a prokaryotic expression vector to obtain a recombinant expression vector;

[0009] S2. Transform the recombinant expression vector into competent cells to induce expression;

[0010] S3. Extract and purify the outer membrane vesicles of Porphyromonas gingivalis;

[0011] S4. The amplified protein was injected into the tail vein of female mice for antigen immune response;

[0012] S5. Extract serum from female mice and crudely extract Porphyromonas gingivalis outer membrane vesicle antibodies, purify them and verify their specificity.

[0013] In some embodiments, the gene sequence of the target gene is shown as SEQ ID NO: 1.

[0014] In some embodiments, the bacterial outer membrane vesicles are derived from Porphyromonas gingivalis with a deposit number of ATCC 33277.

[0015] In some embodiments, the Porphyromonas gingivalis outer membrane vesicle antibody can upregulate the expression of Porphyromonas gingivalis surface marker Kgp.

[0016] In some of the embodiments, the Porphyromonas gingivalis outer membrane vesicle antibody can upregulate the expression of Porphyromonas gingivalis surface marker Rgps.

[0017] In a second aspect, the present invention provides a kit for detecting outer membrane vesicles of Porphyromonas gingivalis, comprising the anti-outer membrane vesicle antibody of Porphyromonas gingivalis according to claim 1.

[0018] In a third aspect, the present invention provides a reagent for detecting outer membrane vesicles of Porphyromonas gingivalis, comprising the anti-outer membrane vesicle antibody of Porphyromonas gingivalis according to claim 1.

[0019] In a fourth aspect, the present invention further provides a drug for diagnosing chronic periodontitis, characterized in that it comprises the anti-Porphyromonas gingivalis outer membrane vesicle antibody according to claim 1 and a pharmaceutically acceptable excipient.

[0020] In a fifth aspect, the present invention also provides the use of Porphyromonas gingivalis outer membrane vesicle antibodies in the preparation of drugs for treating periodontitis.

[0021] In some embodiments, the treatment is by injection.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention prepares an antibody against outer membrane vesicles of Porphyromonas gingivalis for the first time, filling the gap in the field of antibodies. The prepared antibody against outer membrane vesicles of Porphyromonas gingivalis can be stained in immunohistochemistry in tissue sections, which is beneficial for observing the progression of outer membrane vesicles of Porphyromonas gingivalis and systemic diseases, thereby determining the cellular localization of the action of outer membrane vesicles of Porphyromonas gingivalis, and can also help study the systemic nano-distribution of outer membrane vesicles of Porphyromonas gingivalis, thereby reducing workload and improving the efficiency of diagnosis of chronic periodontitis.

[0024] At the same time, the Porphyromonas gingivalis outer membrane vesicle antibody prepared by the present invention can accurately quantify the accumulation of Porphyromonas gingivalis outer membrane vesicles in various organs through the Elisa technology, solving the problem that in vivo imaging can only be semi-quantitative through fluorescence intensity, and verifies that Porphyromonas gingivalis outer membrane vesicles are distributed to various organs through the vascular pathway, which is beneficial to the subsequent preparation of drugs that inhibit exosomes through the vascular pathway, thereby blocking the effects of periodontitis on organs throughout the body. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solution of the present invention, the drawings required for use in the implementation mode will be briefly introduced below. Obviously, the drawings described below are only some implementation modes of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0026] Figure 1 This is the electrophoresis result of the recombinant expression vector in the embodiment of the present invention.

[0027] Figure 2 This is a transmission electron microscopy observation result of the outer membrane vesicles of Porphyromonas gingivalis in an embodiment of the present invention.

[0028] Figure 3 The nano-flow cytometry particle size analysis results and expression diagram of the outer membrane vesicles of Porphyromonas gingivalis in the embodiment of the present invention;

[0029] Figure 4 gingivalis outer membrane vesicles in the embodiment of the present invention, in which: in Figure A, the molecular weights of markers Kgp and Rgp are 56 kDa and 42 kDa respectively; in Figure B, the molecular weight of Pg OMVs is approximately 20-25 kDa; and in Figure C, the molecular weight of GAPDH is 37 kDa.

[0030] Figure 5 This is a graph showing the results of using Western blot to verify the specificity of the Porphyromonas gingivalis outer membrane vesicle antibody in the examples of the present invention.

[0031] Figure 6gingivalis outer membrane vesicles in the liver, stomach, lung, kidney, spleen and serum respectively in the embodiment of the present invention; in the figure, PBS is the PBS blank group; IG represents the gavage group; PMI represents the periodontal ligament injection group; PDModel-IG represents the periodontitis model-gavage group; PD Model-PMI represents the periodontitis model-periodontal ligament injection group.

[0032] Figure 7 gingivalis outer membrane vesicles in the liver, spleen, lung, and kidney respectively.

[0033] Figure 8 1 is a standard curve diagram of each organ in the embodiment of the present invention, in which: A is the liver; B is the stomach; C is the lung; D is the kidney; E is the spleen; and F is the serum. DETAILED DESCRIPTION

[0034] The following is a clear and complete description of the technical solutions in the embodiments of the present invention in conjunction with specific embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0035] In the present invention, the test methods used are conventional methods unless otherwise specified; the materials, reagents, etc. used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0036] Example 1: Construction of recombinant vector

[0037] 1. Experimental reagents:

[0038] DH5α competent cells: Tiangen Biotechnology; LB agarose medium: GSbioth; PCR kit: Tianya Biotechnology;

[0039] 2. Experimental steps:

[0040] 1. According to Porphyromonas gingivalis ATCC 33277, codon optimization was performed using software. The optimized sequence is shown in SEQ ID NO.1. The DNA fragment was synthesized by Wuxi Saisuofei Company.

[0041]

[0042] 2. Connect

[0043] Reaction system: 2 μL (about 150 ng) of the optimized target fragment DNA, 0.5 μL (about 50 ng) of the plasmid vector, 5 μL of solution I quick ligation solution, and sterile deionized water to make up to 10 μL, and ligate at 16°C for 30 minutes.

[0044] 3. Conversion

[0045] (1) Add the ligation product to 100 μL of DH5α competent cells and mix well. Place the mixture on ice for 30 minutes, then place it in a 42°C water bath for 90 seconds. Immediately place the mixture on ice for 2-3 minutes.

[0046] (2) Add 900 μL of LB medium (without antibiotics) preheated at 37°C and culture with shaking at 150 rpm and 37°C for 45 min.

[0047] (3) Centrifuge at 2500 rpm for 5 minutes, remove the supernatant, and keep 100 μL of the mixed bacterial solution. Add it to the LB solid agar medium containing Amp antibiotics (antibiotic concentration 100 μg / mL). Use a sterile curved glass rod to gently spread the cells evenly. After the surface of the plate is dry, invert the plate and incubate at 37°C for 12-16 hours.

[0048] 4. Colony PCR

[0049] Pick a single colony from the above plate, dissolve it in 3 μL of water, take 0.5 μL as a template, and perform PCR.

[0050] A 10 μL reaction system was used, specifically 1 μL of 10× Taq buffer Buffer, 1.6 μL of 25 mM MgCl, 1 μL of 2.5 mM dNTP mix, 0.5 μL of each upstream and downstream primer (10 μM), 0.3 μL of Taq DNA polymerase (2.5 U / μL), and 0.5 μL of DNA template (about 100 ng), and the 10 μL system was supplemented with sterile water.

[0051] The reaction conditions were pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 30 seconds, annealing at 56°C, and extension at 72°C for 1 minute; 20 cycles; after the PCR reaction cycle, extension was continued at 72°C for 3 minutes, and then stored at 4°C.

[0052] Table 1 Upstream and downstream primer sequences

[0053] Primers Sequence (5'3') Rgp-F CCGCTACTCATGCTGGAAATA(SEQ ID NO.2) Rgp-R CAGAGAAGCAGGAAGCGTATAA(SEQ ID NO.3) Kgp-F AAGGTAGGTGTGTTCGGTTATG(SEQ ID NO.4) Kgp-R GCCCACGGCATAGAAATACA(SEQ ID NO.5)

[0054] A total of 5 colonies were selected for PCR. After the PCR reaction, 5 μL of PCR product was analyzed by 1.5% agarose electrophoresis. The theoretical size of the band amplified by the vector upstream and downstream primers was about 5175 bp. The actual amplified band was as follows: Figure 1 As shown, the obtained gene was consistent with the expected sequence.

[0055] Example 2: Extraction and purification of Porphyromonas gingivalis outer membrane vesicles

[0056] 1. Preliminary extraction method of Porphyromonas gingivalis

[0057] 1. Bacterial culture medium formula

[0058] Component I: 50 mg hemin, 1 mL NaOH mother solution (1 mol / L), 1 mL 10 mg / mL vitamin K1 solution, add dH2O to make up to 100 mL, then adjust the pH to 7.4 with hydrochloric acid or citric acid, filter with a 0.22 um filter, and store at 4°C away from light.

[0059] Component II: BHI medium (liquid)

[0060] Take 3.6 g BHI powder, 0.5 g yeast powder, and 0.04 g cysteine ​​hydrochloride, make up to 100 mL, sterilize by high pressure at 121°C, and store at 4°C.

[0061] Liquid culture medium: Mix component I and component II at a volume ratio of 1:100 and it is ready for use.

[0062] Solid culture medium: Add 1.8 g agar powder to component II and sterilize under high pressure, then add component I and defibrinated sheep blood (the amount of defibrinated sheep blood is 1 / 10 of the culture medium), mix well, pour into plates, and store at 4°C.

[0063] 2. Bacterial Passaging

[0064] (1) Add 5 mL of component II and 50 μL of component I to the shake tube and shake well (insert the tip of the pipette into the liquid surface to add), then shake and blow the old shake tube to mix the precipitate (take out the bacteria after preparing the culture medium);

[0065] (2) (You can measure the OD value first) Take 100 μL of the bacterial solution and add it to the new culture medium and culture it in the anaerobic incubator (put the inoculated shaking tube first, and then pour out the original solution after confirming that it is correct).

[0066] 3. Bacterial recovery: (1 cryopreserved tube, 2 shaking tubes)

[0067] (1) Prepare bacterial culture medium (5 mL of component II, 50 μL of component I)

[0068] (2) Take out the frozen strain, add 500 μL of the original freezing solution to each shake tube, and transfer to two shake tubes, using a total of 1 mL of the original freezing solution.

[0069] (3) Anaerobic chamber culture.

[0070] 4. Exosome extraction:

[0071] (1) Place the stock solution of Porphyromonas gingivalis in a 50 mL centrifuge tube and use a high-speed centrifuge at 4°C, 5000×g, and 20 minutes to remove Porphyromonas gingivalis. After taking out the supernatant and transferring it to a new 50 mL centrifuge tube, repeat the high-speed centrifuge at 4°C, 5000×g, and 20 minutes to remove Porphyromonas gingivalis until no side wall precipitation is seen in the 50 mL centrifuge tube, and the exosome crude extraction step is completed.

[0072] (2) The supernatant was transferred through a 0.45 μm and a 0.22 μm microbial vacuum filter and then transferred to a 100-kDa hollow fiber membrane (Amersham Biosciences), concentrated using a Quix-Stand Benchtop system (Amersham Biosciences), and filtered at 4°C, 5000 × g, for 20 min, leaving the liquid precipitate in the upper container.

[0073] (3) The liquid precipitate in the upper container was resuspended with 2-3 mL PBS (Gibco) and transferred to a 12.5 mL ultracentrifuge tube. Ultracentrifugation was performed at 4°C, 150,000 × g, and 180 min. After ultracentrifugation, the supernatant was discarded, and the side wall precipitate was retained. The side wall precipitate was resuspended with 300 μL PBS (Gibco), and the initial extraction of exosomes was completed. The protein concentration was determined by Bradford analysis (Bio-Rad Laboratories).

[0074] (4) The morphology and size of the outer membrane vesicles of Porphyromonas gingivalis were observed using a transmission electron microscope (FEI Tecnai G2 Spirit T12).

[0075] Depend on Figure 2 As shown in the TEM image, some vesicle-like structures appeared, indicating that the outer membrane vesicles of Porphyromonas gingivalis are typical vesicle-like structures. Figure 3 As shown in the DLS particle size distribution diagrams in (1) and (2), the outer membrane vesicles of Porphyromonas gingivalis have a wide size range with an average diameter of 136.6 nm.

[0076] At the same time, by Figure 3(3) and (4) showed that the outer membrane vesicles of P. gingivalis significantly upregulated the expression of markers such as Kgp and Rgps.

[0077] Example 3: Protein expression and purification in a cell-free system

[0078] 1. Experimental reagents:

[0079] PLD cell-free protein expression kit and protein purification kit: purchased from Perotine Biotechnology.

[0080] 2. Experimental steps:

[0081] 1. Reaction system: Component A 20.5 μL, Component B 16.7 μL, DNA template final concentration 20 ng / μL, ddH2O to 50 μL. (The reaction system can be scaled up or down according to actual needs. In this example, a 300 μL reaction system is scaled up 6 times).

[0082] 2. Protein expression and purification

[0083] (1) Add the prepared reaction system to a 24-well plate and mix well using a pipette, avoiding violent shaking.

[0084] (2) Place the 24-well plate on a shaker and set the parameters to 180 rpm and 25°C. Perform the protein synthesis reaction for 16 hours. After the reaction is completed, centrifuge at 4°C and 10,000×g for 20 minutes and collect the supernatant.

[0085] (3) 50 μL Ni beads were washed twice with 50 μL 1×PBS (10 mmol / L Na2HPO4, 1.75 mmol / L KH2PO4, 137 mmol / L NaCl, 2.65 mmol / L KCl, pH = 7.4); (centrifugation conditions: 6000×g, 30 seconds).

[0086] (4) Incubation: Add [50 μL Ni beads, 700 μL PBS, 250 μL reaction supernatant, 4 μL 500 mM imidazole eluent (i.e., the final imidazole concentration is 2 mM)] to a 1.5 mL centrifuge tube and incubate at 4°C for 2 hours (shake slowly on a rotary mixer).

[0087] (5) Washing: Wash three times with 1 mL of 5 mM imidazole washing solution (50 mmol / L Na2HPO4, 300 mmol / L NaCl, 5 mmol / Limidazole, pH = 7.4); (centrifugation conditions: 6000 g, 30 seconds).

[0088] (6) Elution: Elute once with 0.1 mL of 500 mM imidazole eluent (50 mmol / L Na2HPO4, 300 mmol / L NaCl, 500 mmol / L imidazole, pH = 7.4); (centrifugation conditions: 6000 × g, 30 seconds).

[0089] Example 4: Antibody Preparation

[0090] 1. Experimental reagents:

[0091] Freund's complete adjuvant: sigma; HRP goat anti-mouse secondary antibody: biosharp; Protein GAgarose (FastFlow, 5mL) pre-packed column, Binding buffer, Elution buffer, Neutralization buffer: all purchased from Beyotime.

[0092] 2. Experimental steps:

[0093] 1. Mouse breeding and immunization:

[0094] The C57 mice were quarantined and observed, and rested for one week. Then, Freund's complete adjuvant was mixed with protein supernatant and Porphyromonas gingivalis outer membrane vesicles in a volume ratio of 1:1:1 and injected intraperitoneally, with a total protein amount of 10 μg. Subsequently, booster immunization injections were performed every 2 weeks, with each injection amount of 10 μg, for a total of 4 immunization injections.

[0095] 2. Antibody titer determination:

[0096] (1) After immunization, blood was collected by cardiac puncture, and then the blood was allowed to stand at room temperature for 30 minutes to allow the blood to coagulate. The blood was then centrifuged at 4°C and 1000×g for 20 minutes to obtain serum for later use.

[0097] (2) Add 10 μg / mL antigen (i.e., protein supernatant) to the Elisa plate for coating, 100 μL per well, incubate for 4 h, discard the antigen, and add BSA blocking solution for blocking.

[0098] (3) The serum obtained by centrifugation was diluted into different concentrations and added to the Elisa plate for reaction, 100 μL per well, at 4°C overnight.

[0099] (4) Discard the serum sample and add Elisa washing solution to wash three times.

[0100] (5) Add HRP goat anti-mouse secondary antibody and incubate for 1 hour.

[0101] (6) Discard the secondary antibody and add Elisa washing solution for washing 3 times in total.

[0102] (7) Add colorimetric substrate for color development, and use an ELISA reader to detect the absorbance and calculate the antibody titer. The maximum P / N value indicates the optimal antigen coating concentration and serum dilution multiple.

[0103] Table 2 Antibody titer

[0104] Dilution gradient P / N 1:100 5.787671759 1:200 7.929639227 1:400 11.87691148 1:800 15.32429668 1:1600 13.66389549 1:3200 10.73569756 1:6400 6.31222965 1:12800 4.805219605 1:25600 2.556364788

[0105] 3. Antibody chromatography purification:

[0106] (1) Dilution: To ensure that the sample solution has an appropriate ionic strength and pH value, dilute the serum with Binding buffer at a 1:1 ratio.

[0107] (2) Equilibration: Install the pre-loaded column, open the cap (upper plug) on ​​the pre-loaded column, wash and equilibrate the pre-loaded column with 10 times the column volume of Binding buffer so that the agarose gel in the pre-loaded column is in the same buffer system as the target protein, which plays a role in protecting the protein. Do not let the pre-loaded column drip dry during the washing and equilibration process.

[0108] (3) Loading: Mix the diluted sample to avoid bubbles. Add the sample from the top of the pre-packed column, collect the flow-through, re-load the flow-through, repeat twice, and then collect the flow-through.

[0109] (4) Washing: After sample binding, wash the pre-packed column with 20 column volumes of Binding buffer to remove non-specifically adsorbed proteins at a flow rate of 1 mL / min and collect the washing solution. Do not allow the pre-packed column to drip dry during the washing process.

[0110] (5) Add an appropriate amount of Neutralization buffer to the collection tube at a ratio of 100 μL of Neutralization buffer per mL of elution buffer. After the previous washing step, the bound antibody is usually eluted with 5 column volumes of Elution buffer and the eluate l is collected.

[0111] (6) The eluted antibodies were concentrated using an ultrafiltration tube and the antibody concentration was detected, which was 12 μg / mL.

[0112] Example 5: Antibody Validation

[0113] 1. Female C57BL / 6J mice aged 6-8 weeks were selected, and a blank control group and an experimental group were set up. The mice in the experimental group were intraperitoneally injected with Porphyromonas gingivalis outer membrane vesicles (30 μg total protein) for 6 hours. The livers of the mice were taken by using the livers of female C57BL / 6J mice aged 6-8 weeks in the blank control group and the livers of C57BL / 6J mice 6 hours after intraperitoneal injection of Porphyromonas gingivalis outer membrane vesicles (30 μg total protein), and Western Blot was performed to verify the antibody specificity of Porphyromonas gingivalis outer membrane vesicles.

[0114] Second, the Elisa sandwich experiment and immunohistochemistry experiment were performed by using the blank control group of 6-8 week old female C57BL / 6J mice injected with PBS (Gbico) and the C57BL / 6J mice injected with Porphyromonas gingivalis outer membrane vesicles (30 μg total protein) in the periodontal ligament to observe the accumulation of Porphyromonas gingivalis outer membrane vesicles in various organs when using this specific antibody. For details, see the attached experimental figure ( Figure 6-7 ).

[0115] Standard curve drawing:

[0116] 1. Set up standard wells and sample wells, and add 50 μL of standards of different concentrations to each standard well;

[0117] Liver, stomach, lung, kidney, spleen standard concentrations (S0-S7): 0, 1.25, 2.5, 5, 10, 20, 40 μg / mL.

[0118] Serum standard (S0-S7) concentrations: 0, 12.5, 25, 50, 100, 200, 400 ng / mL.

[0119] 2. First add 10μL of the sample to be tested to the sample well, then add 40μL of sample diluent, and do not add anything to the blank well.

[0120] 3. Except for the blank wells, add 100 μL of horseradish peroxidase (HRP)-labeled detection antibody to each well of the standard well and sample well, seal the reaction wells with a sealing film, and incubate in a 37°C water bath or incubator for 60 min.

[0121] 4. Discard the liquid, pat dry on absorbent paper, fill each well with washing solution, let it stand for 1 minute, shake off the washing solution, pat dry on absorbent paper, and repeat this process 5 times (you can also use a plate washer to wash the plate).

[0122] 5. Add 50 μL of substrate A and B to each well and incubate at 37°C in the dark for 15 min.

[0123] 6. Add 50 μL of stop solution to each well and measure the OD value of each well at a wavelength of 450 nm within 15 minutes. Draw a standard curve: Use the concentration of the standard as the horizontal axis and the OD value as the vertical axis to draw a linear regression curve of the standard. Figure 8 As shown, the concentration value of each sample is calculated according to the curve equation.

[0124] Result analysis:

[0125] Depend on Figure 4 It can be seen that the carrier protein of the outer membrane vesicle surface marker of Porphyromonas gingivalis was successfully amplified and further combined with Figure 5 It can be seen that the bands of the antibody against the outer membrane vesicles of Porphyromonas gingivalis are clear, indicating good specificity and no non-specific binding, and the antibody against the outer membrane vesicles of Porphyromonas gingivalis has a high relative expression level.

[0126] Subsequently, by Figure 6 It can be seen that the gavage group was not distributed in various organs at various time points, but after periodontal ligament injection, Porphyromonas gingivalis outer membrane vesicles were distributed in various organs including gastric tissue, which shows that under periodontal ligament injection, Porphyromonas gingivalis outer membrane vesicles can reach various organs through the vascular pathway. The present invention verifies this mechanism through Porphyromonas gingivalis outer membrane vesicle antibodies, which is conducive to the subsequent research on the preparation of drugs that inhibit exosomes through the vascular pathway, thereby blocking the effects of periodontitis on organs throughout the body.

[0127] In summary, the specific antibody for the outer membrane vesicles of Porphyromonas gingivalis prepared by the present invention can not only enable the outer membrane vesicles of Porphyromonas gingivalis in tissue sections to be observed under a microscope, but this antibody can also simultaneously label the surface markers Rgp and Kgp of the outer membrane vesicles of Porphyromonas gingivalis, and can also be accurately quantified by Elisa technology, which is beneficial to the subsequent preparation of exosome inhibitory drugs, and when treating systemic diseases, periodontitis can be treated by blocking the vascular pathway, thereby preventing the aggravation of systemic diseases.

[0128] The antibody of the present invention is stored in 0.1 mol / L pH 7.2 phosphate buffer containing 0.1% sodium azide and can be stored at -20°C for half a year.

[0129] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A Porphyromonas gingivalis outer membrane vesicle antibody, characterized in that: The preparation of the Porphyromonas gingivalis outer membrane vesicle antibody comprises the following steps: S1. Inserting the target gene into a prokaryotic expression vector to obtain a recombinant expression vector; S2. Transform the recombinant expression vector into competent cells to induce expression; S3. Extract and purify the outer membrane vesicles of Porphyromonas gingivalis; S4. The amplified protein was injected into the tail vein of female mice for antigen immune response; S5. Extract serum from female mice and crudely extract Porphyromonas gingivalis outer membrane vesicle antibodies, purify them and verify their specificity.

2. The Porphyromonas gingivalis outer membrane vesicle antibody according to claim 1, characterized in that The gene sequence of the target gene is shown in SEQ ID NO:

1.

3. The Porphyromonas gingivalis outer membrane vesicle antibody according to claim 1, characterized in that The bacterial outer membrane vesicles are derived from Porphyromonas gingivalis with a deposit number of ATCC 33277.

4. The Porphyromonas gingivalis outer membrane vesicle antibody according to claim 1, characterized in that The Porphyromonas gingivalis outer membrane vesicle antibody can upregulate the expression of Kgp, a surface marker of Porphyromonas gingivalis.

5. The Porphyromonas gingivalis outer membrane vesicle antibody according to claim 1, characterized in that The Porphyromonas gingivalis outer membrane vesicle antibody can upregulate the expression of the Porphyromonas gingivalis surface marker Rgps.

6. A kit for detecting outer membrane vesicles of Porphyromonas gingivalis, characterized in that: A composition comprising the anti-Porphyromonas gingivalis outer membrane vesicle antibody according to claim 1.

7. A reagent for detecting outer membrane vesicles of Porphyromonas gingivalis, characterized in that: A composition comprising the anti-Porphyromonas gingivalis outer membrane vesicle antibody according to claim 1.

8. A drug for diagnosing chronic periodontitis, characterized in that: The invention comprises the antibody against Porphyromonas gingivalis outer membrane vesicles according to claim 1 and a pharmaceutically acceptable excipient.

9. Application of Porphyromonas gingivalis outer membrane vesicle antibodies in the preparation of drugs for the treatment of periodontitis.

10. The use according to claim 9, characterized in that: The treatment method is injection.

Images