Inonotus vanning ZAAS-S11 strain as well as culture method and application of inonotus vanning ZAAS-S11 strain

Abstract

The invention discloses an inonotus vanning ZAAS-S11 strain, the strain comprises an ITS segment nucleic acid sequence and a specific segment nucleic acid sequence, the ITS segment nucleic acid sequence is shown as SEQ ID NO.1, the specific segment nucleic acid sequence is shown as SEQ ID NO.2, the strain is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number is CGMCC NO.41355. The invention further discloses a preparation method of the strain. According to the inonotus weringensis ZAAS-S11 hypha extract disclosed by the invention, the effective prevention and treatment of inflammatory enteritis can be realized in an oral administration manner; the inonotus vanning ZAAS-S11 strain disclosed by the invention has good administration safety, and a new choice is provided for preventing and treating inflammatory enteritis of people.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, in particular to the technical field of Porites vaninianus. Background Art

[0002] Inflammatory bowel disease, which mainly includes ulcerative colitis and Crohn's disease, is a global health problem that affects approximately 0.5% of the world's population. Typical symptoms of inflammatory bowel disease include acute diarrhea, intermittent abdominal pain, rectal bleeding, and weight loss. In addition to significantly reducing the quality of life, it also increases the risk of colon cancer, thus placing a heavy burden on individuals and society. Currently, there is a lack of clear therapeutic drugs for inflammatory bowel disease. Although commonly used clinical drugs have a high remission rate, secondary failures often occur. Therefore, there is an urgent need to find more effective and safer drugs. Summary of the invention

[0003] The purpose of the present invention is to solve the problems in the prior art and provide a Sanghuangporus vaninii ZAAS-S11. The strain of the present invention can alleviate the weight loss of mice caused by inflammatory bowel disease and significantly alleviate the shortening of the colon.

[0004] To achieve the above-mentioned object, the present invention proposes a Vaninian polypore ZAAS-S11 strain, which comprises an ITS segment nucleic acid sequence and a specific segment nucleic acid sequence, the ITS segment nucleic acid sequence is shown in SEQ ID NO.1, the specific segment nucleic acid sequence is shown in SEQ ID NO.2, and the strain is deposited in the General Microbiology Center of China National Microbiological Culture Collection Committee with a deposit number of CGMCC NO.41355.

[0005] The present invention provides a medicament for alleviating symptoms of inflammatory bowel inflammation, which is the hyphae or hyphae extract of the Vaninia fibrosa ZAAS-S11 strain according to claim 1.

[0006] Preferably, the target of the drug is mammals.

[0007] Preferably, the target of the drug is human.

[0008] Preferably, the agent is mycelium or mycelium extract of Porites vaninianus ZAAS-S11.

[0009] Preferably, the concentration of the mycelium extract is 1 mg / mL.

[0010] Preferably, the mycelium extract is administered orally, by intragastric administration, or by injection.

[0011] The mycelium extract of Porites vaninii ZAAS-S11 was fed to enteritis model mice, which significantly alleviated the shortening of the colon of the mice and effectively alleviated the symptoms of inflammatory bowel inflammation in the mice, and is suitable for the long-term prevention and treatment of inflammatory bowel inflammation.

[0012] The invention proposes the application of the Vaninia fibrosa ZAAS-S11 strain in inflammatory bowel disease.

[0013] Preferably, the method comprises the following steps: culturing ZAAS-S11 mycelium, harvesting the mycelium, extracting and concentrating the mycelium by boiling in water, and freeze-drying the mycelium extract.

[0014] The present invention also proposes a method for cultivating the Vaninian polypore ZAAS-S11 strain, comprising the following steps: S1: Get sub-entities; S2: bacterial strain isolation; S3: morphological identification; S4: Molecular characterization.

[0015] Preferably, S2 comprises the following steps: clean the fruiting body with water, disinfect the surface with 75% alcohol, place it in a clean bench, remove the fruiting body about 0.5 cm from the surface with a sterile blade, and dig out a piece of about 0.5 cm 3 The fruiting body blocks were placed in a PDA plate culture medium containing penicillin-streptomycin (mg / L) and cultured at 28°C for about 7 days. The colonies that were not contaminated by other bacteria were picked and transferred to a new PDA plate culture medium containing penicillin-streptomycin (mg / L) until no more bacteria grew on the entire plate.

[0016] Preferably, the S3 comprises the following steps: after the strain ZAAS-S11 is transferred to a PDA plate and cultured for 7 days, the mycelial morphology is observed. The strain has a medium growth rate in the PDA plate, at a growth rate of about 9-11 mm / d. The mycelium is light yellow, velvety, with an obvious bulge in the middle. The vegetative mycelium wall is smooth, thin to slightly thick, with simple septa and moderate branching. No spore production is observed under the culture state.

[0017] Preferably, in S4, the strain ZAAS-S11 is identified by phylogenetic tree analysis: the ITS segment of the strain ZAAS-S11 is sequenced to obtain the ITS sequence of the strain ZAAS-S11, and a phylogenetic tree is constructed using MEGA5.0 software and the Neighbor-joining method, and the evolutionary relationship of the strain ZAAS-S11 is comprehensively analyzed to determine that the strain is Porites vaninensis.

[0018] The beneficial effects of the present invention are as follows: the mycelium extract of the Vaninia fibrosa ZAAS-S11 of the present invention can achieve effective prevention and treatment of inflammatory enteritis by oral administration; the Vaninia fibrosa ZAAS-S11 strain of the present invention has good safety for administration, and provides a new choice for preventing and treating human inflammatory enteritis; when preventing and treating inflammatory enteritis, the Vaninia fibrosa ZAAS-S11 strain of the present invention only needs to be cultured for 1-2 weeks through liquid fermentation and then extracted and freeze-dried to obtain the strain, which has the advantages of short production time and stable and controllable quality compared with the use of annual or perennial fruiting bodies.

[0019] The features and advantages of the present invention will be described in detail through embodiments in conjunction with the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 These are the morphological characteristics of Vaninium, where Figure A shows the growth state in a PDA culture dish; Figure B is an enlarged view of the hyphae at the edge of Figure A; and Figure C shows the hyphae cultured in a liquid shake flask. Figure 2 This is a schematic diagram of the phylogenetic analysis of ZAAS-S11 of Vaninia fibrosa; Figure 3 This is a schematic diagram of the effect of the Vaninia fibrosa ZAAS-S11 on the body weight of mice with inflammatory enteritis; Figure 4 This is a schematic diagram of the effect of Porites vaninii ZAAS-S11 on colon length in mice with inflammatory enteritis. DETAILED DESCRIPTION

[0021] The present invention is further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any form.

[0022] Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the present technical field.

[0023] Experimental reagents: Dextran sulfate sodium salt (DSS, relative molecular mass 35000-50000) was purchased from MP Company, USA. Except for the above reagents, the reagents and materials used in the following examples were all commercially available.

[0024] PDB medium (1L): 200 g potato, 20 g white sugar, 1.5 g MgSO4, 1.5 g KH2PO4, add water to make up to 1000 mL, pH 7.0.

[0025] When preparing PDA medium, 1.5% agar powder should be added.

[0026] Example 1 A Vaninia fibrosa ZAAS-S11 strain, comprising an ITS segment nucleic acid sequence and a specific segment nucleic acid sequence, wherein the ITS segment nucleic acid sequence is shown in SEQ ID NO.1, and the specific segment nucleic acid sequence is shown in SEQ ID NO.2.

[0027] Other Vaninia species do not contain this specific segment or the nucleic acid sequence of this specific segment has a homology of <80% compared with ZAAS-S11.

[0028] ITS segment nucleic acid sequence NO.1: TCGAGTTTTGAAAGCGAGACTTGCTGCTGGCGCGAATGAATTTTTGCGCATGTGCACGGCCTTCGCGCTCAAATCCAACTCTCAAACCCCCTGTGCACCTTATCATATCGCGAGTCGAAGTTAGTAGTCTGAGGTCTGTCTTGTAAGTAATGAGTA GAAGGGCGAAAGCGAGTGTTGCTCGTTAGGTAACCCTTCGAAAATGAAAGCGAGCGGGAGTGCGTCGGGTGAAGACTTGGGCTTGTTGTTACAAACCCCCCCCTTATATTGTCTTTGTGAATGTAATGCTCCTCGTGGGCGAAAATCAATA.

[0029] Specific segment nucleic acid sequence NO.2: CCTCTTGTGCATATATGATGTAAATTTTAGGCTGGTTTGTGGAGCTATGGGCCGGAACTTGTGACAATAAGAAAGGGGTGGGGGTGCAGTACTTTTGCACGCAGCATATAAATTTAAAAGGTATGTACCT CCTCGTCGACATCTTTCCCCTGGCACATTCATCCATCCCTTGTTCTCACCCCTGGTTCCCCTGTTTACATGTGCTACACTACGCCTACCCGCCGGGCACGCATCCTGGAGTACAAGCTTGACGGATGGTC CAATACAGACGTAGTAGCAAAACTTGGCCTTTCAAAGTCTACCGTGTCAAGGCAGTACCGCAGACTCCTCGAAACTCGTGATCCATACTCTGTGAAGGCTAAGACAGGACGTCCATGCAAGCTTACGGAG TCAGAGGGTCGCATTGCAGCCAGGATGATGGCGAGAGGTGAAGCCCGAGACGCAACAGATTTGAAAAGAAAGCAGTTCACGCATGTCCATGCTGCAACGGTGCGTCGCCAGCTTCGTAGACAGGGACTAC.

[0030] The present invention isolates a Vaning fibroporus ZAAS-S11 from a mulberry tree in Tonglu County, Hangzhou City, Zhejiang Province. The rRNA gene sequence analysis determines that the strain belongs to the Vaning fibroporus of the genus Morinius. The whole genome comparison with other Vaning fibroporus is performed, and the specific sequence exists, and the nucleic acid sequence is No.1. The strain grows at a medium speed in a PDA plate, with a growth rate of about 9-11 mm / d. The hyphae are light yellow and velvety, with obvious bulges in the middle. The vegetative hyphae wall is smooth, thin-walled to slightly later-walled, with simple septa and moderate branches. No spores are produced in the culture state ( Figure 1 A, B); The hyphae in PDB liquid medium culture are light yellow and exist in clusters ( Figure 1 C).

[0031] The Vaninian fibroporus ZAAS-S11 provided by the present invention is classified and named Sanghuangporusvaninii, and is deposited in the General Microbiology Center of the China Culture Collection Administration, and the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; the deposit date is July 5, 2024, and the deposit number is CGMCC NO.41355.

[0032] Isolation, identification and conservation of Sanghuangporus vaninii ZAAS-S11.

[0033] The fruiting bodies were collected from mulberry tree branches in Tonglu County, Hangzhou City, Zhejiang Province.

[0034] (1) Isolation of fungi: Clean the surface of the fruiting body with water, disinfect it with 75% alcohol, and place it on a clean bench. Use a sterile blade to remove about 0.5 cm of the surface of the fruiting body, and dig out a piece of about 0.5 cm 3 The fruiting body blocks were placed in a PDA plate culture medium containing penicillin-streptomycin (mg / L) and cultured at 28°C for about 7 days. The colonies that were not contaminated by other bacteria were picked and transferred to a new PDA plate culture medium containing penicillin-streptomycin (mg / L) until no more bacteria grew on the entire plate.

[0035] (2) Morphological identification: After strain ZAAS-S11 was transferred to PDA plates and cultured for 7 days, the mycelial morphology was observed. The strain grew at a moderate rate in the PDA plates, about 9-11 mm / d. The mycelium was light yellow and velvety, with a distinct bulge in the middle. The vegetative mycelium had smooth walls, thin to slightly thick walls, simple septa, and moderate branching. No spore production was observed under culture conditions.

[0036] (3) Molecular identification: Phylogenetic analysis was used to identify strain ZAAS-S11 in order to clarify its taxonomic status.

[0037] Specifically: By sequencing the ITS segment of strain ZAAS-S11, the ITS sequence of strain ZAAS-S11 was obtained, and the phylogenetic tree was constructed using the Neighbor-joining method using MEGA5.0 software, and the evolutionary relationship of strain ZAAS-S11 was comprehensively analyzed.

[0038] Depend on Figure 2 It can be seen that the strain ZAAS-S11 is most similar to Sanghuangporus vaninii FS656175, and it is determined that the strain is Sanghuangporus vaninii.

[0039] (4) Strain deposition: Sanghuangporus vaninii ZAAS-S11 strain was deposited in the General Microbiology Center of China Culture Collection Administration in July 2024 with the deposition number CGMCCNO.41355. The deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0040] Example 2 Application of Sanghuangporus vaninii ZAAS-S11 in alleviating inflammatory bowel disease.

[0041] a. Obtaining mycelium extract: The mycelium of strain ZAAS-S11 was inoculated in PDB medium and cultured at 25°C and 200 rpm for about 2 weeks. The mycelium was harvested and added to water at a solid-liquid ratio of 1:10 (w / v) by wet weight. The mixture was boiled for 3 h and filtered through gauze to collect the filtrate. The filtrate was heated and concentrated to a smaller volume and then freeze-dried to obtain the mycelium extract (SE).

[0042] b. Application of ZAAS-S11 in alleviating inflammatory bowel disease: Forty male C57BL / 6 mice weighing 25±2 g were purchased.

[0043] The mice were fed a maintenance diet for rats and mice with the nutritional composition of 20.50% crude protein, 4.62% crude fat, 1.23% calcium, 0.91% phosphorus, 1.30% lysine, and 0.68% methionine + cysteine.

[0044] The mice were equally divided into 4 treatment groups, with 10 mice in each group housed in the same cage. The groups were named control (Control), model group (DSS), and treatment group (DSS+SE).

[0045] After one week of pre-feeding, the Control group continued to drink tap water, the DSS group drank 1% DSS aqueous solution, and the DSS+SE group drank an aqueous solution containing 1% DSS and 1 mg / mL SE (based on the estimate that every 20g of body weight of mouse drank 5mL of water, the SE intake dose was approximately 250mg / kg body weight).

[0046] The mice were allowed to eat freely for 22 days, during which they were weighed daily. On the 22nd day, the mice were eyeballed and blood was collected. The mice were killed by cervical dislocation and then dissected to measure the length of the colon.

[0047] Figure 3 It can be seen that compared with the normal control group, the body weight of the DSS and DSS+SE groups quickly showed differences from the normal group. After the 7th day, the body weight of the DSS+SE group remained basically unchanged, but the body weight of the mice in the DSS group continued to decline. On the 21st day, the body weight of the DSS+SE group was significantly different from that of the DSS group (P<0.01). The autopsy found that the colon length of the DSS+SE group was significantly different from that of the DSS group (P<0.01), and there was no significant difference between the DSS+SE group and the normal group ( Figure 4 ).

[0048] The experiment used 1% DSS to model inflammatory bowel disease in mice. By feeding 1 mg / mL of mycelial extract aqueous solution, the Vaninia fibrosa ZAAS-S11 was able to significantly improve the weight loss and shortening of the colon caused by inflammatory bowel disease in mice, and effectively alleviate the symptoms of inflammatory bowel disease in mice.

Claims

1. A strain of ZAAS-S11 of Vaninia fibrosa, characterized in that: The strain comprises an ITS segment nucleic acid sequence and a specific segment nucleic acid sequence, the ITS segment nucleic acid sequence is shown in SEQ ID NO.1, the specific segment nucleic acid sequence is shown in SEQID NO.2, the classification name of the strain is Sanghuangporus vaninii, and the strain is preserved in the General Microbiology Center of the China Microorganism Culture Collection Administration, with the preservation number CGMCC NO.41355.

2. A medicament for alleviating symptoms of inflammatory bowel inflammation, characterized in that: The medicament is the mycelium or mycelium extract of the Vaninia fibrosa ZAAS-S11 strain according to claim 1.

3. The medicament according to claim 2, characterized in that: The mycelium extract has a concentration of 1 mg / mL.

4. The medicament according to claim 2, characterized in that: The mycelium extract can be administered orally, by intragastric administration, or by injection.

5. The medicament according to claim 2, characterized in that: The objects of prevention and treatment of the drug include mammals.

6. Use of the Inonotus vaninianus ZAAS-S11 strain as claimed in claim 1 in inflammatory bowel disease.

7. The use of the Vaninia fibrosa ZAAS-S11 strain in inflammatory bowel disease according to claim 6, characterized in that: The following steps are involved: The mycelium of ZAAS-S11 was cultured, and after the mycelium was harvested, it was extracted and concentrated by boiling, and the mycelium extract was obtained after freeze-drying.

8. A method for cultivating the Vaninia fibrosa ZAAS-S11 strain, characterized in that: The following steps are involved: S1: Get sub-entities; S2: bacterial strain isolation; S3: morphological identification; S4: Molecular characterization.

9. The method for cultivating the Vaninian polypore ZAAS-S11 strain according to claim 8, characterized in that: S2 comprises the following steps: cleaning the fruiting body with water, disinfecting the surface with 75% alcohol, placing the fruiting body in a clean bench, removing the surface of the fruiting body about 0.5 cm with a sterile blade, and digging out a piece of about 0.5 cm 3 The fruiting body blocks were placed in a PDA plate culture medium containing penicillin-streptomycin (mg / L), and cultured at 28°C for about 7 days. The colonies that were not contaminated by other bacteria were picked and transferred to a new PDA plate culture medium containing penicillin-streptomycin (mg / L) until no bacteria grew on the entire plate. The S3 included the following steps: After the strain ZAAS-S11 was transferred to the PDA plate and cultured for 7 days, the hyphae morphology was observed. The strain had a medium growth rate in the PDA plate, about 9-11 mm / d. The hyphae were light yellow and velvety, with an obvious bulge in the middle. The vegetative hyphae had smooth walls, thin to slightly thick walls, simple septa, moderate branches, and no spore production was observed under the culture state.

10. The method for cultivating the Vaninian polypore ZAAS-S11 strain according to claim 8, characterized in that: In S4, the strain ZAAS-S11 was identified by phylogenetic tree analysis: the ITS segment of the strain ZAAS-S11 was sequenced to obtain the ITS sequence of the strain ZAAS-S11, and the phylogenetic tree was constructed using MEGA5.0 software and the neighbor-joining method. The evolutionary relationship of the strain ZAAS-S11 was comprehensively analyzed, and the strain was determined to be Porites vaninensis.

Images