Sparassis crispa strain suitable for industrial cultivation and cultivation method of sparassis crispa strain

Abstract

The invention discloses a Sparassis sp. Strain (FJSXQJ-01) suitable for industrial cultivation, the preservation number of the strain is GDMCC 65276, the strain is preserved in Guangdong Microbiological Culture Collection Center, and the ITS sequence of the strain is as shown in SEQ ID NO: 1; the invention further discloses a cultivation method of the sparassis crispa strain. The cultivation method comprises the steps of mother strain preparation, stock culture, culture medium preparation and culture, primordium induction, fruiting management and the like. According to the sparassis crispa strain suitable for artificial cultivation, wild resource collection and systematic domestication breeding are carried out, the sparassis crispa variety suitable for artificial cultivation is bred, the sparassis crispa strain suitable for artificial factory cultivation and the matched cultivation method have the advantages that hyphae grow fast and are high in infectious microbe resistance, primordium is self-colored and robust, and the fruiting rate reaches up to 90% or above.

Description

Technical Field

[0001] The invention relates to a hydrangea strain suitable for factory cultivation and a cultivation method thereof, belonging to the technical field of edible fungus breeding. Background Art

[0002] Sparassis sp. belongs to Basidiomycota, Agaricomycetes, Polyporales, Sparassidaceae, and Sparassis. Sparassis is not only delicious, but also has multiple nutritional and health functions. Studies have shown that the content of β-glucan in Sparassis is very rich, which is of great development value. At present, the research on Sparassis mainly focuses on the biological characteristics of strains, nutritional components and medicinal value. The genetic breeding, cultivation technology, wild resource mining and liquid fermentation of Sparassis are still relatively weak. There are problems such as long cultivation cycle, inconsistent mushroom production time, low yield, and serious strain degeneration. At present, there are only two varieties of Sparassis recognized in my country, namely "Minxiu No. 1" and "Minxiu No. 2", both of which are Sparassis latifolia. The single variety and serious homogeneity of Sparassis have greatly hindered its cultivation scale, production capacity, and industrial development. Wild hydrangea resources are extremely scarce, resulting in a lack of genetic breeding materials and insufficient research, which seriously restricts the development of the hydrangea industry. Therefore, it is of great significance to tap local resources and carry out the domestication and cultivation of new species of hydrangea and the selection and breeding of excellent strains.

[0003] Most of the hydrangeas cultivated in my country are Sparassis latifolia, with fruiting bodies up to 30 cm high and 10 to 40 cm in diameter. The flesh is odorless and tasteless, hydrangea-shaped, leaf-like branches, and numerous wavy petals at the branch ends. They are white to milky white in the early stage, and dirty white to light brownish white when old. The flesh is flesh-colored, the hyphae are colorless, with thin to slightly thick walls, and many have lock-like joints. The stipes are mostly grown in the host body and can be up to 35 cm long. The spores are colorless, smooth in surface, and oval to spherical. The mushroom body contains a very rich amount of polysaccharides, and is a large fungus used for both medicine and food.

[0004] At present, most of the hydrangea mushrooms on the market are broad-leaved hydrangea mushrooms, which are single species, homogenized and seriously degraded, which has greatly hindered their cultivation scale, production capacity and industrial development. Wild hydrangea mushroom resources are extremely scarce, and there is a lack of development and utilization of local wild hydrangea mushroom resources, a lack of genetic breeding materials, and insufficient research, which seriously restricts the development of the hydrangea mushroom industry. Therefore, the selection and breeding of new varieties of hydrangea mushrooms is imminent. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a hydrangea strain suitable for factory cultivation and a cultivation method thereof, so as to solve the technical problems existing in the above-mentioned prior art.

[0006] The technical scheme adopted by the present invention is: a hydrangea strain suitable for cultivation, with a preservation number of GDMCC65276, preserved in Guangdong Provincial Microbiological Culture Collection Center, the strain is FJSXQJ-01, classified and named as hydrangea Sparassis sp., and its ITS sequence is shown in SEQ ID NO:1; through ITS sequence comparison, the strain is a species belonging to Polyporaceae, Hydrangeaceae, and Hydrangea, and belongs to the same genus Hydrangea as Sparassis latifolia widely cultivated on the market, but is a different species.

[0007] Preferably, the Hydrangea strain has a characteristic DNA sequence that is different from other strains, and the characteristic DNA sequence fragment is shown in SEQ ID NO:2.

[0008] Preferably, the described hydrangea strain has an elliptical to nearly spherical fruiting body, shaped like a blooming hydrangea, fleshy, with a short stalk, solitary, and the fruiting body is composed of many closely arranged fan-shaped sheet structures; the fan sheets mostly extend from the central stalk-like structure; they are grayish white and soft when fresh, turn light gray to light orange after aging, leathery, and cream white to light brown after drying, with a brittle texture, about 1 mm thick, the top edge of the fan sheets is entire or slightly wavy and slightly cracked, the top color is darker, the front and back sides have the same color, and the fungus aroma is obvious; the basidiospores are elliptical to nearly spherical, with a diameter of about 4.5-7.5×3.5-4(5.0)μm, transparent, and thin-walled; the basidia are narrow and nearly cylindrical (49-66×5-7μm), with spores on the top, and are transparent.

[0009] Preferably, the mycelium of the hydrangea strain in the mother culture medium is white, with a small amount of aerial hyphae, fast mycelium growth, good colony morphological consistency, and occasional regular concentric ring patterns on the colonies.

[0010] The factory cultivation method of the hydrangea is as follows:

[0011] (1) Preparation of mother culture: The weight composition formula of mother culture is 80%-85% potato, 7%-9% glucose, 1%-1.5% peptone, 0.5%-1% potassium dihydrogen phosphate, 0.2%-0.5% magnesium sulfate, 5%-10% agar, and then dilute to (grams of potato / 200) liters with pure water, sterilize, package, and cool for use. Inoculate the purified hydrangea mycelium into the above culture medium and culture it in the dark at 22±1°C;

[0012] (2) Stock culture: The weight composition is 70%-73% of sawdust, 8%-20% of corn flour, 3%-15% of bran, 0.1%-2% of sucrose, 0.1%-2% of peptone, 0.01%-1% of potassium dihydrogen phosphate, and 0.01%-0.2% of magnesium sulfate. The above components are stirred evenly, and water is added during the stirring process to make the water content 60%-62%; the culture medium is prepared according to the above formula, and after preparation, it is loaded into the culture bottle, sterilized at high temperature and high pressure, and cooled for use; the prepared mother culture is inoculated into the stock culture medium; and the culture is placed in the dark at 22±1°C for 25-30 days;

[0013] (3) Cultivated seed formula: The weight component formula is 0-73% pine sawdust, 0-80% miscellaneous sawdust, 0-16% corn flour, 0-12% bran, 0-12% flour, 1-2% sucrose, 0-1% peptone, 0-0.2% potassium dihydrogen phosphate, 0-0.2% magnesium sulfate, and 0-2% CaCO3. The above components are mixed evenly, and water is added during the mixing process to make the water content 60%-62%.

[0014] The culture medium is prepared according to the above formula, and after preparation, it is packed into a 170mm×330mm spawn bag, sterilized by high temperature and high pressure, and cooled for use; the prepared original seed is inoculated into the cultivation seed culture medium, and cultured in the dark at 22±1°C for 50-60 days, and the carbon dioxide concentration in the culture room does not exceed 2800ppm; (4) Primordial induction and mushroom fruiting management: in the primordial induction stage, the induction temperature is controlled at 18°C ​​for 12 days, the light intensity is 500-2000Lx, and the light intensity is not less than 8 hours per day, the carbon dioxide concentration in the induction room does not exceed 1800ppm, and the air humidity is about 70%; in the fruiting body development stage, the temperature is controlled at 18-22°C, and the culture is carried out for 18-25 days. The indoor carbon dioxide concentration does not exceed 1000ppm, and the air humidity is not less than 90-95%; the entire growth and development cycle is about 95-110 days.

[0015] Preferably, the cultivated species is cultivated: the weight component formula is 78% of miscellaneous sawdust, 10% of flour, 10% of corn flour, 1% of sucrose, and 1% of CaCO3. The above components are stirred evenly, and water is added during the stirring process to make the water content 60%.

[0016] Preferably, the cultivated species is cultured: the weight component formula is 71.8% of sawdust, 13% of corn flour, 5% of bran, 8% of flour, 1.5% of sucrose, 0.5% of peptone, 0.1% of potassium dihydrogen phosphate, and 0.1% of magnesium sulfate. The above components are stirred evenly, and water is added during the stirring process to make the water content 60%.

[0017] Preferably, the cultivated species is cultured: the weight component formula is 20% pine sawdust, 52.8% miscellaneous sawdust, 15% corn flour, 10% bran, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, and 0.1% magnesium sulfate. The above components are stirred evenly, and water is added during the stirring process to make the water content 60%.

[0018] Preferably, the cultivated species is cultured: the weight component formula is 40% pine sawdust, 32.8% miscellaneous sawdust, 15% corn flour, 10% bran, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, and 0.1% magnesium sulfate. The above components are stirred evenly, and water is added during the stirring process to make the water content 60%.

[0019] Preferably, the cultivated species is cultured: the weight component formula is 60% pine sawdust, 12.8% miscellaneous sawdust, 15% corn flour, 10% bran, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, and 0.1% magnesium sulfate. The above components are stirred evenly, and water is added during the stirring process to make the water content 60%.

[0020] Preferably, the cultivated species is cultured: the weight component formula is 72.8% pine sawdust, 15% corn flour, 10% bran, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, and 0.1% magnesium sulfate. The above components are stirred evenly, and water is added during the stirring process to make the water content 60%.

[0021] The beneficial effects of the invention are as follows: compared with the prior art, the invention provides a hydrangea strain suitable for cultivation, the fruiting body of the strain is grayish white to light orange in color, the flower shape is beautiful, and the nutrients are rich, which is different from all existing artificially cultivated hydrangea strains; the hydrangea strain suitable for artificial cultivation provided by the invention has characteristic DNA fragments and morphological characteristics that are different from other strains; the hydrangea strain suitable for artificial factory cultivation and the supporting cultivation method provided by the invention enable the mycelium to grow fast and have strong resistance to foreign bacteria, the primordium is self-colored and strong, and the mushroom yield rate is as high as 90% or more.

[0022] The present invention selects and breeds hydrangea varieties suitable for artificial cultivation by carrying out wild resource collection and systematic domestication and breeding, provides rich materials for the development of the hydrangea industry and genetic breeding, and promotes the rapid development of the hydrangea industry.

[0023] The hydrangea strain in the present invention is compared with the broad-leaf hydrangea strain on the market, and its appearance morphology is quite different. The primordium of the strain FJSXQJ-1 is pure white, and the fruit is grayish white and soft when fresh, and becomes light gray to light orange after aging, and the leathery flower is good, spherical, and the top edge is entire or slightly wavy, with fungus fragrance, strong anti-weeding ability of the strain, low pollution rate of the cultivation bag, and good consistency of mushroom production. In addition, by comparing with the nutritional component determination of the commercially available broad-leaf hydrangea, the fruiting body of the strain cultured by the present invention is richer in nutritional components than the commercially available broad-leaf hydrangea, and the crude polysaccharide content can reach 657.33 mg / g, which is approximately twice that of the broad-leaf hydrangea (329.30 mg / g), the crude protein content is 334.95 mg / g, while the broad-leaf hydrangea is only 85.55 mg / g; the crude fat content is 3.33%, while the broad-leaf hydrangea is only 1.90%. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a diagram of the morphological characteristics of wild strains of Hydrangea.

[0025] Figure 2 It is a mycelium diagram of the hydrangea strain of the present invention.

[0026] Figure 3 This is a diagram of the primordium of the hydrangea strain of the present invention.

[0027] Figure 4 This is a diagram of the primordium differentiation of the hydrangea strain of the present invention.

[0028] Figure 5 This is a morphological diagram of the Hydrangea latifolia strain.

[0029] Figure 6 It is a morphological diagram of the hydrangea strain of the present invention.

[0030] Figure 7 This is the mushroom fruiting situation of the hydrangea strain of the present invention. DETAILED DESCRIPTION

[0031] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments.

[0032] Embodiment 1:

[0033] A Sparassis sp. strain suitable for factory cultivation is disclosed. The strain has a collection number of GDMCC 65276 and is preserved in Guangdong Microbial Culture Collection Center. The strain is FJSXQJ-1 and is classified and named Sparassis sp.

[0034] The strain parent of the present invention is a wild hydrangea fruiting body collected from Fanjingshan National Nature Reserve in Tongren City, Guizhou Province in October 2022. Pure cultured mycelium is obtained by tissue separation, purification and identification. Through ITS sequence phylogenetic analysis, the strain is a species of the genus Hydrangea. The strain belongs to the order Polyporales, the family Hydrangeaceae, and the genus Hydrangea. Its ITS sequence is shown in SEQ ID NO: 1:

[0035] GTATTGGTACGACGGCAGTGTCTGAGGCTCGCTGCAGACCTGAAGCTTGATATCGAATTCGCGTGTCGCCCTTTCCTCCGCTTATTGATATGCTTAAGTTCGGCGGGTAGTCCTACCTGATTTGAGGTCAGACGGTCAGAAAGCTGTCCCGACAAAGGGACGATTGGAAGCCGACCCGCAGAGCGTCACGACCGCGGCGTAGACGATTATTATATCACACCGACGGCCGATCCGCAAAAGGTTCGCGCTAATGCGTTCCAGAGGAGCCGACTGACCAGAGCCGGCAGAAGCCTCCAAAGTCCAAGCTTCAAGCCCCGACAAAGGAGATGAAGTTGATGATTCCACGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAAATCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATAAGGTGCGTTACAAACGCGAGCGCATTCTATTAAGACATTCCTCCAGTGTGCGTGCCGAAGCCTTCCATCACCACATGATGACTCCAGCTATAGGGCAAATTCCCGTCCTCCCGCGCGAACCCCTGGGCAAACTGCCCCTGCTAAGCAGCAGTAGTGACAGAACCCCTGGGGCTAAGGATACTAAGGATTCAATCAGGCCCCAAGCAAGTGCTTAAACCTGCTCAGCAAGGCAGTGACACAACACCACCCCCCCAGGATCCTGGAGCTACACATCCCAGTCATAAAAGCTTTCATCACCACCATGTCGTACGAGGGCAGCAACGACAACACACATTCTCTGGTTCGTATATGAGGCCGGAAGGCACCGAGCCACGGCCCCTCTCGAGGCCGACCCGAAACCGACTTACCAAAAGGTTCACAGGTGTAAGAAGATGGAAGATGGATGGAGCGGGGCGTGCACATGCCTCCGTCAACGACGAAGAGGCCAGCGACAGCCCGGTTTCAAAACTCGATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACAATTTTACTTCCAGGGGGACCGCGAATTCAATTC

[0036] The strain has a characteristic DNA sequence that is different from other strains, and the characteristic DNA sequence fragment is shown in SEQ ID NO:2.

[0037] The characteristic DNA fragment sequence information of the strain is as follows:

[0038] GCTGCCTAGGCTTCTTCACGGACCTCCACGCCTGCCTACTCGTCGGCGCGTCACTTCAACGCCGACGGTGAGGTATGGGTAACACGCTTGAGCGCCATCCATTTTCAGGGCTGGTTCATTCGGCAGGTGAGTTGTTACACACTCCTTGGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTAGATGAACCAACACCTTTTGTGGTGTCTGATGAGCGTGCATTCCGGCACCTTAACCTCACGTTCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACTAGAAACTCTCAATCGCCGAGCGGTCCAATCGAGGGACGGCCCGTTCTTACATATTTAAAGTTTGAGAATAGGTTGAGGTCGTTTCGACCCCAAGGCCTCTAATCATTCGCTTTACCACATAAATCTGATACGAGTTTCTGCTATCCTGAGGGAAACTTCGGCAGGAACCAGCTACTAGATGGTTCGATTAGTCTTTCGCCCCTATACCCAAATTCGACGATCGATTTGCACGTCAGAATCGCTACGAGCCTCCACCAGAGTTTCCTCTGGCTTCACCCTATTCAGGCATAGTTCACCATCTTTCGGGTCCCAACATGCACGCTCCACCGCAGAGCCGTCACAGCAGTTCAGGTCCGGGCGTCGATGCTCCCCACGACGGGGATCTCGACCTTTCACTTTCGTTGCGCGCTCGGGTTTTCCACCCAAACACTCGCGGGCATGTTAGACTCCTTGGTCCGTGTTTCAAGACGGGTCGTTTAAAGCCATTACGCCAGCATCCTAAGCACGAGCGTGGGCGAACCCCGACCGTAAAGGCGTGCTGAGTTCCTCGATCCCCACCGCCGTATGCGACCGAGGGCTATAACACACCGTGATGATGGTGCCACGTTCCCTCGACCTTTATCCGGCGGTCGAAATCGATGCTGGCCCGTCGACCGGAAAGTGCACCGAGCGAAAGAGCAAGGCTGACTTCCGGCCAACGCGACTGACTTCAAGCGTTTCCCTTTCAGCAATTTCACGTACTGTTTAACTCTCTTTCCAAAGTTCTTTTCATCTTTCCCTCACGGTACTTGTTCGCTATCGGTCTCTCGCCAATATTTAGCTTTAGATGGAATTTACCACCCGTTTTGAGCTGCATTCCCAAACAACTCGACTCATCGA GAGCGCATCACAAGCACCGGCGGTCCGTGTCAAAGACGGGATTCTCACCCTCTACGACGCTCTGTTCCAAGAGACTTGTACACGGTCCGGCGCGGAAGGCGCTTCTCCAGATTACAACTCGGACGGCGGTGAAACCGTCAGATTTTAAATTTGAGCTCTTCCCGCTTCACTCGCAGTTACTAGGGGA

[0039] The present embodiment also includes a cultivation method of a hydrangea strain suitable for factory cultivation as follows:

[0040] (1) Production of mother stock

[0041] The formula of the mother culture is 200g of potato, 20g of glucose, 3g of peptone, 1.5g of potassium dihydrogen phosphate, 1g of magnesium sulfate, and 20g of agar, and then the volume is made up to 1 liter with pure water, sterilized, packaged, cooled and set aside. The purified hydrangea mycelium is inoculated into the above culture medium and cultured in the dark at 20-22°C. The mycelium of the strain in the mother culture medium is white, with a small amount of aerial mycelium, the mycelium grows faster, and the colony morphology is consistent.

[0042] (2) Production and cultivation of original seeds

[0043] The original seed culture formula is 72.8% sawdust, 15% corn flour, 10% bran, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, and 0.1% magnesium sulfate. The above components are stirred evenly, and water is added during the stirring process to make the water content 60%-62%. The culture medium is prepared according to the above formula, and after preparation, it is put into the strain bottle, sterilized at high temperature and high pressure, and cooled for use. The prepared mother strain is inoculated into the original seed culture medium. It is placed in dark culture at 20-22°C for 25-30 days.

[0044] (3) Cultivation and cultivation of cultivars

[0045] Cultivar formula:

[0046] Formula 1: 78% sawdust, 10% flour, 10% corn flour, 1% sucrose, 1% CaCO3. Mix the above components evenly and add water during the mixing process to make the water content 60%.

[0047] Formula 2: 71.8% sawdust, 13% corn flour, 5% bran, 8% flour, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, 0.1% magnesium sulfate. Mix the above components evenly and add water during the mixing process to make the water content 60%.

[0048] Formula 3: 20% pine sawdust, 52.8% miscellaneous sawdust, 15% corn flour, 10% bran, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, 0.1% magnesium sulfate. Mix the above components evenly and add water during the mixing process to make the water content 60%.

[0049] Formula 4: 40% pine sawdust, 32.8% miscellaneous sawdust, 15% corn flour, 10% bran, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, 0.1% magnesium sulfate. Mix the above components evenly and add water during the mixing process to make the water content 60%.

[0050] Formula 5: 60% pine sawdust, 12.8% miscellaneous sawdust, 15% corn flour, 10% bran, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, 0.1% magnesium sulfate. Mix the above components evenly and add water during the mixing process to make the water content 60%.

[0051] Formula 6: 72.8% pine sawdust, 15% corn flour, 10% bran, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, 0.1% magnesium sulfate. Mix the above components evenly and add water during the mixing process to make the water content 60%.

[0052] Prepare the culture medium according to the above formula, put it into 170mm×330mm bags, sterilize it under high temperature and high pressure, and cool it for use. Inoculate the prepared stock into the culture medium, and culture it in the dark at 22±1℃ for 50-60 days. The carbon dioxide concentration in the culture room shall not exceed 2800ppm.

[0053] (4) Primordial induction and mushroom production management

[0054] In the primordium induction stage, the induction temperature is controlled at 18℃ for 12 days, the light is 500-2000Lx, the light is not less than 8 hours a day, the carbon dioxide concentration in the induction room does not exceed 1800ppm, and the air humidity is about 70%. In the fruiting body development stage, the temperature is controlled at 18-22℃, the culture is carried out for 18-25 days, the indoor carbon dioxide concentration does not exceed 1000ppm, and the air humidity is not less than 92%. The entire growth and development cycle is about 110 days.

[0055] The production data of the six cultivation formulas are shown in Table 1:

[0056] Table 1 Production status data

[0057]

[0058] As shown in Table 1, all six cultivation formulas can produce mushrooms, but the differences between different formulas are quite obvious. Formula 1 has the highest comprehensive yield, reaching 112.32 g / bag, and has a low contamination rate and a moderate cultivation cycle. It is the most suitable production formula for this strain. Formula 5 is second, with a slightly lower yield than Formula 1, but the highest fruiting rate and the lowest contamination rate. Formula 3 has the worst effect, the lowest yield, and the lowest fruiting rate, and should be eliminated in production.

[0059] The nutritional components of Hydrangea spp. FJSXQJ-1 strain and Hydrangea spp. are compared as shown in Table 2:

[0060] Table 2 Comparison of nutritional components between Hydrangea oleracea FJSXQJ-1 strain and Hydrangea latifolia

[0061]

[0062] Note: All test results were completed by Sanshu Biological Co., Ltd.

[0063] As can be seen from Table 2, the fruiting bodies cultivated by the strain of the present invention have richer nutritional components than the commercially available Hydrangea spp., with a crude polysaccharide content of 657.33 mg / g, which is approximately twice that of Hydrangea spp. (329.30 mg / g); a crude protein content of 334.95 mg / g, while that of Hydrangea spp. is only 85.55 mg / g; and a crude fat content of 3.33%, while that of Hydrangea spp. is only 1.90%. This indicates that the Hydrangea spp. produced by the strain has richer nutritional components and is of great cultivation value.

[0064] As can be seen from the accompanying drawings, the mycelium in this embodiment grows faster, has a strong ability to resist foreign bacteria, the primordium is white and strong, the mushroom production is consistent, and the mushroom production rate reaches 90%.

[0065] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. A strain of Sparassis sp. suitable for factory cultivation (FJSXQJ-01), characterized in that: The strain has a deposit number of GDMCC 65276 and is deposited in Guangdong Microbiological Culture Collection Center. Its ITS sequence is shown in SEQ ID NO:

1.

2. The method for cultivating a Sparassis sp. strain (FJSXQJ-01) suitable for factory cultivation according to claim 1, characterized in that: Here’s how: (1) Preparation of mother culture: The weight composition formula of mother culture is 80%-85% potato, 7%-9% glucose, 1%-1.5% peptone, 0.5%-1% potassium dihydrogen phosphate, 0.2%-0.5% magnesium sulfate, and 5%-10% agar, and then the volume is made up to (grams of potato / 200) liters with pure water, sterilized, packaged, cooled and set aside; the purified hydrangea mycelium is inoculated into the above culture medium and cultured in the dark at 22±1°C; (2) Stock culture: The weight composition is 70%-73% of sawdust, 8%-20% of corn flour, 3%-15% of bran, 0.1%-2% of sucrose, 0.1%-2% of peptone, 0.01%-1% of potassium dihydrogen phosphate, and 0.01%-0.2% of magnesium sulfate. The above components are stirred evenly, and water is added during the stirring process to make the water content 60%-62%; the culture medium is prepared according to the above formula, and after preparation, it is loaded into the culture bottle, sterilized at high temperature and high pressure, and cooled for use; the prepared mother culture is inoculated into the stock culture medium; and the culture is placed in the dark at 22±1°C for 25-30 days; (3) Cultivated seed formula: The weight composition formula is 0-73% pine sawdust, 0-80% miscellaneous sawdust, 0-16% corn flour, 0-12% bran, 0-12% flour, 1-2% sucrose, 0-1% peptone, 0-0.2% potassium dihydrogen phosphate, 0-0.2% magnesium sulfate, and 0-2% CaCO3. The above components are stirred evenly, and water is added during the stirring process to make the water content 60%-62%; Prepare the culture medium according to the above formula, put it into a 170mm×330mm bacterial bag after preparation, sterilize it with high temperature and high pressure, and set it aside after cooling; inoculate the prepared original seed into the cultivation medium, place it in the dark at 22±1℃ for 50-60 days, and the carbon dioxide concentration in the culture room shall not exceed 2800ppm; (4) Primordial induction and fruiting management: During the primordial induction stage, the induction temperature is controlled at 18°C ​​for 12 days, the light intensity is 500-2000Lx, and the light intensity is not less than 8 hours per day. The carbon dioxide concentration in the induction room does not exceed 1800ppm, and the air humidity is about 70%; during the fruiting body development stage, the temperature is controlled at 18-22°C, the culture is carried out for 18-25 days, the indoor carbon dioxide concentration does not exceed 1000ppm, and the air humidity is not less than 90-95%; the entire growth and development cycle is about 95-110 days.

3. The method for cultivating a Sparassis sp. strain (FJSXQJ-01) suitable for factory cultivation according to claim 2, characterized in that: Cultivation of cultivated species: The weight component formula is 78% of sawdust, 10% of flour, 10% of corn flour, 1% of sucrose, and 1% of CaCO3. The above components are mixed evenly, and water is added during the mixing process to make the water content 60%.

4. The method for cultivating a Sparassis sp. strain (FJSXQJ-01) suitable for factory cultivation according to claim 2, characterized in that: Cultivation of cultivated species: The weight component formula is 71.8% of sawdust, 13% of corn flour, 5% of bran, 8% of flour, 1.5% of sucrose, 0.5% of peptone, 0.1% of potassium dihydrogen phosphate, and 0.1% of magnesium sulfate. Stir the above components evenly, and add water during the stirring process to make the water content 60%.

5. The method for cultivating a Sparassis sp. strain (FJSXQJ-01) suitable for factory cultivation according to claim 2, characterized in that: Cultivation of cultivated species: The weight component formula is 20% pine sawdust, 52.8% miscellaneous sawdust, 15% corn flour, 10% bran, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, and 0.1% magnesium sulfate. Stir the above components evenly, and add water during the stirring process to make the water content 60%.

6. The method for cultivating a Sparassis sp. strain (FJSXQJ-01) suitable for factory cultivation according to claim 2, characterized in that: Cultivation of cultivated species: The weight component formula is 40% pine sawdust, 32.8% miscellaneous sawdust, 15% corn flour, 10% bran, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, and 0.1% magnesium sulfate. Stir the above components evenly, and add water during the stirring process to make the water content 60%.

7. The method for cultivating a Sparassis sp. strain (FJSXQJ-01) suitable for factory cultivation according to claim 2, characterized in that: Cultivation of cultivated species: The weight component formula is 60% pine sawdust, 12.8% miscellaneous sawdust, 15% corn flour, 10% bran, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, and 0.1% magnesium sulfate. Stir the above components evenly, and add water during the stirring process to make the water content 60%.

8. The method for cultivating a Sparassis sp. strain (FJSXQJ-01) suitable for factory cultivation according to claim 2, characterized in that: Cultivation of cultivated species: The weight component formula is 72.8% pine sawdust, 15% corn flour, 10% bran, 1.5% sucrose, 0.5% peptone, 0.1% potassium dihydrogen phosphate, and 0.1% magnesium sulfate. The above components are stirred evenly, and water is added during the stirring process to make the water content 60%.

Images