Microbial cell factories for catechol production

Abstract

This invention relates to the field of synthetic biology, and more particularly to a microbial cell factory for producing catechols. The invention uses *Pseudomonas putida* strains with the pcaHG, catA, and catA2 genes knocked out as substrate bacteria, and introduces exogenous AroY and / or kpdB genes, or increases the expression of endogenous genes VanAB and PobA. Through a strategy of cofactor regulation and key enzyme overexpression, lignin-derived monomers are efficiently converted into catechols, achieving a conversion rate of 98.5% and a maximum yield of 14.1 mM, a significant improvement compared to the previous conversion rate of 64%.

Description

Technical Field

[0001] This invention relates to the field of synthetic biology, and more particularly to microbial cell factories for producing catechols. Background Technology

[0002] Catechol, also known as catechol, is an organic compound with the chemical formula C6H6O2, and is a white crystalline powder. Catechol contains two adjacent hydroxyl groups, giving it excellent antioxidant and antibacterial properties. It is also an important intermediate in the chemical synthesis of pesticides, flavoring agents, pharmaceuticals, and biomaterials, and can be used as a rubber hardener, electroplating additive, skin antiseptic and bactericidal agent, hair dye, photographic developer, and color photography antioxidant, among other applications.

[0003] Currently, catechins are mainly obtained through chemical synthesis. However, chemical synthesis processes are complex, produce numerous byproducts, and are difficult to control under varying reaction conditions, resulting in a persistent supply shortage. Microbial methods, on the other hand, are gaining increasing attention due to their rapid reaction, suitability for industrial-scale production, environmental friendliness, and solvent-free nature.

[0004] Lignin is the main component of lignocellulose biomass and the world's largest source of renewable aromatic compounds. Approximately 150 billion tons of lignin are produced annually; however, the vast majority is used for combustion and power generation, leading to resource waste and environmental pollution. Lignin can be converted into catechols via microbial methods. First, microorganisms secrete lignin-degrading enzymes, such as lignin peroxidase and manganese peroxidase, to depolymerize lignin. Then, through a series of redox and enzymatic reactions, the depolymerized products are further converted into catechols. Therefore, the microbial method for converting lignin into catechols is a promising approach for lignin value-added and catechol production.

[0005] *Pseudomonas putida*, possessing multiple metabolic pathways for lignin derivatives, serves as an excellent platform for lignin biotransformation. Through gene editing and metabolic regulation, efficient conversion of lignin to catechols can be achieved. Current research has explored methods in *Pseudomonas putida* to convert ferulic acid and p-coumaric acid monomers into catechols by knocking out downstream degradation pathways and introducing protocatechuic acid decarboxylase from *Enterobacter cloacae* and vanillic acid O-demethylase from *Acinetobacter*. However, the highest efficiencies achieved are only 6% and 64%, respectively, indicating significant room for improvement. Summary of the Invention

[0006] In view of this, the technical problem to be solved by the present invention is to provide a microbial cell factory for producing catechol.

[0007] This invention uses *Pseudomonas putida* as the chassis cell and proposes a solution to the problems of intermediate product accumulation and low heterologous expression efficiency. It provides a metabolic regulation strategy for *Pseudomonas putida*, offering a promising approach for the biotransformation of lignin.

[0008] The catechol-producing strain provided by the present invention is *Pseudomonas putida* containing at least one of the following I) to IV);

[0009] I) Nucleic acid encoding protocatechuic acid decarboxylase;

[0010] II) Nucleic acid encoding vanillic acid O-demethylase oxygenase;

[0011] III) Nucleic acid encoding 4-hydroxybenzoic acid 3-monooxygenase;

[0012] IV) Nucleic acids encoding isopentenyltransferases.

[0013] In this invention, the sources of protocatechuic acid decarboxylase were screened, for example: AroY from *Enterobacter cloacae*, Pdc from *Klebsiella pneumoniae*, and TaGDC from *Talaromyces atroroseus*. Among the protocatechuic acid decarboxylases from multiple sources, the protocatechuic acid decarboxylase from *Enterobacter cloacae* achieved a higher conversion rate. This invention optimized the codons of the nucleic acid encoding the protocatechuic acid decarboxylase to better match the original genome characteristics of *Pseudomonas putida*, and added the RBS sequence TAGAAAACCTCCTTA to the 5' end. Compared to other optimization schemes, the nucleic acid encoding the protocatechuic acid decarboxylase, as shown in SEQ ID NO:1, exhibits superior performance.

[0014] In this invention, the vanillic acid O-demethylase oxygenase is a vanillic acid O-demethylase oxygenase from *Pseudomonas putida*. In this invention, the RBS sequence TAGAAAACCTCCTTA is added to the 5' end of the nucleic acid encoding the vanillic acid O-demethylase oxygenase. The nucleic acid encoding the vanillic acid O-demethylase oxygenase is shown in SEQ ID NO:2.

[0015] In this invention, the 4-hydroxybenzoic acid 3-monooxygenase is a 4-hydroxybenzoic acid 3-monooxygenase derived from *Pseudomonas putida*. In this invention, the RBS sequence TAGAAAACCTCCTTA is added to the 5' end of the nucleic acid encoding 4-hydroxybenzoic acid 3-monooxygenase. The nucleic acid encoding 4-hydroxybenzoic acid 3-monooxygenase is shown in SEQ ID NO:3.

[0016] This invention also screened the sources of isopentenyltransferases, such as EcdB from *Enterobacter cloacae*, KpdB from *Klebsiella pneumoniae*, UbiX from *E. coli*, and PADI from yeast. Preferably, the isopentenyltransferase is from *Klebsiella pneumoniae*, which yields higher conversion rates. This invention also optimized the codons of the nucleic acid encoding the isopentenyltransferase to better match the original genome characteristics of *Pseudomonas putida*, and added the RBS sequence TAGAAAACCTCCTTA to the 5' end. Compared to other optimization schemes, the nucleic acid encoding the isopentenyltransferase, as shown in SEQ ID NO:4, achieves superior results.

[0017] In a specific embodiment, the strain contains nucleic acids encoding protocatechuic acid decarboxylase, vanillic acid O-demethylase oxygenase, 4-hydroxybenzoic acid 3-monooxygenase, and isopentenyltransferase. More specifically, this invention utilizes the heterologous expression of protocatechuic acid decarboxylase AroY from Enterobacter cloacae and isopentenyltransferase from Klebsiella pneumoniae in *Pseudomonas putida* to improve the conversion efficiency of protocatechuic acid decarboxylase. Intermediate products are eliminated by overexpressing the endogenous key enzyme genes pobA and vanAB, thereby increasing catechol yield.

[0018] In some embodiments, the strain expresses any one of protocatechuic acid decarboxylase, vanillic acid O-demethylase oxygenase, 4-hydroxybenzoic acid 3-monooxygenase, or isopentenyltransferase.

[0019] In some embodiments, the strain expresses:

[0020] Protocatechuic acid decarboxylase and vanillic acid O-demethylase oxygenase;

[0021] Or it may express protocatechuic acid decarboxylase and 4-hydroxybenzoic acid 3-monooxygenase;

[0022] Or it may express protocatechuic acid decarboxylase and isopentenyltransferase;

[0023] Or it may express vanillic acid O-demethylase oxygenase and 4-hydroxybenzoic acid 3-monooxygenase;

[0024] Or it may express vanillic acid O-demethylase oxygenase and isopentenyltransferase;

[0025] Or it may express 4-hydroxybenzoic acid 3-monooxygenase and isopentenyltransferase.

[0026] In other embodiments, the strain expresses:

[0027] Protocatechuic acid decarboxylase, vanillic acid O-demethylase oxygenase, and 4-hydroxybenzoic acid 3-monooxygenase.

[0028] It may express protocatechuic acid decarboxylase, vanillic acid O-demethylase oxygenase, and isopentenyltransferase.

[0029] It may express protocatechuic acid decarboxylase, 4-hydroxybenzoic acid 3-monooxygenase, and isopentenyltransferase.

[0030] It may express vanillic acid O-demethylase oxygenase, 4-hydroxybenzoic acid 3-monooxygenase and isopentenyltransferase.

[0031] In this invention, the pcaHG, catA, and catA2 genes in *Pseudomonas putida* are knocked out. The pcaHG gene is protocatechuic acid 3,4-dioxygenase, the catA gene is a catechol-degrading enzyme, and the catA2 gene is a catechol-degrading enzyme. This invention uses *Pseudomonas putida* with the pcaHG, catA, and catA2 genes knocked out as the substrate bacteria, and introduces exogenous AroY, VanAB, PobA, and / or kpdB genes into it. Catechol production is increased by enhancing the expression of endogenous key enzyme genes and overexpressing isopentenyltransferase to enhance cofactor supply.

[0032] Furthermore, the present invention also provides a method for constructing the strain as described above, comprising:

[0033] Construct a plasmid vector containing at least one of the following: nucleic acid encoding protocatechuic acid decarboxylase, nucleic acid encoding vanillic acid O-demethylase oxygenase, nucleic acid encoding 4-hydroxybenzoic acid 3-monooxygenase, and nucleic acid encoding isopentenyltransferase; and transfect or transform the plasmid vector into *Pseudomonas putida*.

[0034] The construction method described in this invention also includes the step of knocking out the pcaHG gene, the catA gene, and the catA2 gene.

[0035] In this invention, the plasmid vector is pBBR1MCS-2, or a pUC series vector (e.g., pUC18, pUC19, pUC57), pTZ series vector (e.g., pTZ19R), pMD series vector (e.g., PMD18T), pQE series vector (e.g., pQE30), pTrc series vector (e.g., pTrcHisA), pTrx series vector (e.g., pTrxFus), pRSET series vector (e.g., pRSET-A, pRSET-B), pVAX series vector (e.g., pVAX1), pBR series vector (e.g., pBR322), pbv series vector (e.g., pbv220), or pBluescript II series vector (e.g., pBluescript II). KS(+)), L4440 series vectors (e.g., L4440), pCAMBIA series vectors (e.g., pCAMBIA-1301), pMAL series vectors (e.g., pMAL-p2X), and pGD series vectors (e.g., pGD926).

[0036] In some specific embodiments, the plasmid vector overexpressing the AroY, VanAB, PobA, and / or kpdB genes in this invention is pBBR1MCS-2, and the insertion sites of the exogenous fragments are Sac I, Spe I, BamH I, and Hind III. In this invention, the plasmid vector is constructed using the Gibson method.

[0037] In some specific embodiments, the strain is constructed using transformation. Specifically, the strain is constructed using rapid transformation.

[0038] Furthermore, the present invention also provides a method for preparing catechins, comprising: using ferulic acid and / or p-coumaric acid as substrates, fermenting with the strain to obtain a product containing catechins.

[0039] In this invention, the fermentation medium is an M9 medium containing glucose, ferulic acid and p-coumaric acid.

[0040] M9 medium contains 6.78 g / L Na2HPO4, 3.00 g / L KH2PO4, 1.00 g / L NH4Cl, 0.50 g / L NaCl, 0.24 g / L MgSO4, and trace elements (0.060 g / L FeSO4·7H2O, 0.00270 g / L CaCO3, 0.002 g / L ZnSO4·H2O, 0.00116 g / L MnSO4·H2O, 0.00037 g / L CoSO4·7H2O, 0.00033 g / L CuSO4·5H2O, and 0.00008 g / L H3BO3).

[0041] The glucose content in the culture medium is 15-25 g / L, for example, glucose content of 15 g / L, 16 g / L, 17 g / L, 18 g / L, 19 g / L, 20 g / L, 21 g / L, 22 g / L, 23 g / L, 24 g / L, 25 g / L.

[0042] The content of ferulic acid in the culture medium is 1-10 mM, for example, the content of ferulic acid is 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM.

[0043] The content of p-coumaric acid in the culture medium is 1-10 mM, for example, the content of p-coumaric acid is 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM.

[0044] In a specific embodiment, the fermentation medium includes: M9 medium containing 20 g / L glucose, 5 mM ferulic acid and 5 mM p-coumaric acid.

[0045] In this invention, the initial inoculation concentration of the strain is OD. 600 =1.0, the fermentation conditions are 180 rpm, 30°C, fermentation for about 72 hours.

[0046] This invention uses *Pseudomonas putida* strains with the pcaHG, catA, and catA2 genes knocked out as substrate bacteria, and introduces exogenous AroY and / or kpdB genes, or increases the expression of endogenous genes VanAB and PobA. Through a strategy of cofactor regulation and key enzyme overexpression, lignin-derived monomers are efficiently converted into catechols, achieving a conversion rate of 98.5% and a maximum yield of 14.1 mM, representing a significant improvement compared to the previous conversion rate of 64%. Attached Figure Description

[0047] Figure 1 This demonstrates the route for synthesizing catechols from ferulic acid and p-coumaric acid;

[0048] Figure 2 The yield of catechols by each strain using FA and p-CA as substrates is shown. Detailed Implementation

[0049] This invention provides a microbial cell factory for producing catechols. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0050] Unless otherwise defined in this invention, scientific and technical terms related to this invention shall have the meanings understood by one of ordinary skill in the art.

[0051] In this application, the terms "comprising," "including," and "having" are used interchangeably to indicate the inclusiveness of a solution, meaning that the solution may contain elements other than those listed. It should also be understood that the use of "comprising," "including," and "having" herein also provides for solutions "consisting of...".

[0052] In this application, the term "and / or" describes the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can represent: A existing alone, A and B existing simultaneously, or B existing alone. A and B can be singular or plural.

[0053] In this application, "at least one" means one or more, and "more than one" means two or more. "At least one of the following" or similar expressions refer to any combination of these items, including any combination of single or multiple items.

[0054] The plasmid used in this article is pBBR1MCS-2.

[0055] The sclerotium P. putida KTCA01 used in this article was obtained from the laboratory (Tianjin University) by knocking out the pcaHG, catA and catA2 genes of wild-type Pseudomonas putida.

[0056] The primer sequences used in this article include:

[0057] yz-pBBR1-for:ttacaatttccattcgccattcagg

[0058] yz-pBBR1-rev:ttaatgcagctggcacgaca

[0059] vanAB-BM-F:ggcggccgctctagaactagataaggaggttttctaatgtaccccaaaaacacctgg

[0060] vanAB-BM-R:gcgacaagaagtaaggatccactagtcagatgtccagcaccagc

[0061] yz-cx-R:caactggacccaagccaatc

[0062] PobA-BM-F: tgctggtgctggacatctgactagtaaggaggttttctaatgaaaactcaggttgcaattatPobA-BM-R: caagaagtaaggatccactagtcaggcaacttcctcgaacg

[0063] cx-PobA-F:agagaatggtatcgagatcg

[0064] KpdB-T7-F:tcactatagggcgaattggagctctaaggaggttttctaatgaagc

[0065] KpdB-T7-R:agagcggccgccaccgcggtcctatagtgagtcgtattaggagctcttactcgatctcttg

[0066] yz-KpdB-R:actcgatctcttgagcgaact

[0067] The gene sequences used in this article include:

[0068] >AroY gene sequence (as shown in SEQ ID NO:1)

[0069]

[0070] >vanAB fragment sequence (as shown in SEQ ID NO:2)

[0071]

[0072] >pobA gene fragment (as shown in SEQ ID NO:3)

[0073]

[0074] >kpdB gene (as shown in SEQ ID NO:4)

[0075] TAAGGAGGTTTTCTAatgaagctgatcatcggcatgaccggtgccaccggtgctccactgggtgtggccttgctgcaggccttgcgtgacatgccggaagtggagactcacctggtgatgagcaagtgggccaagaccaccatcgagctgga aacgccatggaccgcacgtgaagtggccgcactggccgacttcagccattcgccagccgatcaagccgccaccatcagcagcggtagcttccgtaccgatggcatgatcgtgattccgtgcagcatgaagaccttggccggtatccgtgcag gttacgccgaaggcttggtgggtcatgcagccgatgtggtgctgaaagaaggccgtaagctggtgctggtgccacgtgaaatgccgctgagcaccatccacctggagaacatgctggcactgagccgtatgggcgtggccatggtgccgcca atgagcgcctactacaaccatccggaaaccgtggacgacatcaccaaccacatcgtgacgcgtgtgctggaccagttcggtctggactaccacaaggcacgtcgttggaacggtctgcgtaccgccgaacagttcgctcaagagatcgagtaa

[0076] The test materials used in this invention are all common commercial products and can be purchased on the market.

[0077] The present invention will be further illustrated below with reference to the embodiments:

[0078] Example 1: Construction of P. putida KTCA01 (taking pcaHG knockout as an example)

[0079] E. coli containing the pSEVA-gRic6T plasmid were cultured overnight in LB medium containing gentamicin, and the plasmid was extracted. A suitable gRNA was selected from the pcaHG gene. The obtained pSEVA-gRic6T plasmid was digested into a linear fragment using BsaI, and the linear fragment and gRNA were ligated using T4 DNA ligase. The resulting fragment was then transformed into colonic culture, plated on LB agar plates containing gentamicin, and incubated overnight at 37°C. White clones were then selected, and single colonies were further cultured overnight in LB medium containing gentamicin. The plasmid containing the gRNA was extracted and double-digested with BamHI and SpeI to obtain the linear fragment. Simultaneously, PCR was performed using Q5 high-fidelity DNA polymerase with the wild-type P. putida KT2440 genome as a template to obtain the upper and lower homologous arms of the target gene. The linearized plasmid and the upper and lower homologous arms were seamlessly assembled using BM cloning, followed by colonic transformation, and the plasmid was extracted to verify its correctness.

[0080] The plasmid pCAS-RK2T was electroporated into wild-type *Pseudomonas putida* and plated on tetracycline-containing agar plates. The correct strain was then inoculated into LB broth supplemented with tetracycline and cultured at 30°C for 12 h. Subsequently, the strain was transferred to fresh LB broth (with tetracycline) supplemented with 6.0 g / L arabinose to induce λ-Red protein expression. After 3 h, the pSEVA-gRic6T-pcaHG plasmid was electroporated into competent cells and plated on double-antibiotic (tetracycline + gentamicin) agar plates and cultured overnight at 30°C. Colony PCR was used to screen for correctly edited transformants, which were then inoculated into LB liquid medium supplemented with tetracycline and 500 mM rhamnose to target and eliminate the pSEVA-gRNAT-pcaHG-related plasmid. The strains that lost the pSEVA-gRNAT-pcaHG plasmid were then inoculated into LB medium containing 10 g / L sucrose and 5 g / L glucose and cultured for 24 h to eliminate the pCAS-RK2T plasmid. The bacterial culture was then plated onto LB agar plates and incubated overnight at 30°C to obtain plasmid-free strains.

[0081] The knockout methods for catA and catA2 are as described above, ultimately yielding the basal strain P. putida KTCA01 with pcaHG, catA, and catA2 knocked out.

[0082] Example 2: Addition of the gene for protocatechuic acid decarboxylase AroY from Enterobacter cloacae.

[0083] A plasmid containing the gene for exogenous protocatechuic acid decarboxylase (AroY) was introduced into the spore strain P. putida KTCA01(ΔpcaHG,ΔcatA,ΔcatA2) to obtain strain KTCA02.

[0084] Experimental Methods: Plasmids pUC57-AroY and pBBR1MCS-2 were digested with restriction endonucleases Hind III and Bam HI. The linearized plasmid pBBR1MCS-2 and gene fragment aroY were assembled using Gibson DNA synthesis and transformed into competent E. coli cells to amplify the plasmid. The amplified plasmid was then plated on LB plates containing 50 mg / L kanamycin. After overnight incubation at 37°C, the transformants were verified using primers yz-pBBR1-for and yz-pBBR1-rev. The correctly verified strain was inoculated into LB liquid medium and incubated overnight at 37°C. The plasmid was then extracted and sequenced for verification. The correct plasmid was named pCA02. The plasmid was then transformed into P. putidaKTCA01 via electroporation and plated on solid medium containing kanamycin resistance. The plated plasmid was incubated overnight at 30°C. The obtained transformants were verified using the primers yz-pBBR1-for and yz-pBBR1-rev, and the correct strain P. putida KTCA02 was obtained.

[0085] Fermentation method: Recombinant *Pseudomonas putida* from glycerol medium was inoculated into test tubes containing 5 mL of Luria-Bertani medium, and 50 mg / mL kanamycin was added. The mixture was incubated on a shaker at 220 rpm and 30°C for approximately 20 hours. The bacterial broth that reached the logarithmic growth phase was transferred to a 250 mL shake flask containing 50 mL of M9 mineral medium and 20 g / L glucose, and 50 mg / mL kanamycin was added. The culture was incubated at 30°C and 180 rpm for approximately 22 hours. Cells were then collected by centrifugation at 4,200 rpm for 10 minutes and inoculated into a new 250 mL Erlenmeyer flask containing 50 mL of M9 medium and 20 g / L glucose, and 50 mg / mL kanamycin was added. The medium was also supplemented with 5 mM ferulic acid and 5 mM p-coumaric acid. The initial inoculum concentration was OD0.05. 600 =1.0.

[0086] Experimental results: 0.54 mM catechins were obtained after fermentation with ferulic acid for 72 h; 4.2 mM catechins were obtained after fermentation with p-coumaric acid for 72 h; and 3.3 mM catechins were obtained using both ferulic acid and p-coumaric acid as substrates.

[0087] Example 3: Overexpression of VanAB from *Pseudomonas putida*

[0088] In the biotransformation pathway of ferulic acid in *Pseudomonas putida* KT2440, the vanAB gene encodes vanillic acid O-demethylase oxygenase, which catalyzes the conversion of vanillic acid to protocatechuic acid. The endogenous vanAB gene was integrated into plasmid pCA02 and then transformed into *P. putida* KTCA01 to obtain strain KTCA05.

[0089] Experimental Procedure: The vanAB gene fragment was obtained from the genome using primers vanAB-BM-F and vanAB-BM-R. Plasmid pCA02 was digested with Spe I enzyme, and the vanAB fragment was ligated to the linearized plasmid using Gibson assembly. After heat shock transformation, the plasmid was cultured overnight. The transformants were initially validated using primers yz-pBBR1-for and yz-cx-R. The correctly validated plasmid was extracted and sequenced, and named pCA05. pCA05 was electroporated into *P. putida* KTCA01, resulting in the correctly named *P. putida* KTCA05 strain.

[0090] Experimental results: 4.1 mM catechins were obtained after fermentation of ferulic acid for 72 h.

[0091] Example 4: Overexpression of PobA from *Pseudomonas putida*

[0092] The pobA gene encodes 4-hydroxybenzoic acid 3-monooxygenase, which plays a key role in the conversion of p-hydroxybenzoic acid to protocatechuic acid. The endogenous pobA gene was integrated into plasmid pCA05 and then transformed into P. putida KTCA01 to obtain strain KTCA07.

[0093] Experimental Procedure: Following the method described in Example 2, the pobA gene fragment was obtained from the genome using primers pobA-BM-F and pobA-BM-R, and then Gibson transformed into the linearized plasmid pCA05 digested with Spe I. After heat shock transformation, the transformants were preliminarily verified using primers cx-PobA-F and yz-cx-R. The correctly verified plasmid was extracted and sequenced, and named pCA07. pCA07 was electroporated into P. putida KTCA01, and the resulting strain was named P. putidaKTCA07.

[0094] Experimental results: Using ferulic acid and p-coumaric acid as substrates, 8.8 mM catechins were obtained after fermentation for 72 h.

[0095] Example 5: Addition of the isopentenyltransferase kpdB gene from Burkholderia pneumoniae

[0096] The reactivity of protocatechuic acid decarboxylase is dependent on isopentenylriboflavin. Therefore, protocatechuic acid decarboxylase activity can be regulated by expressing flavin isopentenyltransferase.

[0097] Experimental Procedure: Following the method described in Example 2, the gene kpdB (synthesized by Qingke) was amplified using primers KpdB-T7-F and KpdB-T7-R, and then Gibson transformed into the linearized plasmid pCA07 digested with Sac I. After heat shock transformation, the transformants were preliminarily verified using primers cx-pBBR1-for and yz-KpdB-R. The correctly verified plasmid was extracted and sequenced, and the correctly sequenced plasmid was named pCA09. pCA09 was electroporated into P. putida KTCA01, and the resulting strain was named P. putidaKTCA09.

[0098] Experimental results: Using ferulic acid and p-coumaric acid as substrates, 14.1 mM catechins were obtained after fermentation for 72 h, with a conversion rate of 98.5%.

[0099] Conversion effect

[0100] The metabolic pathway for the synthesis of catechols from ferulic acid and p-coumaric acid is as follows: Figure 1 Using ferulic acid and / or coumaric acid as substrates, the yield and conversion rates of the strains involved in Example 1 and Comparative Examples 1-3 were statistically analyzed. Figure 2 ).

[0101] Table 1: Catechol yield and conversion rate of the strain under different substrate conditions

[0102]

[0103] Note: FA, ferulic acid; p-CA, p-coumaric acid.

[0104] The results showed that the strategy of cofactor regulation and key enzyme overexpression enabled lignin-derived monomers to be efficiently converted into catechols with a conversion rate of 98.5% and a maximum yield of 14.1 mM. Under the same substrate concentration, strains KTCA07 and KTCA09 had higher yields, and the yields of these strains were significantly different from those of other strains (p < 0.01).

[0105] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A catechol-producing strain, which is a *Pseudomonas putida* containing the following four nucleic acids (I) to (IV). Pseudomonas putida ); I) Nucleic acid encoding protocatechuic acid decarboxylase; II) Nucleic acid encoding vanillic acid O-demethylase oxygenase; III) Nucleic acid encoding 4-hydroxybenzoic acid 3-monooxygenase; IV) Nucleic acids encoding isopentenyltransferase; The protocatechuic acid decarboxylase is derived from Enterobacter cloacae (… Enterobacter cloacae The protocatechuic acid decarboxylase; The vanillic acid O-demethylase oxygenase is vanillic acid O-demethylase oxygenase from *Pseudomonas putida*. The 4-hydroxybenzoic acid 3-monooxygenase is derived from *Pseudomonas putida*. The isopentenyltransferase is derived from Burkholderia pneumoniae (… Klebsiella pneumoniae Isopentenyltransferase.

2. The strain according to claim 1, characterized in that, The nucleic acid encoding protocatechuic acid decarboxylase is shown in SEQ ID NO:1; The nucleic acid encoding vanillic acid O-demethylase oxygenase is shown in SEQ ID NO:2; The nucleic acid encoding 4-hydroxybenzoic acid 3-monooxygenase is shown in SEQ ID NO:3; The nucleic acid encoding the isopentenyltransferase is shown in SEQ ID NO:

4.

3. The strain according to claim 1 or 2, characterized in that, Among them, the pcaHG gene, catA gene, and catA2 gene were knocked out.

4. A method for constructing the strain according to any one of claims 1 to 3, comprising: Construct a plasmid vector containing nucleic acids encoding protocatechuic acid decarboxylase, vanillic acid O-demethylase oxygenase, 4-hydroxybenzoic acid 3-monooxygenase, and isopentenyltransferase; transfect or transform the plasmid vector into *Pseudomonas putida*.

5. The construction method according to claim 4, characterized in that, It also includes steps to knock out the pcaHG gene, catA gene, and catA2 gene.

6. A method for preparing catechins, comprising: Using ferulic acid and / or p-coumaric acid as substrates, fermentation is carried out with the strain described in any one of claims 1 to 3 to obtain a product containing catechols.

7. The preparation method according to claim 6, characterized in that, The fermentation medium was M9 medium containing 20 g / L glucose, 5 mM ferulic acid and 5 mM p-coumaric acid.

8. The preparation method according to claim 6 or 7, characterized in that, The initial inoculation concentration of the strain was OD 600 =1.0, and the fermentation conditions are 180 rpm, 30℃, and fermentation for 72 hours.

Images