Strong-pathogenicity novel duck reovirus as well as preparation and application of egg yolk antibody of strong-pathogenicity novel duck reovirus

Abstract

The invention discloses a novel duck reovirus RD240407A with strong pathogenicity as well as preparation and application of an egg yolk antibody of the novel duck reovirus RD240407A. Specifically, the preservation number of the novel duck reovirus RD240407A is CGMCC (China General Microbiological Culture Collection Center) No. 46196. The invention also provides an inactivated vaccine and an egg yolk antibody prepared from the strain. The egg yolk antibody prepared from the novel duck reovirus RD240407A has a good immune effect on disease treatment and prevention before disease of ducklings and goslings. Compared with a serum antibody in the prior art, the preparation method of the egg yolk antibody is simple, blood sampling is not needed, and the egg yolk antibody can be obtained by only collecting and purifying immune hyperimmune egg yolk; the preparation method is simple and convenient, and is suitable for large-scale production, popularization and application.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a novel strain of highly pathogenic duck reovirus and the preparation and application of its egg yolk antibody. Background Art

[0002] The new duck reovirus disease is an infectious disease that has been prevalent in my country in recent years and has seriously endangered the duck and goose industries. The disease can be transmitted both vertically and horizontally. After infection, it causes a decrease in the body's immunity and is prone to cause mixed infections and secondary infections. The younger the age of the ducklings and goslings, the higher the incidence rate. It is currently widely prevalent in many regions of my country.

[0003] Currently, there are no ideal commercial drugs on the market to prevent and control the disease. There are few reports on yolk antibodies for emergency prevention and early infection treatment of new duck reovirus from geese and ducks. At the same time, the method of extracting yolk antibodies is still one of the factors restricting the mass production of IgY, and the market demand for yolk antibodies is huge.

[0004] Since the toxicity of the virus directly affects the antibody situation, it is necessary to screen out new duck reoviruses with strong pathogenicity and high immunogenicity, and the prepared egg yolk antibodies have the advantages of high purity, high titer, and good treatment and prevention effects. Therefore, the existing technology needs to be further improved. Summary of the invention

[0005] The present invention aims to solve the above problems and provides a novel strain of highly pathogenic duck reovirus RD240407A and the preparation and application of its egg yolk antibody.

[0006] Specifically, the technical solution provided by this application is as follows:

[0007] In a first aspect, the present application provides a novel duck reovirus RD240407A, and the deposit number of the novel duck reovirus RD240407A is CGMCC No.46196.

[0008] In a second aspect, the present invention provides a use of a novel duck reovirus RD240407A as described in the first aspect in preparing an inactivated vaccine.

[0009] In a third aspect, the present invention provides an inactivated vaccine, wherein the antigen in the inactivated vaccine comprises the inactivated novel duck reovirus RD240407A described in the first aspect.

[0010] Furthermore, the preparation method of the inactivated vaccine is as follows:

[0011] S1: The novel duck reovirus RD240407A strain of claim 1 is inoculated into 8-day-old SPF chicken embryos and 9-day-old susceptible duck embryos through the yolk cavity at a dose of 0.2 ml / piece, and dead embryos within 24 hours are discarded. The allantoic fluids of chicken embryos and duck embryos that died within 36 to 120 hours and have typical lesions are collected, and the collected allantoic fluids of chicken embryos and duck embryos are mixed at a ratio of 1:2 (v / v), and then centrifuged at 6000 rpm for 15 minutes, and the supernatant tested for sterility is quantitatively packaged and frozen for storage;

[0012] S2: Mix the chicken embryo virus liquid and duck embryo virus liquid obtained in S1, add 10% formaldehyde solution, shake while adding, mix them thoroughly, the final concentration of the formaldehyde solution is 0.1%, then pour the virus liquid steadily into another sterile stainless steel barrel, stir and inactivate at 37°C for 24 hours, take samples for inactivation test after inactivation, and store the inactivated virus liquid at 2-8°C for standby use;

[0013] S3: Prepare the immunogen in a ratio of 3:1 (V / V) between oil phase and water phase. Take 3 portions of oil phase and put them into a high-speed shear instrument. While stirring at 15,000 r / min, slowly add 1 portion of water phase and stir for 6 minutes to fully emulsify the mixture. After emulsification, aseptically divide the mixture into 250 ml sterile bottles, write the name, preparation time, filling amount, etc. on the outer wall of the bottle, and store it at 2-8°C.

[0014] In a fourth aspect, the present invention provides use of a novel duck reovirus RD240407A as described in the first aspect in preparing egg yolk antibodies.

[0015] In a fifth aspect, the present invention provides an egg yolk antibody, wherein the egg yolk antibody is prepared using the novel duck reovirus RD240407A described in the first aspect as an antigen.

[0016] Furthermore, the preparation method of the yolk antibody is as follows:

[0017] S1: Prepare vaccine to immunize laying hens and collect highly immune eggs;

[0018] S2: eggshell disinfection and egg yolk pretreatment;

[0019] The eggshell disinfection is as follows: soaking the eggs in 0.1% 42°C Chlorhexidine solution for 15 minutes, taking them out and draining the water, washing them with running water to remove surface dirt, spraying and fumigating the eggs with 0.1% Weikang (glutaraldehyde) for 30 minutes, and then breaking the eggs after drying them;

[0020] The egg yolk pretreatment comprises: separating the egg white and the egg yolk by an egg beater; mixing and stirring evenly in a ratio of 1:1 (v / v, egg yolk: 0.02 mol / L disodium hydrogen phosphate solution); filtering with a 60-mesh steel wire sieve to remove impurities in the egg yolk liquid; transferring the egg yolk liquid to a sedimentation tank, and adding the remaining 2 times volume of disodium hydrogen phosphate solution; stirring at 1000 rpm for 60 min;

[0021] S3: Acidification extraction; according to 1:1 (v / v, egg yolk: sedimentation agent), slowly add 1 times sedimentation liquid into the sedimentation tank. At this time, the solution is milky yellow, uniform and turbid; use 30% citric acid solution to adjust the pH value of the sedimentation liquid to 6.0, and sediment at 4°C for 12h. After the sedimentation is completed and the titer of the supernatant is not less than 1:16, take the supernatant;

[0022] S4: Caprylic acid degreasing: Add caprylic acid to the extracted supernatant at a final concentration of 0.1% to degreasing, mix thoroughly and place at room temperature for 2 to 6 hours, remove impurities through filter cloth, and the antibody stock solution is obtained;

[0023] S5: Sterile filtration: Sterilize with a 0.22um microporous filter;

[0024] S6: Ultrafiltration to remove viruses: Use an ultrafiltration membrane with a molecular weight cutoff of 1000 kDa to remove viruses;

[0025] S7: Ultrafiltration concentration: Use an ultrafiltration membrane with a molecular weight cutoff of 100 kDa to concentrate the egg yolk antibody twice;

[0026] S8: Antibody titer determination: The titer of reosome antibody agar expansion should not be less than 1:16;

[0027] S9: Packaging: Pack in quantitative quantities, seal with a lid, and store at 2-8℃.

[0028] Based on the above technical solution, the method of S1: preparing immune laying hens and collecting highly immune eggs is as follows:

[0029] For the first immunization, the prepared immunogen was injected intramuscularly into commercial laying hens around 140 days old, 0.5 ml per chicken;

[0030] Second vaccination: 15 days after the first vaccination, intramuscular injection of the prepared immunogen, 1.0 ml / mouse;

[0031] The third immunization was intramuscular injection of the prepared immunogen 15 days after the second immunization, 1.5 ml / mouse;

[0032] Fourth vaccination: 30 days after the third vaccination, intramuscular injection of the prepared immunogen, 2 ml / animal;

[0033] Eggs were collected for testing starting 14 days after the fourth vaccination. When the titer of the egg agar diffusion test was no less than 1:64, the high-immunity eggs were collected and stored at 4°C for later use.

[0034] Based on the above technical solution, the yolk antibody is used for prevention before infection and / or treatment after infection.

[0035] Based on the above technical solution, the injection amount of the yolk antibody is 1 mL / each

[0036] The present invention has the following advantages / benefits:

[0037] 1. The present invention isolates a highly pathogenic new duck reovirus RD240407A from goose sources, with a deposit number of CGMCC No.46196. The egg yolk antibody prepared using the strain has a good immune effect. Experimental data show that the egg yolk antibody prepared using the new duck reovirus RD240407A has a good immune effect in both the treatment and pre-onset prevention of ducklings and goslings; it can reach 95%-99.5%.

[0038] 2. Compared with the serum antibodies in the prior art, the egg yolk antibodies of the present invention are simple to prepare and do not require blood collection. The egg yolk antibodies can be purified by collecting the yolk of immune high-immunity chicken eggs. The egg yolk antibodies have good stability, significant therapeutic effects, and a simple production method suitable for large-scale production and promotion and application. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the prior art descriptions are briefly introduced below. Obviously, the drawings described below are only one embodiment of the present invention, and for ordinary technicians in this field, other implementation drawings can be derived from the provided drawings without creative work.

[0040] Figure 1 : Electrophoresis diagram of the detection of the novel duck reovirus RD240407A strain of the present invention, wherein lane 1: marker; lane 2: RD240407A; lane 3: NDRV negative control.

[0041] Figure 2 : Liver lesion diagram of dead duck embryo of the present invention.

[0042] Figure 3 :Electron microscopic image of the novel duck reovirus RD240407A strain of the present invention DETAILED DESCRIPTION

[0043] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. The following embodiments are only for illustrating the present invention, and are not intended to limit the scope of the present invention in any way. Based on the embodiments in the present invention, all other embodiments obtained by those skilled in the art without making creative work are within the scope of protection of the present invention. The experimental methods used in the present invention are conventional methods unless otherwise specified. The materials, reagents, etc. used in the present invention, unless otherwise specified, can be obtained from commercial channels. In addition, other terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art.

[0044] Example 1: Isolation and identification of a novel duck reovirus strain RD240407A

[0045] Among the following raw materials, sterile PBS solution was purchased from Wuhan Boster Bioengineering Co., Ltd.; 2×TapPCRStarMix was purchased from Beijing Kangrun Chengye Biotechnology Co., Ltd.; Tween 80 and Span 80 were purchased from Sinopharm Chemical Reagent Co., Ltd.; other raw materials were commercially available.

[0046] 1.1 Virus collection and isolation

[0047] The liver and spleen tissues of diseased geese suspected of being infected with the new duck reovirus were collected aseptically. Sterile PBS was added to the diseased tissues at a ratio of 1:2 (W / V), then ground and homogenized. After repeated freezing and thawing for 3 times, centrifuged at 6000rpm for 15min, the supernatant was taken for strain separation and purification, filtered with a sterile filter, and stored at -20℃ for later use. After blind transmission in the yolk cavity of SPF chicken embryos for 3 generations and blind transmission in ordinary duck embryos for 2 generations, the new duck reovirus RD240407A strain was isolated and purified.

[0048] 1.2 Virus identification

[0049] (1) Viral DNA extraction

[0050] The specific operation process was carried out according to the instructions of the StarSceipt III One-Step RT-RCR Kit (Dye), and the sample addition volume was 300 μL.

[0051] (2) Identification primer: NDRV-F: ACTCGTGGCGTCTTATATC

[0052] NDRV-R:TGGCGGAATAGTGAATACAT

[0053] The fragment length of this identification primer is 997 bp.

[0054] (3) PCR amplification system: A 20 μL amplification system was used for amplification. The specific reagents are shown in Table 1:

[0055] Table 1: PCR amplification system (20 μL)

[0056]

[0057] (4) Amplification procedure: 94°C pre-denaturation for 3 min, 94°C denaturation for 30 s, 55°C annealing for 40 s, 72°C extension for 40 s, 30 cycles; 72°C extension for 10 min after the cycle, and storage at 4°C. The PCR products after the reaction were subjected to 1% agarose gel electrophoresis.

[0058] PCR detection electrophoresis diagram Figure 1 The specific sequence is shown in SEQ ID NO: 1:

[0059]

[0060] 1.3 Toxicity test on SPF chicken embryos and ordinary duck embryos

[0061] The strain RD240407A was diluted 1:100 with PBS (0.01mol / L, pH=7.2), and then inoculated into 10 8-day-old SPF chicken embryos and 10 9-day-old susceptible duck embryos through the yolk cavity, 0.2ml per embryo, and continued to incubate at 37°C. At least 8 SPF chicken embryos and susceptible duck embryos should die 24-168h after inoculation. Dead embryos should have symptoms such as skin full of hemorrhage and irregular gray-white necrotic spots on the liver ( Figure 2 ).

[0062] The experimental results are shown in Table 2:

[0063] Table 2: Death status of SPF chicken embryos and susceptible duck embryos

[0064]

[0065] 1.4 Electron microscopy observation

[0066] Electron microscopy images Figure 3 As shown, under the electron microscope, it was observed that the virus particles were spherical, with a double-layer capsid and no capsule, and the diameter was between 60 and 80 nm, mostly around 75 nm.

[0067] 1.5 Virus strain preservation

[0068] The strain RD240407A was deposited in the China General Microbiological Culture Collection Center (CGMCC) on September 23, 2024. The deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 46196.

[0069] Example 2: Antigen preparation

[0070] 2.1 Virus proliferation procedure

[0071] The novel duck reovirus RD240407A strain isolated in Example 1 was inoculated into 8-day-old SPF chicken embryos and 9-day-old susceptible duck embryos through the yolk cavity at a dose of 0.2 ml / piece, and dead embryos within 24 hours were discarded. The allantoic fluids of chicken embryos and duck embryos that died within 36 to 120 hours and had typical lesions were collected. The collected chicken embryos and duck embryos were mixed at a ratio of 1:2 (v / v) and centrifuged at 6000 rpm for 15 minutes. The supernatant tested for sterility was quantitatively packaged and frozen for storage.

[0072] 2.2 Virus liquid inactivation

[0073] Mix the antigens that have passed the test (SPF chicken embryos and 9-day-old susceptible duck embryos should have at least 8 dead eggs 24-168 hours after inoculation and the PCR electrophoresis bands should be correct and clear), add 10% formaldehyde solution, shake as you add, mix thoroughly, the final concentration of formaldehyde solution is 0.1%, then pour the virus liquid steadily into another sterile stainless steel barrel, stir and inactivate it at 37°C for 24 hours (start timing when the antigen temperature rises to 37°C, stir 3-4 times during the period). After the inactivation is completed, take samples separately for inactivation test, and store the inactivated virus liquid at 2-8°C for later use.

[0074] 2.2.1 Sterility test: Take the inactivated virus solution and test it according to the appendix of the current Chinese Pharmacopoeia of Veterinary Medicine.

[0075] 2.2.2 Inactivation test: Inoculate the inactivated virus liquid into 8-day-old SPF chicken embryos and 9-day-old susceptible duck embryos through the yolk cavity, 0.2 ml per embryo, and observe for 168 hours. All SPF chicken embryos and susceptible duck embryos should be alive. Blindly propagate for one generation using this method, and all SPF chicken embryos and susceptible duck embryos should still be alive.

[0076] 2.2.3 Experimental results: The antigen is sterile after inactivation.

[0077] The antigen was completely inactivated and 10 8-day-old SPF chicken embryos and 9-day-old susceptible duck embryos were inoculated and blindly transmitted for one generation. All the 8-day-old SPF chicken embryos and 9-day-old susceptible duck embryos survived.

[0078] 2.3 Preparation of immunogen

[0079] 2.3.1 Oil phase preparation

[0080] Take 94 parts of white oil for injection and 6 parts of Span 80, mix them and heat to 90°C while stirring. Sterilize them under high pressure at 121°C for 30 min and set aside. This is the oil phase.

[0081] 2.3.2 Preparation of aqueous phase

[0082] Take 96 parts of antigen and 4 parts of sterilized Tween 80, mix and shake thoroughly to dissolve the Tween 80 completely, which is the water phase.

[0083] 2.3.3 Emulsification

[0084] Prepare the immunogen at a ratio of 3:1 (V / V) between the oil phase and the water phase. Take 3 portions of the oil phase and place them in a high-speed shearing instrument. While stirring at 15,000 r / min, slowly add 1 portion of the water phase and stir for 6 minutes to fully emulsify the mixture. After emulsification, dispense the mixture into 250 ml sterile bottles aseptically, write the name, preparation time, and amount on the outer wall of the bottle, and store at 2-8°C.

[0085] 2.4 Immunogen testing

[0086] 2.4.1 Properties

[0087] Appearance: Milky uniform emulsion

[0088] Dosage form: Oil-in-water type. Take a clean pipette and draw a small amount of immunogen and drop it into cold water. Except for the first drop, it will not spread.

[0089] Stability: Pipette 10 ml of immunogen into a centrifuge tube and centrifuge at 3000 r / min for 15 min. The water phase precipitated at the bottom of the tube should be 0.1 ml and should not exceed 0.5 ml.

[0090] Viscosity: Tested in accordance with the current Appendix of the Chinese Pharmacopoeia of Veterinary Medicine, it is 100cP and does not exceed 200cP.

[0091] 2.4.2 Sterility test: Test in accordance with the appendix of the current Chinese Pharmacopoeia of Veterinary Medicine, and the product must be sterile after the test.

[0092] 2.4.3 Safety test: 10 14-day-old SPF chickens were injected with 2.0 ml of the immunogen into the leg muscle and observed for 14 days. No local or systemic adverse reactions caused by the injection of the immunogen were found.

[0093] 2.4.4 Effectiveness test:

[0094] Twenty 60-day-old SPF chickens were used, 15 of which were injected with 1 ml of immunogen into the muscle legs, and the other 5 were used as controls. Blood was collected 21 days after immunization, and the serum was separated. The serum agar titer was measured after inactivation at 56°C for 30 minutes. The agar titer of the immunized group antibody was 1:64, and the agar titer of the control group antibody was negative.

[0095] Example 3: Preparation of Reovirus Yolk Antibodies

[0096] 3.1 Immunization Procedure

[0097] For the first vaccination, the prepared immunogen was injected intramuscularly into commercial laying hens around 140 days old, 0.5 ml / hen; for the second vaccination, the prepared immunogen was injected intramuscularly 15 days after the first vaccination, 1.0 ml / hen; for the third vaccination, the prepared immunogen was injected intramuscularly 15 days after the second vaccination, 1.5 ml / hen; for the fourth vaccination, the prepared immunogen was injected intramuscularly 30 days after the third vaccination, 2 ml / hen. Eggs were collected for testing 14 days after the fourth vaccination. When the titer of the egg agar diffusion test was not less than 1:64, the high-immunity eggs were collected and stored at 4°C for later use.

[0098] 3.2 Preparation of yolk antibody

[0099] Cleaning and disinfection: Soak the eggs in 0.1% 42℃ Chlorhexidine solution for 15 minutes, remove them from the water, rinse them with running water to remove surface dirt, spray fumigate the eggs with 0.1% Weikon (glutaraldehyde) for 30 minutes, blow dry the eggs and then crack them.

[0100] Yolk pretreatment: Use an egg beater to separate the egg white and yolk; mix and stir evenly according to 1:1 (v / v, egg yolk: 0.02mol / L disodium hydrogen phosphate solution); filter with a 60-mesh wire sieve to remove impurities in the egg yolk liquid; transfer the above egg yolk liquid to a sedimentation tank, and add the remaining 2 times volume of disodium hydrogen phosphate solution (0.02mol / L); stir at 1000rpm for 60min. At this time, the pH value of the mixed solution is about 7.2, the color is milky yellow, turbid and uniform. Note: At this time, it must be slow and uniform, and the time must be sufficient to prevent the egg yolk from denaturing.

[0101] Acid extraction: Slowly add 1 times sedimentation liquid (PVP and trehalose are 6.66g / L and 4.16g / L respectively, fully dissolved in purified water of equal mass to egg yolk) into the sedimentation tank at a ratio of 1:1 (v / V, egg yolk: sedimentation agent). At this time, the solution is milky yellow, uniform and turbid; carefully adjust the pH value of the sedimentation liquid to 6.0 with 30% citric acid solution, and sediment at 4°C for 12h. After the sedimentation is completed and the titer of the supernatant is not less than 1:16, all the supernatant can be transferred out to the next step.

[0102] Caprylic acid degreasing: Add caprylic acid to the extracted supernatant at a final concentration of 0.1% to remove fat, mix thoroughly and place at room temperature for 2 to 6 hours, remove impurities through filter cloth, and the antibody stock solution is obtained.

[0103] Sterile filtration: Sterilize by filtering with a 0.22um microporous filter.

[0104] Ultrafiltration virus removal: Use an ultrafiltration membrane with a molecular weight cutoff of 1000kDa to remove viruses.

[0105] Ultrafiltration concentration: Use an ultrafiltration membrane with a molecular weight cutoff of 100 kDa to concentrate the egg yolk antibody twice.

[0106] Antibody titer determination: The agar titer of the novel duck reovirus antibody should not be less than 1:16.

[0107] Packaging: Pack in quantitative quantity, seal with lid, and store at 2-8℃.

[0108] Example 4: RD240407A strain half infectious dose (EID 50 )

[0109] The isolated virus stock solution was diluted 10 times with PBS (0.01mol / L, pH=7.2), with a total of 8 dilutions. For each dilution, 10 9-day-old susceptible duck embryos (200μL / embryo) were inoculated through the yolk cavity, and a blank control group was set up and incubated at 37°C. Observe every day after infection, discard the duck embryos that died within 24 hours, and observe every 24 hours thereafter for 168 hours. The cumulative number of dead and alive duck embryos at each dilution was counted, and the experimental data are shown in Table 3. The EID of the virus in each 0.2mL suspension was calculated according to the Reed-Muench method. 50 .

[0110] Table 3: Mortality of inoculated duck embryos and ELD of RD240407A strain 50

[0111]

[0112] Example 5: RD240407A strain challenge and protection test

[0113] 5.1Duckling challenge and protection test of RD240407A strain

[0114] A total of 950 7-day-old specific pathogen-free ducks were randomly divided into 4 groups and weighed. The specific challenge and protection experimental schemes are shown in Table 4.

[0115] Group 1, 50 mice, was the negative control group;

[0116] The second group of 300 ducklings was the non-treatment control group. The 7-day-old ducklings were inoculated with RD240407A virus intramuscularly, with 0.5 mL (containing 200 ELD 50 );

[0117] The third group of 300 ducklings was the challenge and treatment group. The 7-day-old ducklings were inoculated with RD240407A strain virus intramuscularly, with 0.5 mL (containing 200 ELD 50 ), inject 1ml of egg yolk antibody 24 hours;

[0118] The fourth group of 300 ducklings was the challenge and prevention group. The ducklings at 7 days old were injected intramuscularly with 1 ml of egg yolk antibody and intramuscularly inoculated with RD240407A strain virus 24 hours later. Each duckling had 0.5 ml (containing 200 ELD 50 ).

[0119] They were isolated and raised separately, and the specific operation is shown in Table 1. Clinical observation was carried out every day after the challenge, and the incidence and mortality were counted. On the 7th day after the challenge, all ducklings were euthanized and autopsied (the method for judging the lesions: the autopsy showed liver bleeding and spleen bleeding).

[0120] Table 4: Duckling RD240407A strain challenge and protection test plan

[0121]

[0122] The experimental data of ducklings are shown in Table 5:

[0123] Table 5: Results of challenge and protection test of ducklings with strain RD240407A

[0124]

[0125] From the experimental data in Table 5, it can be obtained that the test scheme for the infection and protection of ducklings with the RD240407A strain is as follows: in Group 1, the number of ducklings that developed the disease 7 days after infection was 0%; in Group 2, the number of ducklings that developed the disease 7 days after infection in the non-treatment group was 292 / 300, with an incidence rate of 97.3%; in Group 3, the number of ducklings that developed the disease 7 days after infection in the treatment group was 9 / 300, with a protection rate of 97.0%; in Group 4, the number of ducklings that developed the disease 7 days after infection in the prevention group was 5 / 300, with a protection rate of 98.3%.

[0126] 5.2D240407A strain gosling challenge and protection experiment

[0127] A total of 650 7-day-old specific pathogen-free geese were randomly divided into 4 groups and weighed. The specific challenge and protection experimental schemes are shown in Table 5.

[0128] Group 1, 50 mice, was the negative control group;

[0129] The second group of 200 goslings was the non-treatment control group. The 7-day-old goslings were intramuscularly inoculated with RD240407A virus, with 0.5 mL (containing 200 ELD 50 );

[0130] The third group of 200 goslings was the challenge and treatment group. The 7-day-old goslings were intramuscularly inoculated with RD240407A virus, with 0.5 mL (containing 200 ELD 50 ), inject 1ml of egg yolk antibody 24 hours;

[0131] The fourth group of 200 goslings was the virus prevention group. The 7-day-old goslings were injected intramuscularly with 1 ml of egg yolk antibody, and 24 hours later, the RD240407A virus was inoculated intramuscularly, with 0.5 ml (containing 200 ELD 50 ).

[0132] They were isolated and raised separately, and the specific operation is shown in Table 6. Clinical observation was carried out every day after the challenge, and the incidence and mortality were counted. On the 7th day after the challenge, all goslings were euthanized and autopsied (the method for judging the lesions: the autopsy showed hemorrhage in the liver, sclerosis of the spleen and irregular necrotic spots).

[0133] Table 6: Gosling RD240407A strain challenge and protection test plan

[0134]

[0135] The experimental data of goslings are shown in Table 7:

[0136] Table 7: Goslings RD240407A strain challenge and protection test results

[0137]

[0138] From the experimental data in Table 7, it can be seen that the test scheme of RD240407A strain infection and protection in goslings is as follows: Group 1, the incidence of goslings 7 days after infection is 0%; Group 2, the incidence of goslings in the infection non-treatment group 7 days after infection is 197 / 200, and the incidence rate is 98.5%; Group 3, the incidence of goslings in the infection treatment group 7 days after infection is 4 / 200, and the protection rate is 98.0%; Group 4, the incidence of goslings in the infection prevention group 7 days after infection is 1 / 200, and the protection rate is 99.5%;

[0139] Based on the experimental data of this embodiment, it can be concluded that the protection rate of ducklings against the reovirus strain is 97.0%-98.3%, and the protection rate of goslings is 98.0%-99.5%. The yolk antibody can effectively prevent and treat the onset of reovirus in ducklings and goslings.

[0140] Example 6: Large-group test of RD240407A strain

[0141] 6.1 Large-group experiment with duckling strain RD240407A

[0142] A large-scale duck experimental area was selected in Shandong Province, and two diseased duck houses were selected as experimental subjects, each of which housed 5,000 one-week-old ducks.

[0143] The diseased ducks in the two duck houses were treated separately. Ducks in duck house 1 were injected with 1 mL of reoconstriction yolk antibody purchased from the market. Ducks in duck house 2 were injected with 1 mL of RD240407A virus yolk antibody. The ducks were observed for 7 consecutive days and the disease status of the ducklings was recorded (the method for judging the disease of new duck reoconstriction: depression, loss of appetite, reduced water intake. Typical symptoms include general fatigue, weak feet, difficulty walking and even inability to stand. Some sick ducks also have respiratory damage such as difficulty breathing and mouth breathing)

[0144] The experimental results are as follows: After 7 days of treatment with reovirus yolk antibody, the protection rate of ducks in area 1 was 82.5%, and the protection rate of ducks in area 2 was 93.9%. Facing the attack of reovirus, the yolk antibody prepared in this experiment has a better protective effect than the commercially available yolk antibody, and has a better prevention and control effect.

[0145] 6.2 Large-group test of RD240407A strain in goslings

[0146] A large goose test area in Shandong Province was selected, and one of the diseased goose houses was selected as the test object. The goose house was divided into two isolation areas, 1 and 2, each of which raised 2,000 geese aged 2 weeks. The diseased geese in areas 1 and 2 were treated separately. Geese in area 1 were injected with 1.5 mL / goose of reoconstriction yolk antibody purchased from the market; goose houses in area 2 were injected with 1.5 mL / goose of RD240407A strain virus yolk antibody. They were observed for 7 consecutive days and the disease status of the goslings was recorded (the method for judging the disease of reoconstriction: depression, loss of appetite, and reduced water intake. Typical symptoms include general fatigue, soft feet, difficulty walking, and even inability to stand. Some sick geese also have respiratory damage such as difficulty breathing and mouth breathing.)

[0147] Results: After 7 days of treatment with reovirus yolk antibody, the protection rate of geese in area 1 was 85.2%, and that in area 2 was 94.1%. Facing the attack of the new duck reovirus, the yolk antibody prepared in this experiment had a better protective effect than the commercially available yolk antibody, and had a better prevention and control effect.

[0148] It is understandable that those skilled in the art can make equivalent substitutions or changes based on the technical solution and concept of the present invention, and all these changes or substitutions should fall within the protection scope of the claims attached to the present invention.

Claims

1. A novel duck reovirus RD240407A, characterized in that: The deposit number of the novel duck reovirus RD240407A is CGMCC No.46196.

2. Use of a novel duck reovirus RD240407A as claimed in claim 1 in preparing an inactivated vaccine.

3. An inactivated vaccine, characterized in that: The antigen in the inactivated vaccine comprises the inactivated novel duck reovirus RD240407A described in claim 1.

4. An inactivated vaccine according to claim 3, characterized in that: The preparation method of the inactivated vaccine is as follows: S1: The novel duck reovirus RD240407A strain of claim 1 is inoculated into 8-day-old SPF chicken embryos and 9-day-old susceptible duck embryos through the yolk cavity at a dose of 0.2 ml / piece, and dead embryos within 24 hours are discarded. The allantoic fluids of chicken embryos and duck embryos that died within 36 to 120 hours and have typical lesions are collected, and the collected allantoic fluids of chicken embryos and duck embryos are mixed at a ratio of 1:2 (v / v), and then centrifuged at 6000 rpm for 15 minutes, and the supernatant tested for sterility is quantitatively packaged and frozen for storage; S2: Mix the chicken embryo virus liquid and duck embryo virus liquid obtained in S1, add 10% formaldehyde solution, shake while adding, mix them thoroughly, the final concentration of the formaldehyde solution is 0.1%, then pour the virus liquid steadily into another sterile stainless steel barrel, stir and inactivate at 37°C for 24 hours, take samples for inactivation test after inactivation, and store the inactivated virus liquid at 2-8°C for standby use; S3: Prepare the immunogen in a ratio of 3:1 (V / V) between oil phase and water phase. Take 3 portions of oil phase and put them into a high-speed shear instrument. While stirring at 15,000 r / min, slowly add 1 portion of water phase and stir for 6 minutes to fully emulsify the mixture. After emulsification, aseptically divide the mixture into 250 ml sterile bottles, write the name, preparation time, filling amount, etc. on the outer wall of the bottle, and store it at 2-8°C.

5. Use of the novel duck reovirus RD240407A as claimed in claim 1 in preparing egg yolk antibodies.

6. An egg yolk antibody, characterized in that: The egg yolk antibody is prepared by using the novel duck reovirus RD240407A described in claim 1 as an antigen.

7. The egg yolk antibody according to claim 6, characterized in that: The preparation method of the yolk antibody is as follows: S1: Prepare vaccine to immunize laying hens and collect highly immune eggs; S2: eggshell disinfection and egg yolk pretreatment; The eggshell disinfection is as follows: soaking the eggs in 0.1% 42°C Chlorhexidine solution for 15 minutes, taking them out and draining the water, washing them with running water to remove surface dirt, spraying and fumigating the eggs with 0.1% Weikang (glutaraldehyde) for 30 minutes, and then breaking the eggs after drying them; The egg yolk pretreatment comprises: separating the egg white and the egg yolk by an egg beater; mixing and stirring evenly in a ratio of 1:1 (v / v, egg yolk: 0.02 mol / L disodium hydrogen phosphate solution); filtering with a 60-mesh steel wire sieve to remove impurities in the egg yolk liquid; transferring the egg yolk liquid to a sedimentation tank, and adding the remaining 2 times volume of disodium hydrogen phosphate solution; stirring at 1000 rpm for 60 min; S3: Acidification extraction; according to 1:1 (v / v, egg yolk: sedimentation agent), slowly add 1 times sedimentation liquid into the sedimentation tank. At this time, the solution is milky yellow, uniform and turbid; use 30% citric acid solution to adjust the pH value of the sedimentation liquid to 6.0, and sediment at 4°C for 12h. After the sedimentation is completed and the titer of the supernatant is not less than 1:16, take the supernatant; S4: Caprylic acid degreasing: Add caprylic acid to the extracted supernatant at a final concentration of 0.1% to degreasing, mix thoroughly and place at room temperature for 2 to 6 hours, remove impurities through filter cloth, and the antibody stock solution is obtained; S5: Sterile filtration: Sterilize with a 0.22um microporous filter; S6: Ultrafiltration to remove viruses: Use an ultrafiltration membrane with a molecular weight cutoff of 1000 kDa to remove viruses; S7: Ultrafiltration concentration: Use an ultrafiltration membrane with a molecular weight cutoff of 100 kDa to concentrate the egg yolk antibody twice; S8: Antibody titer determination: The titer of the new duck reosome antibody agar expansion should not be less than 1:16; S9: Packaging: Pack in quantitative quantities, seal with a lid, and store at 2-8℃.

8. The egg yolk antibody according to claim 7, characterized in that: S1: Preparation of immune laying hens and collection of highly immune eggs are as follows: For the first immunization, the prepared immunogen was injected intramuscularly into commercial laying hens around 140 days old, 0.5 ml per chicken; Second vaccination: 15 days after the first vaccination, intramuscular injection of the prepared immunogen, 1.0 ml / mouse; The third immunization was intramuscular injection of the prepared immunogen 15 days after the second immunization, 1.5 ml / mouse; Fourth vaccination: 30 days after the third vaccination, intramuscular injection of the prepared immunogen, 2 ml / animal; Eggs were collected for testing starting 14 days after the fourth vaccination. When the titer of the egg agar diffusion test was no less than 1:64, the high-immunity eggs were collected and stored at 4°C for later use.

9. The egg yolk antibody according to claim 6, characterized in that: The yolk antibody is used for prevention before infection and / or treatment after infection.

10. The egg yolk antibody according to claim 1, characterized in that: The injection amount of the egg yolk antibody is 1 mL / mouse.

Images