4-propyl guaiacol oxidase mutant as well as preparation method and application thereof

Abstract

The invention discloses a 4-propyl guaiacol oxidase mutant as well as a preparation method and application thereof, wild type 4-propyl guaiacol oxidase comes from Penicillium simplicissimum, an active center of the wild type 4-propyl guaiacol oxidase is modified by using a directed evolution means, and the mutant is obtained by modifying the active center of the wild type 4-propyl guaiacol oxidase. 4-propyl guaiacol oxidase mutants D170E, S426T, S50Q / D170E, D170E / L411V and D170E / L411V / S106C with relatively high activity, cis-trans selectivity and trans-isoeugenol yield are obtained, efficient synthesis from cheap 4-propyl guaiacol to high-value trans-isoeugenol is realized, and industrial synthesis and application of the trans-isoeugenol are facilitated.

Description

Technical Field

[0001] The invention relates to an oxidase, in particular to a 4-propylguaiacol oxidase, and belongs to the technical fields of enzyme engineering and genetic engineering. Background Art

[0002] Trans-isoeugenol (E-isoeugenol) is a natural phenolic compound with significant antioxidant, antibacterial, antifungal and anti-inflammatory biological activities, and is widely used in food, medicine, agriculture and other fields. For example, trans-isoeugenol can be used as a natural antioxidant and preservative; its unique aroma also makes it useful in spices, flavors or condiments; trans-isoeugenol is also a synthetic raw material for a variety of compounds, and has the potential to be used in agriculture as an environmentally friendly pesticide ingredient. Due to its low toxicity and natural properties, trans-isoeugenol has become a popular research object for green alternatives, and has broad application prospects in the future.

[0003] The production methods of trans-isoeugenol mainly include natural extraction, biotransformation and chemical synthesis. Natural extraction is usually obtained from essential oils of plants such as cloves and cinnamon, but the extraction efficiency is low; biotransformation converts precursor substances (such as eugenol) into isoeugenol through microbial or enzyme catalysis, which has high selectivity and environmental friendliness; chemical synthesis often converts eugenol or other related precursors into trans-isoeugenol under specific conditions through isomerization or specific catalytic reactions, but chemical synthesis requires precious metal catalysis, and the cis-trans selectivity of the product is poor. Therefore, the biotransformation method is a more economical and controllable means for large-scale production of trans-isoeugenol. In the biotransformation method, 4-propylguaiacol oxidase (also known as vanillyl alcohol oxidase) from Penicillium simplicissimum can use 4-propylguaiacol as a substrate to catalyze the oxidation reaction to produce trans-isoeugenol. However, natural 4-propylguaiacol oxidase has low activity, low cis-trans selectivity, and low yield of trans-isoeugenol, which cannot meet the needs of industrial applications. Summary of the invention

[0004] Purpose of the invention: The purpose of the present invention is to provide a 4-propylguaiacol oxidase mutant with high activity, high cis-trans selectivity and high production of trans-isoeugenol, and to provide a preparation method of the enzyme mutant, related nucleotide sequences, recombinant vectors, and recombinant cells.

[0005] Technical solution: The 4-propylguaiacol oxidase mutant of the present invention is obtained by amino acid mutation of the sequence shown in SEQ ID NO.1, and the mutation is D170E, S426T, S50Q / D170E, D170E / L411V or D170E / L411V / S106C.

[0006] The amino acid sequences of the 4-propylguaiacol oxidase mutants D170E, S426T, S50Q / D170E, D170E / L411V, and D170E / L411V / S106C are SEQ ID NOs. 2 to 6, respectively.

[0007] The present invention uses 4-propylguaiacol oxidase (PDB: 2VAO) of Penicillium simplicissimum as the original enzyme (wild type), the amino acid sequence of which is SEQ ID NO. 1, and the gene sequence encoding the enzyme is SEQ ID NO. 7. The present invention utilizes the sequence and structural information of the publicly reported 4-propylguaiacol oxidase, performs non-redundant retrieval in databases such as PDB, and screens out potential enzyme genes based on the principles of protein structure similarity, conservative site analysis, and host source diversity, and obtains a pure original enzyme through functional expression in an Escherichia coli expression system and subsequent purification. Finally, 4-propylguaiacol oxidase VAO was selected as the original enzyme. The present invention used semi-rational design to carry out directed transformation of the original enzyme, mutated the amino acids in its active site, and finally screened out 4-propylguaiacol oxidase mutants D170E, S426T, S50Q / D170E, D170E / L411V and D170E / L411V / S106C with high activity, cis-trans selectivity and trans-isoeugenol yield.

[0008] The present invention uses the standard single-letter code for amino acids and the standard substitution notation, for example: D170E means that the aspartic acid (D) at the 170th position of the N-terminus is mutated to glutamic acid (E); S50Q / D170E means that the serine (S) at the 50th position of the N-terminus is mutated to glutamine (Q), and the aspartic acid (D) at the 170th position of the N-terminus is mutated to glutamic acid (E).

[0009] The present invention also provides a nucleotide sequence encoding the 4-propylguaiacol oxidase mutant. The nucleotide sequence can be obtained by base mutation of the sequence shown in SEQ ID NO.7, such as SEQ ID NO.8-12.

[0010] The present invention also provides a recombinant vector comprising the nucleotide sequence, including a cloning vector or an expression vector, which may be a plasmid or a virus, and can maintain replication ability in a host cell, and amplify or express the nucleotide sequence.

[0011] The present invention also provides a recombinant cell, comprising the recombinant vector.

[0012] The present invention also provides a method for preparing the 4-propylguaiacol oxidase mutant, comprising the following steps:

[0013] (1) Designing point mutation primers, using a plasmid carrying a wild-type 4-propylguaiacol oxidase gene as a template, and using the point mutation primers to perform PCR reactions, respectively, and obtaining mutant gene fragments and linearized plasmids after purification;

[0014] (2) The mutant gene fragment is connected to the linearized plasmid to construct an expression vector, and the expression vector is transferred into the host bacteria to induce the expression of the 4-propylguaiacol oxidase mutant.

[0015] Preferably, in step (1), the point mutation primer is:

[0016]

[0017]

[0018] Preferably, in step (1), the PCR reaction system is:

[0019] Composition volume 10×BufferforKOD-Plus- 2.5μL 2mM dNTP 2.5μL <![CDATA[25mMMgSO4]]> 1.5μL DMSO 1μL 10pmol / μLForwardPrimer 0.75μL 10pmol / μLReversePrimer 0.75μL DNA template <100ng KOD-Plus- 1μL <![CDATA[ddH2O]]> up to 25 μL .

[0020] Preferably, in step (1), the PCR reaction conditions are:

[0021]

[0022] Preferably, in step (2), after expression is completed, the cells are collected; or the cells are disrupted and the crude enzyme solution is collected; or the cells are disrupted and the separated and purified 4-propylguaiacol oxidase mutant is collected.

[0023] The present invention also provides a product, which comprises the 4-propylguaiacol oxidase mutant, or the nucleotide sequence, or the recombinant vector, or the recombinant cell.

[0024] The invention also provides application of the product in biocatalytic synthesis of trans-isoeugenol.

[0025] Preferably, the biocatalysis uses 4-propylguaiacol as a substrate, pH 6-9, and temperature 20-45°C.

[0026] The process of 4-propylguaiacol oxidase catalyzing the oxidation reaction to generate trans-isoeugenol is as follows:

[0027]

[0028] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: The present invention provides 4-propylguaiacol oxidase mutants D170E, S426T, S50Q / D170E, D170E / L411V and D170E / L411V / S106C with high activity, cis-trans selectivity and trans-isoeugenol yield, realizes the efficient synthesis of high-value trans-isoeugenol from cheap 4-propylguaiacol, is beneficial to the industrial synthesis and application of trans-isoeugenol, and has good application prospects in medical fields such as drug synthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of the yield and cis-trans selectivity of the synthesis of trans-isoeugenol catalyzed by the original enzyme WT and the mutant;

[0030] Figure 2 Schematic diagram of the yield and cis-trans selectivity of the original enzyme WT catalyzing the synthesis of trans-isoeugenol at different temperatures;

[0031] Figure 3 Schematic diagram of the yield and cis-trans selectivity of the synthesis of trans-isoeugenol catalyzed by mutant D170E / L411V / S106C at different temperatures;

[0032] Figure 4 Schematic diagram of the yield and cis-trans selectivity of the original enzyme WT in synthesizing trans-isoeugenol at different pH;

[0033] Figure 5 Schematic diagram of the yield and cis-trans selectivity of the synthesis of trans-isoeugenol catalyzed by mutant D170E / L411V / S106C at different pH;

[0034] Figure 6 is the enzymatic reaction kinetic curve of the original enzyme WT;

[0035] Figure 7 is the enzymatic reaction kinetic curve of mutant D170E / L411V / S106C;

[0036] Figure 8 is a gas chromatogram of 4-propylguaiacol, cis-isoeugenol and trans-isoeugenol;

[0037] Fig. 9 This is the H NMR spectrum of trans-isoeugenol. DETAILED DESCRIPTION

[0038] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0039] Example 1: A 4-propylguaiacol oxidase mutant D170E

[0040] In this example, 4-propylguaiacol oxidase (PBD:2VAO) of Penicillium simplicissimum was used as the original enzyme, and the aspartic acid at position 170 of the N-terminus of its amino acid sequence was mutated to glutamic acid.

[0041] The preparation method is as follows: (1) designing point mutation primers, performing PCR reaction, and obtaining mutant gene fragments; (2) constructing expression vectors and transferring them into host bacteria for inducing expression. The details are as follows:

[0042] (1) Design point mutation primers and perform PCR reaction to obtain mutant gene fragments

[0043] The wild-type 4-propylguaiacol oxidase VAO gene sequence was designed and synthesized, and an expression vector was constructed. Suzhou Jinweizhi Biotechnology Co., Ltd. was commissioned to synthesize the VAO gene fragment and construct it on the pET22b vector, named pET22b-VAO gene (as shown in SEQ ID NO.7), and its corresponding amino acid sequence is shown in SEQ ID NO.1.

[0044] The vector was transformed into E.coli Top10 strain and screened with ampicillin-resistant LB plates to obtain clones. One clone was selected and inoculated into a 20 mL ampicillin-resistant LB medium test tube and cultured at 37°C and 220 rpm for 12 hours. After the culture, the bacteria were centrifuged at 12,000 rpm for 1 minute and the cells were collected. The plasmid was extracted from E.coli Top10 / pET22b-VAO using a high-purity plasmid mini-extraction kit as a template for iterative mutation to construct a plasmid pET22b-VAO mutant. The plasmid was sequenced by Suzhou Jinweizhi Biotechnology Co., Ltd., and clones with correct insertion of the vector and no mutation were selected to obtain the 4-propylguaiacol oxidase gene expression vector pET22b-VAO.

[0045] Expression and preparation of wild-type 4-propylguaiacol oxidase. The expression vector is transformed into Escherichia coli BL21 (DE3) to obtain Escherichia coli genetic engineering bacteria pET22b-VAO / BL21 (DE3) capable of expressing 4-propylguaiacol oxidase. The engineering bacteria are then inoculated into a culture medium at an inoculum of 0.1%, and the volume of the shake flask is 100mL / 250ml (containing 100mg / L of ampicillin). When the OD600 of the bacterial solution reaches 0.6-0.8, isopropylthiogalactoside (IPTG) with a final concentration of 1mM is added for induction, the temperature is lowered to 18°C ​​and the culture is continued for about 20h, centrifuged at 4000rpm for 10min, the bacterial cells are collected, and resuspended with 100mM Tris-HCl buffer at pH9 to obtain bacterial cells containing 4-propylguaiacol oxidase for subsequent catalytic research and enzyme activity determination.

[0046] Recombinant E. coli BL21 (DE3) / pET22b-VAO mutant D170E was constructed. The gene mutation was carried out by whole plasmid PCR to obtain the target mutant gene. The primers for D170E are shown in Table 1, and single-point iterative mutation was performed. The amino acid sequence of D170E is shown in SEQ ID NO.2, and the nucleotide sequence is shown in SEQ ID NO.8.

[0047] Table 1 Primer sequences of mutant D170E

[0048] Mutation primer name Sequence (5'-3') D170E_F CGATAAACTGTGGCTGGATGTGCCGGAACTGGGCGGTGG D170E_R CATTACCCAGAACACTACCACCGCCCAGTTCCGGCAC

[0049] The PCR reaction system is shown in Table 2:

[0050] Table 2 PCR reaction system

[0051]

[0052]

[0053] The PCR reaction conditions are shown in Table 3.

[0054] Table 3 PCR reaction conditions

[0055]

[0056] After the PCR amplification was completed, the amplified product was detected by 0.9% agarose gel electrophoresis, and the result showed that the amplified product was a single band with a size of about 7000 bp. The amplified product was purified and recovered using a DNA recovery and purification kit.

[0057] The purified gene fragment was digested with DpnI to remove the template and then recombined with recombinase. The recombinant product was transformed into E.coliDH5α competent cells, spread on the surface of LB solid culture medium containing 100μg / mL ampicillin, cultured at 37℃ for 12h, picked a single colony to LB liquid culture, identified the successfully constructed positive transformant by PCR, and verified the correctness of the mutation site by sequencing. After verification, a part of it was added with sterile glycerol at a final concentration of 25%, numbered, and stored at -80℃ for use, and a part of the bacteria was extracted with a plasmid extraction kit, and the recombinant plasmid was stored in a -20℃ refrigerator.

[0058] (2) Constructing the expression vector and transferring it into the host bacteria for inducing expression

[0059] The recombinant expression plasmid pET22b that was successfully sequenced was transferred into E. coli BL21 (DE3) as the expression host to construct the recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-VAO.

[0060] The successfully constructed recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-VAO was spread on a plate containing ampicillin at a final concentration of 100 μg / mL. A single colony was picked and inoculated into 20 mL of LB medium containing resistance and cultured at 37 ° C at 200 rpm / min overnight. 1% of the inoculum was transferred to 500 mL of LB medium containing resistance. At OD 600 When the concentration reaches about 0.6, add IPTG with a final concentration of 0.5 mM and induce at 18°C ​​for about 14 hours.

[0061] After obtaining the bacteria by centrifugation, resuspend them with buffer, break the cells by ultrasonication in an ice bath (working for 3s, interval for 6s, working time for 15min), and centrifuge at 12,000rpm / min for 20min at 4°C. After collecting the supernatant, filter it out through a 0.22μm water filter head as a sample, and then purify it through a nickel column enzyme to obtain a pure enzyme solution. According to the amino acid sequence of VAO, the molar absorption coefficient ε of the protein is calculated, and the absorbance of the purified protein is measured by the A280 method to calculate the concentration of the protein.

[0062] Example 2: A 4-propylguaiacol oxidase mutant S426T

[0063] This example uses the same original enzyme as in Example 1, and mutates the serine at position 426 of the N-terminal amino acid sequence to threonine. The amino acid sequence of the mutant is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.9. The preparation method is basically the same as in Example 1, except for the mutation primers, as shown in Table 4:

[0064] Table 4 Primer sequences of mutant S426T

[0065] Mutation primer name Sequence (5'-3') S426T_F GGCGCACATCTGTTCTTTACTCCGATTGCCAAAG S426T_R CTTCACCGCTAACTTTGGCAATCGGAGTAAAGAACAG

[0066] Example 3: A 4-propylguaiacol oxidase mutant S50Q / D170E

[0067] This example uses the same original enzyme as in Example 1, and mutates the serine at position 50 of the N-terminal amino acid sequence to glutamine, and the aspartic acid at position 170 to glutamic acid. The amino acid sequence of the mutant is shown in SEQ ID NO.4, and the nucleotide sequence is shown in SEQ ID NO.10. The preparation method is basically the same as in Example 1, except for the mutation primers, as shown in Table 5:

[0068] Table 5 Primer sequences of mutant S50Q / D170E

[0069] Mutation primer name Sequence (5'-3') S50Q_F GCAAAGATCAGATTGTGGATGGCCAATATATGAAAACC S50Q_R CATGGGTATGGGTCGGTTTCATATATTGGCCATCCAC D170E_F CGATAAACTGTGGCTGGATGTGCCGGAACTGGGCGGTGG D170E_R CATTACCCAGAACACTACCACCGCCCAGTTCCGGCAC

[0070] Example 4: A 4-propylguaiacol oxidase mutant D170E / L411V

[0071] This example uses the same original enzyme as in Example 1, and mutates the aspartic acid at position 170 of the N-terminal amino acid sequence to glutamic acid, and the leucine at position 411 to valine. The amino acid sequence of the mutant is shown in SEQ ID NO.5, and the nucleotide sequence is shown in SEQ ID NO.11. The preparation method is basically the same as in Example 1, except for the mutation primers, as shown in Table 6:

[0072] Table 6 Primer sequences of mutant D170E / L411V

[0073] Mutation primer name Sequence (5'-3') D170E_F CGATAAACTGTGGCTGGATGTGCCGGAACTGGGCGGTGG D170E_R CATTACCCAGAACACTACCACCGCCCAGTTCCGGCAC L411V_F TCCGACCTATGATGAAGTGAAATGGATTGATTGGCTGCC L411V_R CGGCAGCCAATCAATCCATTTCACTTCATCATAG

[0074] Example 5: A 4-propylguaiacol oxidase mutant D170E / L411V / S106C

[0075] This example uses the same original enzyme as in Example 1, and mutates the aspartic acid at position 170 of the N-terminal amino acid sequence to glutamic acid, the leucine at position 411 to valine, and the serine at position 106 to cysteine. The amino acid sequence of the mutant is shown in SEQ ID NO.6, and the nucleotide sequence is shown in SEQ ID NO.12. The preparation method is basically the same as in Example 1, except for the mutation primers, as shown in Table 7:

[0076] Table 7 Primer sequences of mutant D170E / L411V / S106C

[0077] Mutation primer name Sequence (5'-3') D170E_F CGATAAACTGTGGCTGGATGTGCCGGAACTGGGCGGTGG D170E_R CATTACCCAGAACACTACCACCGCCCAGTTCCGGCAC S106C_F GGCGCACATCTGTTCTTTACTCCGATTGCCAAAG S106C_R CTTCACCGCTAACTTTGGCAATCGGAGTAAAGAACAG L411V_F TCCGACCTATGATGAAGTGAAATGGATTGATTGGCTGCC L411V_R CGGCAGCCAATCAATCCATTTCACTTCATCATAG

[0078] Performance Testing

[0079] 1. Yield and cis-trans selectivity of the synthesis of trans-isoeugenol catalyzed by 4-propylguaiacol oxidase and its mutants The whole cells of the wild-type enzyme and mutant obtained in Examples 1 to 5 were used as catalysts.

[0080] The reaction system was: whole cell bacterial solution with OD = 20, 50mM 4-propylguaiacol, and reaction buffer was 100mM Tris-HCl with pH = 8.5. The reaction temperature was controlled at 30°C by water bath, magnetic stirring was applied, and the reaction was continued for 20h. The concentration of the product trans-isoeugenol was detected by gas chromatography. The results are shown in Figure 1 .

[0081] The gas chromatograms of 4-propylguaiacol, cis-isoeugenol and trans-isoeugenol are shown in Figure 8 The H NMR spectrum of trans-isoeugenol is shown in Fig. 9 .Depend on Figure 1(The bar graph is the yield, and the line graph is the selectivity) It can be seen that among WT, mutants D170E, S426T, S50Q / D170E, L411V / D170E, and L411V / D170E / S106C, the mutants have improved yield and cis-trans selectivity compared with WT, among which L411V / D170E / S106C has the most significant improvement compared with WT, with a yield increase of about 40% and a cis-trans selectivity increase of 65%.

[0082] Optimal temperature for the synthesis of trans-isoeugenol catalyzed by 2-propylguaiacol oxidase and its mutants

[0083] Whole cells of wild type and mutant D170E / L411V / S106C were used as catalysts.

[0084] The reaction system is: whole cell bacterial solution with OD=40, 100mM 4-propylguaiacol, 10% DMSO, and the reaction buffer is 100mM Tris-HCl with pH=8.5. The reaction temperature is controlled at 20℃, 25℃, 30℃, 37℃, and 45℃ by water bath, with magnetic stirring, and the reaction is carried out for 16h. The concentration and cis-trans selectivity of the product trans-isoeugenol are detected by gas chromatography. The results are shown in Figure 2 and Figure 3 .

[0085] Depend on Figure 2 and Figure 3 (The bar graph is the yield, and the line graph is the selectivity) It can be obtained that after the 4-propylguaiacol oxidase and the mutant D170E / L411V / S106C were reacted at different temperatures, the highest enzyme activity measured was 100% relative enzyme activity. The experiment proved that the wild-type 4-propylguaiacol oxidase and its mutants had the highest yield at 25°C and the highest cis-trans selectivity at 20°C. For the wild-type 4-propylguaiacol oxidase, when the temperature was higher than 25°C, the enzyme activity began to decrease, and the cis-trans selectivity decreased; at 45°C, it still had 75% activity. For the mutant D170E / L411V / S106C, when the temperature was higher than 25°C, the enzyme activity began to decrease, and the cis-trans selectivity remained almost unchanged; at 45°C, it still had 75% activity, but the cis-trans selectivity decreased.

[0086] Optimal pH for the synthesis of trans-isoeugenol catalyzed by 3-4-propylguaiacol oxidase and its mutants

[0087] Whole cells of wild type and mutant D170E / L411V / S106C were used as catalysts.

[0088] The reaction system is: whole cell bacterial liquid with OD=40, 100mM 4-propylguaiacol, and 10% DMSO. The reaction buffers are buffers with different pH values, namely: 50mM disodium hydrogen phosphate-citric acid buffer with pH=6, 50mM sodium phosphate buffer with pH=7, 50mM dipotassium hydrogen phosphate-potassium hydrogen phosphate buffer with pH=8, 100mM Tris-HCl buffer with pH=8.5, 100mM Tris-HCl buffer with pH=9, and 50mM boric acid buffer with pH=10. The reaction temperature is controlled at 30°C in a water bath, with magnetic stirring, and the reaction is carried out for 16 hours. The concentration and cis-trans selectivity of the product trans-isoeugenol are detected by gas chromatography. The results are shown in Figure 4 and Figure 5 .

[0089] Depend on Figure 4 and Figure 5 (The bar graph is the yield, and the line graph is the selectivity) It can be obtained that after the 4-propylguaiacol oxidase and the mutant D170E / L411V / S106C were reacted at different pH, the highest enzyme activity measured was 100% relative enzyme activity. The experiment proved that under acidic and neutral conditions, the cleavage activity of VAO was relatively limited, but as the pH increased to 8.5, the activity reached the maximum value. The wild-type 4-propylguaiacol oxidase and the mutant both had the highest yield at pH = 8.5, and the cis-trans selectivity did not change much with pH. The enzyme activity of the two enzymes was almost completely lost at pH = 10, and the enzyme activity of the mutant between pH = 7 and 8.5 was more stable than that of the wild type.

[0090] 4. Effects of different substrate and enzyme concentrations on the synthesis of trans-isoeugenol catalyzed by 4-propylguaiacol oxidase and its mutants

[0091] Whole cells of wild type and mutant D170E / L411V / S106C were used as catalysts.

[0092] The reaction system was: whole cell bacterial solution with OD=10, 20, 40, 80, 10mM, 20mM, 50mM 4-propylguaiacol, 10% DMSO, and the reaction buffer was 100mM Tris-HCl with pH=8.5. The reaction temperature was controlled at 30°C by water bath, magnetic stirring was performed, the reaction was performed for 16h, and the concentration and cis-trans selectivity of the product trans-isoeugenol were detected by gas chromatography. The results are shown in Table 8.

[0093] As shown in Table 8, with the increase of bacterial concentration, the yield of trans-isoeugenol gradually increased, and the yield of the mutant was always higher than that of the wild type. The cis-trans selectivity increased slightly with the increase of bacterial concentration, but the change was not significant. The optimal reaction conditions were OD = 40 and substrate concentration 10 mM.

[0094] Table 8 Effect of substrate concentration and enzyme concentration on enzyme catalysis

[0095]

[0096]

[0097] 5. Kinetic parameters of 4-propylguaiacol oxidase and its mutants

[0098] Using 4-propylguaiacol as substrate, the initial velocities of the enzymatic reactions of wild-type 4-propylguaiacol oxidase and mutant D170E / L411V / S106C were measured at pH 8.5 and 30°C, and the kinetic parameters (K M , K CAT , K CAT / K M ). The results are shown in Figure 6 and Figure 7 The kinetic parameters of wild-type VAO for 4-propylguaiacol were K M 1.37mM, K CAT 17.88min -1 , K CAT / K M =13.05; the kinetic parameters of mutant D170E / L411V / S106C for 4-propylguaiacol are K M 1.15mM, K CAT 4.50min -1 , K CAT / K M =3.91.

[0099] The analysis results show that when 4-propylguaiacol is used as substrate, the K M It is 0.8 times that of the wild type, indicating that the mutant has a better affinity with the substrate. CAT The K CAT The value is 0.3 times that of the wild type, K CAT The decrease in indicates that the mutant converts fewer substrate molecules per unit time, which may be because the mutation at the relevant site affects the binding of the enzyme to the substrate.

Claims

1. A 4-propylguaiacol oxidase mutant, characterized in that: The sequence shown in SEQ ID NO.1 is obtained by amino acid mutation, wherein the mutation is S426T, D170E, S50Q / D170E, D170E / L411V or D170E / L411V / S106C.

2. A nucleotide sequence, characterized in that Encoding the 4-propylguaiacol oxidase mutant according to claim 1.

3. A recombinant vector, characterized in that: Comprising the nucleotide sequence of claim 2.

4. A recombinant cell, characterized in that Comprising the recombinant vector according to claim 3.

5. A method for preparing the 4-propylguaiacol oxidase mutant according to claim 1, characterized in that: The steps include: (1) Designing point mutation primers, using the plasmid carrying the wild-type 4-propylguaiacol oxidase gene as a template, and using the point mutation primers to perform PCR reactions respectively, and obtaining the mutant gene fragment and linearized plasmid after purification; (2) The mutant gene fragment is connected to the linearized plasmid to construct an expression vector, which is then transferred into the host bacteria to induce the expression of the 4-propylguaiacol oxidase mutant.

6. The preparation method according to claim 5, characterized in that: In step (1), the point mutation primer is: 。 7. The preparation method according to claim 5, characterized in that: In step (1), the PCR reaction system is: 。 8. A product, characterized in that The product comprises the 4-propylguaiacol oxidase mutant according to claim 1, or the nucleotide sequence according to claim 2, or the recombinant vector according to claim 3, or the recombinant cell according to claim 4.

9. Use of the product according to claim 8 in biocatalytic synthesis of trans-isoeugenol.

10. The use according to claim 9, wherein the biocatalysis uses 4-propylguaiacol as a substrate, the pH is 6-9, and the temperature is 20-45°C.

Images