Vanilloid alcohol oxidase mutants, methods of making and using the same
By performing directed evolutionary modification on vanillyl oxidase and mutating its amino acid sites, a highly active and highly cis-trans selective vanillyl oxidase mutant was prepared, solving the problems of low catalytic activity and poor selectivity in the existing technology. This enabled the efficient synthesis of cis-isoeugenol and has good prospects for drug synthesis applications.
Patent Information
- Application Number
- CN202411935983.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-26
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2044-12-26
AI Technical Summary
Existing vanillyl alcohol oxidase has low catalytic activity and poor cis-trans selectivity, and cannot produce high levels of cis-isoeugenol.
By performing directed evolutionary modification on vanillyl oxidase of Penicillium simplicissimum, mutating its amino acid sites to S106L, L316F, or I468L, a vanillyl oxidase mutant with high activity and high cis-trans selectivity was prepared and purified using an Escherichia coli expression system.
The efficient synthesis of cis-isoeugenol from inexpensive 4-propylguaiacol has been achieved, improving catalytic activity and cis-trans selectivity, making it suitable for pharmaceutical fields such as drug synthesis.
Smart Images

Figure CN119709671B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to an oxidase, in particular to a vanillyl alcohol oxidase, and belongs to the technical field of enzyme engineering and genetic engineering. BACKGROUND
[0002] Z-isoeugenol is widely used in food, tobacco, washing, cosmetics and drug perfuming, deodorizing of plastics, rubber and other industrial products, and is also an important pharmaceutical raw material and industrial additive. In China, it is mainly used for the preparation of edible essence, while in foreign countries, it is widely used in the production of 3,4,5-trimethoxybenzaldehyde (TMBA), an intermediate of medicine dopamine, methyldopa and sulfonamide drug synergist, as a plant growth promoter, bactericide, lubricating oil defoaming agent, conductive agent for printed circuit board production, etc.
[0003] Vanillyl alcohol oxidase belongs to flavin adenine dinucleotide-dependent oxidase, and is also called flavin oxidase. The enzyme can catalyze alkanes including aromatic compounds to generate olefin compounds. In the reaction of vanillyl alcohol oxidase catalyzing 4-propyl guaiacol, the propyl C-C bond in the substrate is oxidized to generate isoeugenol. Since the existing vanillyl alcohol oxidase has low catalytic activity and poor cis-trans selectivity, it cannot produce high yield of Z-isoeugenol. SUMMARY
[0004] The present application aims to provide a vanillyl alcohol oxidase mutant with high activity, high cis-trans selectivity and high yield of Z-isoeugenol, and to provide a preparation method of the enzyme mutant, related nucleotide sequence, recombinant vector and recombinant cell.
[0005] The vanillyl alcohol oxidase mutant of the present application is obtained by amino acid mutation of the sequence shown in SEQ ID NO. 1, and the mutation is at least one of S106L, L316F or I468L.
[0006] The vanillyl alcohol oxidase mutant is preferably S106L, S106L / L316F, S106L / L316F / I468L, and the amino acid sequences thereof are SEQ ID NO. 2-4, respectively.
[0007] The present application takes vanilla alcohol oxidase (PDB: 2VAO) of Penicillium simplicissimum as the original enzyme (wild type), the amino acid sequence of which is SEQ ID NO. 1, and the gene sequence encoding the enzyme is SEQ ID NO. 5. By using the sequence and structure information of the vanilla alcohol oxidase reported in the prior art, the potential enzyme genes are screened out by performing non-redundant search in the database such as PDB according to the principles of protein structure similarity, conserved site analysis and host source diversity, and then the original enzyme is obtained by functional expression in the E. coli expression system and subsequent purification. Finally, the vanilla alcohol oxidase VAO is selected as the original enzyme, which has wide substrate applicability and can catalyze a variety of aromatic alkane substrates to generate corresponding olefin compounds. The original enzyme is subjected to directed evolution modification by rational design, and the amino acids in the active site are mutated, and finally the vanilla alcohol oxidase mutant with high activity, cis-trans selectivity and cis-isoeugenol yield is screened out.
[0008] The present application uses the standard one-letter code of amino acids and the standard substitution notation, for example: S106L means that the serine (S) at the 106th position of the N-terminal is mutated to leucine (L); S106L / L316F means that the serine (S) at the 106th position of the N-terminal is mutated to leucine (L), and the leucine (L) at the 316th position of the N-terminal is mutated to phenylalanine (F).
[0009] The present application also provides a nucleotide sequence encoding the vanilla alcohol oxidase mutant. The nucleotide sequence can be obtained by base mutation from the sequence shown in SEQ ID NO. 5, such as SEQ ID NO. 6-8.
[0010] The present application also provides a recombinant vector comprising the nucleotide sequence. The recombinant vector includes a cloning vector or an expression vector, and can be a plasmid or a virus, and can maintain the ability to replicate, amplify or express the nucleotide sequence in a host cell. The recombinant vector is preferably a PET-based expression vector.
[0011] The present application also provides a recombinant cell comprising the recombinant vector. The recombinant cell is preferably E. coli.
[0012] The present application also provides a preparation method of the vanilla alcohol oxidase mutant, comprising the following steps:
[0013] (1) designing point mutation primers, using a plasmid with a wild type vanilla alcohol oxidase gene as a template, and performing PCR reaction with point mutation primers, and obtaining a mutant gene fragment and a linearized plasmid after purification;
[0014] (2) the mutant gene fragment is connected with a linearized plasmid to construct an expression vector, and the expression vector is transformed into a host cell to induce expression of the mutant vanillyl alcohol oxidase.
[0015] Preferably, in step (1), the point mutation primer is:
[0016] Mutant primer name Sequence (5'-3') S106L_F GGTCGTAATCTTGGCTATGGCGGTGCCGCACCGCG S106L_R CGCGGTGCGGCACCGCCATAGCCAAGATTACGACC L316F_F GGTCGTAATTGTGGCTATGGCGGTGCCGCACCGCG L316F_R CGCGGTGCGGCACCGCCATAGCCACAATTACGACC I468L_F GCAAAGATCAGATTGTGGATGGCCAATATATGAAACC I468L_R CATGGGTATGGGTCGGTTTCATATATTGGCCATCCAC .
[0017] Preferably, in step (1), the PCR reaction system is:
[0018]
[0019]
[0020] Preferably, in step (1), the PCR reaction conditions are:
[0021]
[0022] Preferably, in step (2), after expression is completed, the cells are collected; or the cells are broken and the crude enzyme solution is collected; or the cells are broken and the mutant vanillyl alcohol oxidase is separated and purified.
[0023] The application also provides a product comprising the mutant vanillyl alcohol oxidase, the nucleotide sequence, the recombinant vector, or the recombinant cell.
[0024] The application also provides use of the product in biological catalysis synthesis of cis-isoeugenol.
[0025] Preferably, the biological catalysis uses 4-propyl guaiacol as a substrate, and is performed at pH 6-9, a temperature of 20-45℃, and for 10-20 hours.
[0026] The process in which the vanillyl alcohol oxidase catalyzes oxidation reaction to generate cis-isoeugenol is as follows:
[0027]
[0028] Beneficial effects: Compared with the prior art, the application has the following remarkable advantages: the application provides a mutant vanillyl alcohol oxidase with high activity, cis-trans selectivity, and cis-isoeugenol yield, realizes efficient synthesis of cis-isoeugenol from cheap 4-propyl guaiacol, is conducive to industrialized synthesis and application of cis-isoeugenol, and has good application prospects in the medical field of drug synthesis and the like. BRIEF DESCRIPTION OF DRAWINGS
[0029] Figure 1 A schematic diagram of yields and cis-trans selectivity of original enzyme WT and mutant catalytic synthesis of cis-isoeugenol;
[0030] Figure 2 A schematic diagram of the yield and cis-trans selectivity of the original enzyme WT catalyzing the synthesis of cis-isoeugenol at different temperatures;
[0031] Figure 3 A schematic diagram of the yield and cis-trans selectivity of the mutant S106L / L316F / I468L catalyzing the synthesis of cis-isoeugenol at different temperatures;
[0032] Figure 4 A schematic diagram of the yield and cis-trans selectivity of the original enzyme WT catalyzing the synthesis of cis-isoeugenol at different pHs;
[0033] Figure 5 A schematic diagram of the yield and cis-trans selectivity of the mutant S106L / L316F / I468L catalyzing the synthesis of cis-isoeugenol at different pHs;
[0034] Figure 6 An enzymatic reaction kinetic curve of the original enzyme WT;
[0035] Figure 7 An enzymatic reaction kinetic curve of the mutant S106L / L316F / I468L;
[0036] Figure 8 A gas chromatogram of cis-isoeugenol and trans-isoeugenol;
[0037] Figure 9 A nuclear magnetic resonance hydrogen spectrum of cis-isoeugenol. DETAILED DESCRIPTION
[0038] The technical solutions of the present application will be further described below with reference to the accompanying drawings.
[0039] Example 1: A vanillyl alcohol oxidase mutant S106L
[0040] In this example, the vanillyl alcohol oxidase (PBD: 2VAO) of Penicillium simplicissimum is used as the original enzyme, and the serine at the N-terminal 106th position of the amino acid sequence is mutated to leucine.
[0041] The preparation method is as follows: (1) design a point mutation primer and perform PCR reaction to obtain a mutant gene fragment; (2) construct an expression vector and transfer it into a host strain for induction expression. The specific process is as follows:
[0042] (1) Design a point mutation primer and perform PCR reaction to obtain a mutant gene fragment
[0043] Construction of vanillyl alcohol oxidase mutant plasmid. The flavin oxidase VAO wild-type gene of Penicillium simplicissimum was synthesized by Genewiz (Suzhou) Co., Ltd. and constructed on the pET22b vector, and the vector was transformed into the E. coli DH5a strain. The recombinant bacteria E. coli DH5a / pET22b-VAO were inoculated in a 5 mL test tube containing culture medium and cultured at 37°C, 200 rpm for 10 h. After the culture was completed, the bacteria were collected by centrifugation at 12,000 rpm for 1 min, and the plasmid was extracted from the recombinant bacteria using a high-purity plasmid extraction kit as a template for iterative mutation to construct the plasmid pET22b-VAO mutant.
[0044] Expression and preparation of wild-type vanillyl alcohol oxidase. The expression vector was transformed into an expression strain to obtain a recombinant expression strain capable of expressing vanillyl alcohol oxidase. The successfully constructed recombinant expression strain E. coli BL21(DE3) / pET22b-VAO was inoculated on an LB plate containing ampicillin at a final concentration of 100 μg / mL, and a single colony was inoculated in 6 mL of LB medium containing resistance and cultured at 37°C, 200 rpm / min overnight. A 1% inoculum was transferred to 500 mL of LB medium containing resistance, and when the OD600 reached about 0.6, IPTG was added at a final concentration of 0.5 mM, and induction was performed at 18°C for about 14 h. The bacteria containing vanillyl alcohol oxidase were obtained and used for subsequent catalytic research and enzyme activity determination.
[0045] Construction of recombinant E. coli BL21(DE3) / pET22b-VAO mutant S106L. The target mutant gene was obtained by whole plasmid PCR. The S106L primer is shown in Table 1, and single-point iterative mutation was performed. The amino acid sequence of the mutant S106L is shown in SEQ ID NO. 2, and the nucleotide sequence is shown in SEQ ID NO. 6.
[0046] Table 1 Primer sequence of mutant S106L
[0047] Mutant primer name Sequence (5'-3') S106L_F GGTCGTAATCTTGGCTATGGCGGTGCCGCACCGCG S106L_R CGCGGTGCGGCACCGCCATAGCCAAGATTACGACC
[0048] The PCR reaction system is shown in Table 2.
[0049] Table 2 PCR reaction system
[0050] Components Volume 10 x Buffer for KOD-Plus- 2.5 μL 2 mM dNTP 2.5 μL 25 mM MgSO4 1.5 μL DMSO 1 μL 10 pmol / μL Forward Primer 0.75 μL 10 pmol / μL Reverse Primer 0.75 μL DNA template <100 ng KOD-Plus- 1 μL ddH2O upto 25 μL
[0051] The PCR reaction conditions are shown in Table 3.
[0052] Table 3 PCR reaction conditions
[0053]
[0054] After PCR amplification, the amplification product was detected by 0.9% agarose gel electrophoresis, and the results showed that the amplification product was a single band with a size of about 7000 bp. The amplification product was purified and recovered by a DNA recovery purification kit.
[0055] The purified gene fragment was digested with Dpn I to remove the template and then recombined with a recombinase. The recombinant product was transformed into E. coli DH5a competent cells, spread on the surface of LB solid medium containing 100 μg / mL ampicillin, incubated at 37°C for 14 h, and then a single colony was picked onto LB liquid medium. The positive transformants were identified by PCR and the correctness of the mutation site was verified by sequencing. After verification, a part was added with sterile glycerol at a final concentration of 25%, numbered, and stored in a -80°C refrigerator for future use. A part of the bacteria was used to extract plasmids with a plasmid extraction kit, and the recombinant plasmids were stored in a -20°C refrigerator.
[0056] (2) Construction of expression vector and induction of expression after transformation into host bacteria
[0057] The successfully sequenced recombinant expression plasmid pET22b was transformed into E. coli BL21(DE3) as an expression host to construct the recombinant mutant expression strain E. coli BL21(DE3) / pET22b-VAO.
[0058] The successfully constructed recombinant mutant expression strain E. coli BL21(DE3) / pET22b-VAO was spread on a plate containing ampicillin at a final concentration of 100 μg / mL, and a single colony was picked and inoculated in 6 mL of LB medium containing resistance at 37°C and 200 rpm / min for overnight culture. A 1% inoculum was transferred to 500 mL of LB medium containing resistance, and the culture was incubated at 37°C and 200 rpm / min until the OD 600 When the OD reached about 0.6, IPTG was added at a final concentration of 0.5 mM, and the culture was induced at 18°C for about 14 h.
[0059] After centrifugation to obtain the bacterial cells, resuspension with buffer, and ultrasonic disruption of the cells in an ice bath (3 s of work, 6 s of interval, and 30 min of work time), centrifugation at 12,000 rpm / min for 20 min at 4°C. The supernatant was collected, filtered through a 0.22 μm water filter, and used as a sample for further nickel column enzyme purification. According to the amino acid sequence of VAO, the molar absorption coefficient ε of the protein was calculated. The absorbance of the purified protein was measured by A280 method, and the concentration of the protein was calculated.
[0060] Example 2: A vanillyl alcohol oxidase mutant S106L / L316F
[0061] The original enzyme used in Example 1 was mutated to have serine at the N-terminal 106th amino acid replaced by leucine and leucine at the 316th amino acid replaced by phenylalanine. The amino acid sequence of the mutant is shown in SEQ ID NO. 3 and the nucleotide sequence is shown in SEQ ID NO. 7. The preparation method is basically the same as that of Example 1, except for the mutation primer, which is shown in Table 4:
[0062] Table 4 Primer sequence for mutant S106L / L316F
[0063] Mutant primer name Sequence (5'-3') S106L_F GGTCGTAATCTTGGCTATGGCGGTGCCGCACCGCG S106L_R CGCGGTGCGGCACCGCCATAGCCAAGATTACGACC L316F_F GGTCGTAATTGTGGCTATGGCGGTGCCGCACCGCG L316F_R CGCGGTGCGGCACCGCCATAGCCACAATTACGACC
[0064] Example 3: A mutant S106L / L316F / I468L of vanillyl alcohol oxidase
[0065] The original enzyme used in Example 1 was mutated to have serine at the N-terminal 106th amino acid replaced by leucine and leucine at the 316th amino acid replaced by phenylalanine, and isoleucine at the 468th amino acid replaced by leucine. The amino acid sequence of the mutant is shown in SEQ ID NO. 4 and the nucleotide sequence is shown in SEQ ID NO. 8. The preparation method is basically the same as that of Example 1, except for the mutation primer, which is shown in Table 5:
[0066] Table 5 Primer sequence for mutant S106L / L316F / I468L
[0067]
[0068]
[0069] Performance test
[0070] 1. Yield and cis / trans selectivity of vanillyl alcohol oxidase and its mutants in catalyzing the synthesis of cis-isoeugenol
[0071] The whole cell bacteria solution of the wild-type enzyme and the mutants obtained in Examples 1-3 were used as catalysts.
[0072] The reaction system was: whole cell bacteria solution with OD = 20, 50 mM 4-propylguaiacol, and reaction buffer was 100 mM Tris-HCl with pH = 8.5. The reaction temperature was controlled at 30°C by water bath, and the reaction was stirred by magnetic stirring. The product trans-isoeugenol concentration was detected by gas chromatograph after 20 h of reaction.
[0073] The gas chromatograms of cis-isoeugenol and trans-isoeugenol are shown in Figure 8 The nuclear magnetic resonance hydrogen spectrum of cis-isoeugenol is shown in Figure 9 Figure 1 (Bar chart for yield, line chart for selectivity) It can be seen that, in wild-type enzyme and mutants, the mutants have higher yield and cis-trans selectivity than WT, and S106L / L316F / I468L has the most significant improvement compared with WT.
[0074] 2. Optimum temperature of vanillyl alcohol oxidase and its mutants for synthesizing cis-isoeugenol
[0075] Whole-cell bacteria solution of wild-type and mutant S106L / L316F / I468L were used as catalysts.
[0076] The reaction system was: whole-cell bacteria solution with OD = 40, 100 mM 4-propylguaiacol, 10% DMSO, and the reaction buffer was 100 mM Tris-HCl with pH 8.5. The reaction temperature was controlled at 20°C, 25°C, 30°C, 37°C, and 45°C by water bath, and the reaction was stirred by magnetic force for 16 h. The concentration of product cis-isoeugenol and cis-trans selectivity were detected by gas chromatography. The results are shown in Figure 2 and Figure 3 .
[0077] From Figure 2 and Figure 3 (Bar chart for yield, line chart for selectivity) It can be seen that, in wild-type enzyme and mutants, the mutants have higher yield and cis-trans selectivity than WT, and S106L / L316F / I468L has the most significant improvement compared with WT.
[0078] 3. Optimum pH of vanillyl alcohol oxidase and its mutants for synthesizing cis-isoeugenol
[0079] Whole-cell bacteria solution of wild-type and mutant S106L / L316F / I468L were used as catalysts.
[0080] The reaction system was: whole-cell bacteria solution with OD = 40, 100 mM 4-propylguaiacol, 10% DMSO. The reaction buffer was different pH buffers, respectively: 50 mM Na2HPO4-citric acid buffer with pH 6, 50 mM Na2PO4 buffer with pH 7, 50 mM K2HPO4-KH2PO4 buffer with pH 8, 100 mM Tris-HCl buffer with pH 8.5, 100 mM Tris-HCl buffer with pH 9, 50 mM boric acid buffer with pH 10. The reaction temperature was controlled at 30°C by water bath, and the reaction was stirred by magnetic force for 16 h. The concentration of product cis-isoeugenol and cis-trans selectivity were detected by gas chromatography. The results are shown in Figure 4 and Figure 5 .
[0081] From Figure 4 and Figure 5(The bar graph shows yield, and the line graph shows selectivity.) It turns out that the optimal pH for VAO enzyme activity is 8.5. Under acidic and neutral conditions, VAO's cleavage activity is relatively limited, but as the pH increases to 8.5, it reaches its maximum. Conversely, as the buffer becomes more alkaline, the activity gradually decreases, and enzyme activity is lost at pH 10.
[0082] 4. Effects of different substrate and enzyme concentrations on the synthesis of cis-isoeugenol by vanillyl alcohol oxidase and its mutants
[0083] Whole cell cultures of the wild type and mutant S106L / L316F / I468L were used as catalysts.
[0084] The reaction system consisted of whole-cell bacterial suspensions at OD = 10, 20, 40, or 80, 10 mM, 20 mM, or 50 mM 4-propylguaiacol, 10% DMSO, and 100 mM Tris-HCl (pH 8.5) as the reaction buffer. The reaction temperature was maintained at 30°C in a water bath with magnetic stirring for 16 hours. The concentration of the product, cis-isoeugenol, and the cis- and trans-selectivity were determined by gas chromatography. The results are shown in Table 6.
[0085] As shown in Table 6, the yield of cis-isoeugenol gradually increased with increasing bacterial concentration, and the yield of the mutant was consistently higher than that of the wild type. Cis-trans selectivity increased slightly with increasing bacterial concentration, but the change was not significant. The optimal reaction conditions were OD = 40 and substrate concentration of 20 mM.
[0086] Table 6 Effects of substrate concentration and enzyme concentration on enzyme catalysis
[0087]
[0088] 5. Kinetic parameters of vanillyl alcohol oxidase and its mutants
[0089] The initial velocities of the enzymatic reactions of wild-type vanillyl alcohol oxidase and mutant S106L / L316F / I468L were measured using 4-propylguaiacol as substrate at pH 8.5 and 30°C. The kinetic parameters (K M , K CAT , K CAT / K M ). The results are shown in Figure 6 and Figure 7 The kinetic parameters of wild-type VAO for 4-propylguaiacol were K M 4.07 mM, K CAT 5.65 minutes -1 , K CAT / K M= 1.39; the kinetic parameters of mutant S106L / L316F / I468L for 4-propylguaiacol were K M = 0.74, K CAT = 8.55 min -1 , K CAT / K M = 11.55.
[0090] The analysis results show that when isoeugenol is used as the substrate, the K M of the mutant is 0.2 times that of the wild type, indicating that the mutant has better affinity for the substrate. From the change in the K CAT value, the K CAT value of the mutant is 2 times that of the wild type, and the increase in K CAT indicates that the number of substrate molecules converted by the mutant per unit time is increased, which may be due to the mutation of the related sites to improve the catalytic rate of the enzyme for the substrate molecules.
Claims
1. A vanilloid alcohol oxidase mutant, characterized in that, obtained by amino acid mutation of the sequence shown in SEQ ID NO. 1, the mutation being S106L, S106L / L316F or S106L / L316F / I468L.
2. A nucleic acid, characterized in that, The vanillyl alcohol oxidase mutant of claim 1.
3. A recombinant vector, characterized in that, The nucleic acid of claim 2.
4. A recombinant cell, characterized in that, The recombinant vector of claim 3.
5. A method for preparing the vanillyl alcohol oxidase mutant according to claim 1, characterized in that: The method comprises the following steps: (1) designing point mutation primers, using a plasmid with a wild-type vanillyl alcohol oxidase gene as a template, and performing PCR reactions using the point mutation primers, to obtain a mutant gene fragment and a linearized plasmid after purification; (2) connecting the mutant gene fragment and the linearized plasmid to construct an expression vector, and transferring the expression vector into a host cell to induce expression of the vanillyl alcohol oxidase mutant.
6. The production method according to claim 5, wherein In step (1), the PCR reaction system is as follows: 。 7. A product characterized by, The product comprises the vanillyl alcohol oxidase mutant of claim 1, or the nucleic acid of claim 2, or the recombinant vector of claim 3, or the recombinant cell of claim 4.
8. Use of the product of claim 7 in the biocatalytic synthesis of cis-isoeugenol.
9. The use according to claim 8, wherein the biocatalysis is performed with 4-propylguaiacol as a substrate, under the conditions of pH 6-9, temperature 20-45℃, and reaction time 10-20 h.
Citation Information
Patent Citations
Pinoresinol enzyme-cascade synthesis method capable of automatically clearing H2O2
CN106591390A
Synthesis method of nitrogenous heterocyclic compound based on vanillyl alcohol oxidase
CN118497159A