Vanillyl alcohol oxidase mutant as well as preparation method and application thereof

Abstract

The invention discloses a vanillyl alcohol oxidase mutant as well as a preparation method and application thereof, wild type vanillyl alcohol oxidase comes from Penicillium simplicissimum, an active center of the wild type vanillyl alcohol oxidase is modified by using a directed evolution means, and the vanillyl alcohol oxidase mutant with relatively high activity, cis-trans selectivity and cis-isoeugenol yield is obtained. The mutation is at least one of S106 L, L316F or I468 L. According to the invention, efficient synthesis from cheap 4-propyl guaiacol to cis-isoeugenol is realized, and industrial synthesis and application of cis-isoeugenol are facilitated.

Description

Technical Field

[0001] The invention relates to an oxidase, in particular to a vanillyl alcohol oxidase, and belongs to the technical fields of enzyme engineering and genetic engineering. Background Art

[0002] Cis-isoeugenol (Z-isoeugenol) is widely used in the flavoring of food, tobacco, washing, cosmetics and medicines, deodorization of plastics, rubber and other industrial products, and is also an important pharmaceutical raw material and industrial additive. It is mainly used in the preparation of edible flavors in China, while its application fields abroad are very wide. It is widely used in the production of pharmaceutical dopa, methyldopa and sulfonamide drug synergist intermediate 3,4,5-trimethoxybenzaldehyde (TMBA), as a plant growth promoter, bactericide, lubricant defoamer, and printed circuit board production conductive agent.

[0003] Vanillyl alcohol oxidase is a flavin adenine dinucleotide-dependent oxidase, so it is also called flavin oxidase. The enzyme can catalyze alkanes, including aromatic compounds, to produce olefin compounds. In the reaction of 4-propylguaiacol catalyzed by vanillyl alcohol oxidase, the propyl CC bond in the substrate undergoes oxidation reaction to produce isoeugenol (Isoeugenol). Due to the problems of low catalytic activity and poor cis-trans selectivity of existing vanillyl alcohol oxidases, it is impossible to produce high yields of cis-isoeugenol. Summary of the invention

[0004] Purpose of the invention: The purpose of the present invention is to provide a vanillyl alcohol oxidase mutant with high activity, high cis-trans selectivity and high yield of cis-isoeugenol, and to provide a preparation method of the enzyme mutant, related nucleotide sequences, recombinant vectors, and recombinant cells.

[0005] Technical solution: The vanillyl alcohol oxidase mutant described in the present invention is obtained by amino acid mutation of the sequence shown in SEQ ID NO.1, and the mutation is at least one of S106L, L316F or I468L.

[0006] The vanillyl alcohol oxidase mutants are preferably S106L, S106L / L316F, S106L / L316F / I468L, and their amino acid sequences are SEQ ID NOs. 2 to 4, respectively.

[0007] The present invention uses the vanillyl alcohol oxidase (PDB: 2VAO) of Penicillium simplicissimum as the original enzyme (wild type), and its amino acid sequence is SEQ ID NO.1, and the gene sequence encoding the enzyme is SEQ ID NO.5. The present invention uses the sequence and structural information of the publicly reported vanillyl alcohol oxidase, and screens out potential enzyme genes according to the principles of protein structure similarity, conservative site analysis and host source diversity by performing non-redundant retrieval in databases such as PDB, and then purifies after functional expression in an Escherichia coli expression system to obtain a pure original enzyme. Finally, vanillyl alcohol oxidase VAO is selected as the original enzyme, which has a wide range of substrate applicability and can catalyze a variety of aromatic alkane substrates to generate corresponding olefin compounds. The present invention uses rational design to carry out directed evolution transformation on the original enzyme, mutates the amino acids in its active site, and finally screens out a vanillyl alcohol oxidase mutant with high activity, cis-trans selectivity and cis-isoeugenol yield.

[0008] The present invention uses the standard single-letter code for amino acids and the standard substitution notation, for example: S106L means that the serine (S) at position 106 at the N-terminus is mutated to leucine (L); S106L / L316F means that the serine (S) at position 106 at the N-terminus is mutated to leucine (L), and the leucine (L) at position 316 at the N-terminus is mutated to phenylalanine (F).

[0009] The present invention also provides a nucleotide sequence encoding the vanillyl alcohol oxidase mutant. The nucleotide sequence can be obtained by base mutation of the sequence shown in SEQ ID NO.5, such as SEQ ID NO.6-8.

[0010] The present invention also provides a recombinant vector comprising the nucleotide sequence. The recombinant vector includes a cloning vector or an expression vector, which can be a plasmid or a virus, and can maintain replication ability in a host cell, amplify or express the nucleotide sequence. The recombinant vector is preferably a PET series expression vector.

[0011] The present invention also provides a recombinant cell, comprising the recombinant vector. The recombinant cell is preferably Escherichia coli.

[0012] The present invention also provides a method for preparing the vanillyl alcohol oxidase mutant, comprising the following steps:

[0013] (1) Designing point mutation primers, using a plasmid carrying a wild-type vanillyl alcohol oxidase gene as a template, and using the point mutation primers to perform PCR reactions, respectively, to obtain mutant gene fragments and linearized plasmids after purification;

[0014] (2) The mutant gene fragment is connected to the linearized plasmid to construct an expression vector, and the expression vector is transferred into the host bacteria to induce the expression of the vanillyl alcohol oxidase mutant.

[0015] Preferably, in step (1), the point mutation primer is:

[0016] Mutation primer name Sequence (5'-3') S106L_F GGTCGTAATCTTGGCTATGGCGGTGCCGCACCGCG S106L_R CGCGGTGCGGCACCGCCATAGCCAAGATTACGACC L316F_F GGTCGTAATTGTGGCTATGGCGGTGCCGCACCGCG L316F_R CGCGGTGCGGCACCGCCATAGCCACAATTACGACC I468L_F GCAAAGATCAGATTGTGGATGGCCAATATATGAAAACC I468L_R CATGGGTATGGGTCGGTTTCATATATTGGCCATCCAC .

[0017] Preferably, in step (1), the PCR reaction system is:

[0018]

[0019]

[0020] Preferably, in step (1), the PCR reaction conditions are:

[0021]

[0022] Preferably, in step (2), after expression is completed, the cells are collected; or the cells are disrupted and the crude enzyme solution is collected; or the cells are disrupted and the isolated and purified vanillyl alcohol oxidase mutant is collected.

[0023] The present invention also provides a product, which comprises the vanillyl alcohol oxidase mutant, or the nucleotide sequence, or the recombinant vector, or the recombinant cell.

[0024] The invention also provides application of the product in biocatalytic synthesis of cis-isoeugenol.

[0025] Preferably, the biocatalysis uses 4-propylguaiacol as a substrate and reacts for 10 to 20 hours at a pH of 6 to 9 and a temperature of 20 to 45°C.

[0026] The process of the vanillyl alcohol oxidase catalyzing the oxidation reaction to generate cis-isoeugenol is as follows:

[0027]

[0028] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: The present invention provides a vanillyl alcohol oxidase mutant with high activity, cis-trans selectivity and cis-isoeugenol yield, realizes the efficient synthesis of cis-isoeugenol from cheap 4-propylguaiacol, is beneficial to the industrial synthesis and application of cis-isoeugenol, and has good application prospects in medical fields such as drug synthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of the yield and cis-trans selectivity of the synthesis of cis-isoeugenol catalyzed by the original enzyme WT and the mutant;

[0030] Figure 2 Schematic diagram of the yield and cis-trans selectivity of the original enzyme WT catalyzing the synthesis of cis-isoeugenol at different temperatures;

[0031] Figure 3 Schematic diagram of the yield and cis-trans selectivity of the synthesis of cis-isoeugenol catalyzed by mutant S106L / L316F / I468L at different temperatures;

[0032] Figure 4 Schematic diagram of the yield and cis-trans selectivity of the original enzyme WT catalyzing the synthesis of cis-isoeugenol at different pH;

[0033] Figure 5 Schematic diagram of the yield and cis-trans selectivity of the synthesis of cis-isoeugenol catalyzed by mutant S106L / L316F / I468L at different pH;

[0034] Figure 6 is the enzymatic reaction kinetic curve of the original enzyme WT;

[0035] Figure 7 is the enzymatic reaction kinetic curve of mutant S106L / L316F / I468L;

[0036] Figure 8 is the gas chromatogram of cis-isoeugenol and trans-isoeugenol;

[0037] Fig. 9 This is the H NMR spectrum of cis-isoeugenol. DETAILED DESCRIPTION

[0038] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0039] Example 1: A vanillyl alcohol oxidase mutant S106L

[0040] In this example, the vanillyl alcohol oxidase (PBD:2VAO) of Penicillium simplicissimum was used as the original enzyme, and the serine at position 106 at the N-terminus of its amino acid sequence was mutated to leucine.

[0041] The preparation method is as follows: (1) designing point mutation primers, performing PCR reaction, and obtaining mutant gene fragments; (2) constructing expression vectors and transferring them into host bacteria for inducing expression. The details are as follows:

[0042] (1) Design point mutation primers and perform PCR reaction to obtain mutant gene fragments

[0043] Construction of vanillyl alcohol oxidase mutant plasmid. The wild-type gene of flavin oxidase VAO of Penicillium simplicissimum was synthesized and constructed on the pET22b vector by Jinweizhi (Suzhou) Company, and the vector was transformed into the E. coli DH5α strain. The recombinant bacteria E. coli DH5α / pET22b-VAO was inoculated in a 5mL test tube with culture medium and cultured at 37°C and 200rpm for 10 hours. After the culture, the bacteria were centrifuged at 12,000rpm for 1min and the cells were collected. The plasmid was extracted from the recombinant bacteria using a high-purity plasmid mini-extraction kit as a template for iterative mutation to construct the plasmid pET22b-VAO mutant.

[0044] Expression and preparation of wild-type vanillyl alcohol oxidase. The expression vector is transformed into an expression strain to obtain a recombinant expression strain capable of expressing vanillyl alcohol oxidase. The successfully constructed recombinant expression strain E. coli BL21 (DE3) / pET22b-VAO is coated on a plate containing ampicillin at a final concentration of 100 μg / mL, a single colony is picked and inoculated in 6 mL of LB medium containing resistance and cultured overnight at 37 ° C at 200 rpm / min, and 1% of the inoculation amount is transferred to 500 mL of LB medium containing resistance. When OD600 reaches about 0.6, IPTG with a final concentration of 0.5mM is added, and induction is carried out at 18 ° C for about 14 hours. The bacterial cells containing vanillyl alcohol oxidase are obtained for subsequent catalytic research and enzyme activity determination.

[0045] Recombinant E. coli BL21 (DE3) / pET22b-VAO mutant S106L was constructed. The gene mutation was carried out by whole plasmid PCR to obtain the target mutant gene. The primers for S106L are shown in Table 1, and single-point iterative mutation was performed. The amino acid sequence of mutant S106L is shown in SEQ ID NO.2, and the nucleotide sequence is shown in SEQ ID NO.6.

[0046] Table 1 Primer sequences of mutant S106L

[0047] Mutation primer name Sequence (5'-3') S106L_F GGTCGTAATCTTGGCTATGGCGGTGCCGCACCGCG S106L_R CGCGGTGCGGCACCGCCATAGCCAAGATTACGACC

[0048] The PCR reaction system is shown in Table 2:

[0049] Table 2 PCR reaction system

[0050] Composition volume 10×BufferforKOD-Plus- 2.5μL 2mM dNTP 2.5μL <![CDATA[25mMMgSO4]]> 1.5μL DMSO 1μL 10pmol / μLForwardPrimer 0.75μL 10pmol / μLReversePrimer 0.75μL DNA template <100ng KOD-Plus- 1μL <![CDATA[ddH2O]]> up to 25 μL

[0051] The PCR reaction conditions are shown in Table 3.

[0052] Table 3 PCR reaction conditions

[0053]

[0054] After the PCR amplification was completed, the amplified product was detected by 0.9% agarose gel electrophoresis, and the result showed that the amplified product was a single band with a size of about 7000 bp. The amplified product was purified and recovered using a DNA recovery and purification kit.

[0055] The purified gene fragment was digested with DpnI to remove the template and then recombined with recombinase. The recombinant product was transformed into E.coli DH5α competent cells, spread on the surface of LB solid culture medium containing 100μg / mL ampicillin, cultured at 37℃ for 14h, and single colonies were picked to LB liquid culture medium. The positive transformants constructed successfully were identified by PCR, and the correctness of the mutation site was verified by sequencing. After verification, a part of the bacteria was added with sterile glycerol at a final concentration of 25%, numbered, and stored in a -80℃ refrigerator for use. A part of the bacteria was extracted with a plasmid extraction kit, and the recombinant plasmid was stored in a -20℃ refrigerator.

[0056] (2) Constructing an expression vector and transferring it into the host bacteria for inducing expression

[0057] The recombinant expression plasmid pET22b that was successfully sequenced was transferred into E. coli BL21 (DE3) as the expression host to construct the recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-VAO.

[0058] The successfully constructed recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-VAO was spread on a plate containing ampicillin at a final concentration of 100 μg / mL. A single colony was picked and inoculated into 6 mL of LB medium containing resistance and cultured overnight at 37 ° C at 200 rpm / min. 1% of the inoculum was transferred to 500 mL of LB medium containing resistance. At OD 600 When the concentration reaches about 0.6, add IPTG with a final concentration of 0.5 mM and induce at 18°C ​​for about 14 hours.

[0059] After obtaining the bacteria by centrifugation, resuspend them with buffer, break the cells by ultrasonication in an ice bath (working for 3s, interval for 6s, working time for 30min), and centrifuge at 12,000rpm / min for 20min at 4°C. After collecting the supernatant, filter it out through a 0.22μm water filter head as a sample, and then purify it with nickel column enzyme. According to the amino acid sequence of VAO, the molar absorption coefficient ε of the protein is calculated, and the absorbance of the purified protein is measured by the A280 method to calculate the concentration of the protein.

[0060] Example 2: A vanillyl alcohol oxidase mutant S106L / L316F

[0061] This example uses the same original enzyme as in Example 1, and mutates the serine at position 106 of the N-terminal amino acid sequence to leucine, and the leucine at position 316 to phenylalanine. The amino acid sequence of the mutant is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.7. The preparation method is basically the same as in Example 1, except for the mutation primers, as shown in Table 4:

[0062] Table 4 Primer sequences of mutant S106L / L316F

[0063] Mutation primer name Sequence (5'-3') S106L_F GGTCGTAATCTTGGCTATGGCGGTGCCGCACCGCG S106L_R CGCGGTGCGGCACCGCCATAGCCAAGATTACGACC L316F_F GGTCGTAATTGTGGCTATGGCGGTGCCGCACCGCG L316F_R CGCGGTGCGGCACCGCCATAGCCACAATTACGACC

[0064] Example 3: A vanillyl alcohol oxidase mutant S106L / L316F / I468L

[0065] This example uses the same original enzyme as in Example 1, and mutates the serine at position 106 of the N-terminal amino acid sequence to leucine, the leucine at position 316 to phenylalanine, and the isoleucine at position 468 to leucine. The amino acid sequence of the mutant is shown in SEQ ID NO.4, and the nucleotide sequence is shown in SEQ ID NO.8. The preparation method is basically the same as in Example 1, except for the mutation primers, as shown in Table 5:

[0066] Table 5 Primer sequences of mutant S106L / L316F / I468L

[0067]

[0068]

[0069] Performance Testing

[0070] 1. Yield and cis-trans selectivity of the synthesis of cis-isoeugenol catalyzed by vanillyl alcohol oxidase and its mutants

[0071] The wild-type enzymes and whole cell cultures of the mutants obtained in Examples 1 to 3 were used as catalysts.

[0072] The reaction system is: whole cell bacterial solution with OD=20, 50mM 4-propylguaiacol, and reaction buffer is 100mM Tris-HCl with pH=8.5. The reaction temperature is controlled at 30°C by water bath, magnetic stirring is used, the reaction is carried out for 20h, and the concentration of the product trans-isoeugenol is detected by gas chromatography.

[0073] The gas chromatograms of cis-isoeugenol and trans-isoeugenol are shown in Figure 8 The H NMR spectrum of cis-isoeugenol is shown in Fig. 9 .Depend on Figure 1(The bar graph is the yield, and the line graph is the selectivity) It can be seen that among the wild-type enzyme and the mutants, the mutants have improved yield and cis-trans selectivity compared to WT, among which S106L / L316F / I468L has the most significant improvement compared to WT.

[0074] 2. Optimal temperature for the synthesis of cis-isoeugenol catalyzed by vanillyl alcohol oxidase and its mutants

[0075] Whole cell cultures of the wild type and mutant S106L / L316F / I468L were used as catalysts.

[0076] The reaction system was: whole cell bacterial solution with OD=40, 100mM 4-propylguaiacol, 10% DMSO, and the reaction buffer was 100mM Tris-HCl with pH 8.5. The reaction temperature was controlled at 20℃, 25℃, 30℃, 37℃, and 45℃ by water bath, with magnetic stirring, and the reaction was carried out for 16h. The concentration and cis-trans selectivity of the product cis-isoeugenol were detected by gas chromatography. The results are shown in Figure 2 and Figure 3 .

[0077] Depend on Figure 2 and Figure 3 (The bar graph is the yield, and the line graph is the selectivity) It can be seen that different temperatures have a significant effect on the catalytic effect of VAO, and its reaction activity shows a positive trend with the change of temperature. The best catalytic effect was observed at 25°C, while the enzyme activity was relatively low at temperatures below or above this temperature.

[0078] 3. Optimal pH for the synthesis of cis-isoeugenol catalyzed by vanillyl alcohol oxidase and its mutants

[0079] Whole cell cultures of the wild type and mutant S106L / L316F / I468L were used as catalysts.

[0080] The reaction system is: whole cell bacterial liquid with OD=40, 100mM 4-propylguaiacol, 10% DMSO. The reaction buffer is a buffer with different pH values, namely: 50mM disodium hydrogen phosphate-citric acid buffer at pH 6, 50mM sodium phosphate buffer at pH 7, 50mM dipotassium hydrogen phosphate-potassium hydrogen phosphate buffer at pH 8, 100mM Tris-HCl buffer at pH 8.5, 100mMTris-HCl buffer at pH 9, 50mM boric acid buffer at pH 10, the reaction temperature is controlled at 30°C in a water bath, magnetic stirring is applied, the reaction is carried out for 16h, and the concentration and cis-trans selectivity of the product cis-isoeugenol are detected by gas chromatography. The results are shown in Figure 4 and Figure 5 .

[0081] Depend on Figure 4 and Figure 5(The bar graph is the yield, and the line graph is the selectivity) It can be seen that the pH of VAO with the most suitable enzyme activity is 8.5. Under acidic and neutral conditions, the cleavage activity of VAO is relatively limited, but as the pH increases to 8.5, the activity reaches the maximum. On the contrary, as the alkalinity of the buffer increases, the activity gradually weakens, and the enzyme activity is lost in the pH 10 system.

[0082] 4. Effects of different substrate and enzyme concentrations on the synthesis of cis-isoeugenol catalyzed by vanillyl alcohol oxidase and its mutants

[0083] Whole cell cultures of the wild type and mutant S106L / L316F / I468L were used as catalysts.

[0084] The reaction system was: whole cell bacterial solution with OD=10, 20, 40, 80, 10mM, 20mM, 50mM 4-propylguaiacol, 10% DMSO, and the reaction buffer was 100mM Tris-HCl with pH 8.5. The reaction temperature was controlled at 30°C by water bath, magnetic stirring was used, the reaction was carried out for 16 hours, and the concentration and cis-trans selectivity of the product cis-isoeugenol were detected by gas chromatography. The results are shown in Table 6.

[0085] As shown in Table 6, with the increase of bacterial concentration, the yield of cis-isoeugenol gradually increased, and the yield of the mutant was always higher than that of the wild type. The cis-trans selectivity increased slightly with the increase of bacterial concentration, but the change was not significant. The optimal reaction conditions were OD = 40 and substrate concentration 20 mM.

[0086] Table 6 Effects of substrate concentration and enzyme concentration on enzyme catalysis

[0087]

[0088] 5. Kinetic parameters of vanillyl alcohol oxidase and its mutants

[0089] Using 4-propylguaiacol as substrate, the initial velocities of the enzymatic reactions of wild-type vanillyl alcohol oxidase and mutant S106L / L316F / I468L were measured at pH 8.5 and 30°C, and the kinetic parameters (K M , K CAT , K CAT / K M ). The results are shown in Figure 6 and Figure 7 The kinetic parameters of wild-type VAO for 4-propylguaiacol were K M 4.07mM, K CAT 5.65min -1 , K CAT / K M=1.39; the kinetic parameters of mutants S106L / L316F / I468L for 4-propylguaiacol are K M is 0.74, K CAT 8.55min -1 , K CAT / K M =11.55.

[0090] The analysis results show that when isoeugenol is used as substrate, the K M It is 0.2 times that of the wild type, indicating that the mutant has a better affinity with the substrate. CAT The K CAT The value is twice that of the wild type, K CAT The increase in indicates that the mutant converts more substrate molecules per unit time, which may be because the mutation at the relevant site increases the catalytic rate of the enzyme on the substrate molecules.

Claims

1. A vanillyl alcohol oxidase mutant, characterized in that It is obtained by amino acid mutation of the sequence shown in SEQ ID NO.1, wherein the mutation is at least one of S106L, L316F or I468L.

2. A nucleotide sequence, characterized in that Encoding the vanillyl alcohol oxidase mutant according to claim 1.

3. A recombinant vector, characterized in that: Comprising the nucleotide sequence of claim 2.

4. A recombinant cell, characterized in that Comprising the recombinant vector according to claim 3.

5. A method for preparing the vanillyl alcohol oxidase mutant according to claim 1, characterized in that: The steps include: (1) Designing point mutation primers, using the plasmid carrying the wild-type vanillyl alcohol oxidase gene as a template, and using the point mutation primers to perform PCR reactions respectively, and obtaining the mutant gene fragment and linearized plasmid after purification; (2) The mutant gene fragment is connected to the linearized plasmid to construct an expression vector, which is then transferred into the host bacteria to induce the expression of the vanillyl alcohol oxidase mutant.

6. The preparation method according to claim 5, characterized in that: In step (1), the point mutation primer is: 。 7. The preparation method according to claim 5, characterized in that: In step (1), the PCR reaction system is: 。 8. A product, characterized in that The product comprises the vanillyl alcohol oxidase mutant described in claim 1, or the nucleotide sequence described in claim 2, or the recombinant vector described in claim 3, or the recombinant cell described in claim 4.

9. Use of the product according to claim 8 in biocatalytic synthesis of cis-isoeugenol.

10. The use according to claim 9, wherein the biocatalysis uses 4-propylguaiacol as a substrate and reacts for 10 to 20 hours at a pH of 6 to 9 and a temperature of 20 to 45°C.

Images