A mutant of isoeugenol dioxygenase, a preparation method thereof and an application thereof

By mutation of the active sites of isoeugenol dioxygenase, the activity and yield of the enzyme are improved, the problem of low existing enzyme activity is solved, and industrial applications for efficient synthesis of vanillin are achieved.

CN118773151BActive Publication Date: 2025-07-22NANJING UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410754406.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-12
Publication Date
2025-07-22
Estimated Expiration
2044-06-12

AI Technical Summary

Technical Problem

The existing isoeugenol dioxygenase has low activity and low yield, making it difficult to meet the needs of industrial applications.

Method used

Mutants with higher activity and yield were prepared by mutation of the active sites of isoeugenol dioxygenase, especially the amino acids at positions 216, 281, 283, and 307.

Benefits of technology

The efficient synthesis of cheap isoeugenol to high-value fragrance vanillin has been achieved, which has improved the yield of enzymes and laid the foundation for industrial synthesis of vanillin.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118773151B_ABST
    Figure CN118773151B_ABST
Patent Text Reader

Abstract

The present invention discloses a mutant of isoeugenol dioxygenase, a preparation method and an application thereof. The mutant has at least one mutation at positions 216, 281, 283 and 307 in the amino acid sequence shown in SEQ ID NO. 1. Through reasonable design of isoeugenol dioxygenase, the finally obtained mutant has a high yield, realizes the efficient synthesis of high-value spice vanillin from cheap isoeugenol, and lays a foundation for the industrial synthesis of vanillin.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of enzyme engineering and genetic engineering, and in particular to a mutant of isoeugenol dioxygenase, a preparation method and application thereof. Background Art

[0002] Vanillin, one of the most widely used flavorings in the world and known as the "King of Food Flavors," has broad application potential in the food and pharmaceutical industries. Vanillin is used in a variety of sectors, including food and beverages, personal care, pharmaceuticals, and animal feed. In the food sector, vanillin enhances flavor and sweetness. Its mild antioxidant properties in foods rich in polyunsaturated fatty acids make it a preservative in cream and butter. In the personal care and pharmaceutical sectors, vanillin is used as a flavoring and direction-masking agent in aromatherapy, toothpaste, car fresheners, and various cleaning products. In the pharmaceutical sector, vanillin is not only an anti-inflammatory agent but also in the manufacture of medications for arthritis, allergies, and nephritis. Vanillin also has diverse industrial applications, such as as a defoaming agent in lubricants, a solubilizer for riboflavin, and an attractant in pesticides.

[0003] Currently, vanillin is produced through three main methods: natural extraction, chemical synthesis, and biological methods. Natural extraction is expensive and has limited yields; chemical synthesis produces products with a single aroma and the use of chemical reagents can pollute the environment; biological synthesis relies on readily available, inexpensive raw materials and a clean and efficient production process. However, current isoeugenol dioxygenases exhibit low activity and yield, necessitating the development of novel isoeugenol dioxygenases with higher activity and yield to meet the demands of industrial applications. Summary of the Invention

[0004] Objectives of the invention: The first objective of the present invention is to provide a mutant of isoeugenol dioxygenase, which addresses the problems of poor stability and low yield of vanillin produced by existing isoeugenol dioxygenase, improves the yield of the enzyme, and realizes the efficient synthesis of high-value spice vanillin from cheap isoeugenol, laying the foundation for the industrial synthesis of vanillin; the second objective of the present invention is to provide a method for preparing the mutant of isoeugenol dioxygenase; the third objective of the present invention is to provide the use of the mutant of isoeugenol dioxygenase in the biocatalytic synthesis of vanillin.

[0005] Technical solution: The mutant of the isoeugenol dioxygenase of the present invention is characterized in that at least one of positions 216, 281, 283, and 307 in the amino acid sequence shown in SEQ ID NO.1 is mutated; the methionine Met (M) at the amino acid position 216 is mutated to alanine Ala (A); the phenylalanine Phe (F) at the amino acid position 281 is mutated to arginine Arg (R), serine Ser (S) or aspartic acid Asn (N); the serine Ser (S) at the amino acid position 283 is mutated to alanine Ala (A) or phenylalanine Phe (F); and the phenylalanine Phe (F) at the amino acid position 307 is mutated to leucine Leu (L).

[0006] The present invention mutates the active site of the coding sequence of isoeugenol dioxygenase from Novosphingobium aromaticivorans (Pdb: 5J55).

[0007] Preferably, the mutant is a mutation of methionine Met (M) at amino acid position 216 to alanine Ala (A).

[0008] Preferably, the mutant is a mutation in which the serine Ser (S) at the 283rd amino acid is mutated to alanine Ala (A).

[0009] Preferably, the mutant is a mutation of serine Ser (S) at amino acid position 283 to phenylalanine Phe (F).

[0010] Preferably, the mutant is a mutation of serine Ser (S) at amino acid position 283 to alanine Ala (A), and a mutation of phenylalanine Phe (F) at amino acid position 307 to leucine Leu (L).

[0011] Preferably, the mutant is a mutation of the serine Ser (S) at the 283rd amino acid to the alanine Ala (A), the phenylalanine Phe (F) at the 307th amino acid to the leucine Leu (L), and the methionine Met (M) at the 216th amino acid to the alanine Ala (A).

[0012] Preferably, the mutant is a mutation of the serine Ser (S) at the 283rd amino acid to an alanine Ala (A), a mutation of the phenylalanine Phe (F) at the 307th amino acid to a leucine Leu (L), and a mutation of the phenylalanine Phe (F) at the 281st amino acid to an arginine Arg (R).

[0013] Preferably, the mutant is a mutation of the serine Ser (S) at the 283rd amino acid to the alanine Ala (A), and the phenylalanine Phe (F) at the 307th amino acid is mutated to the leucine Leu (L), and the phenylalanine Phe (F) at the 281st amino acid is mutated to the serine Ser (S).

[0014] Preferably, the mutant is a mutation in which the serine Ser (S) at the 283rd amino acid is mutated to the alanine Ala (A), the phenylalanine Phe (F) at the 307th amino acid is mutated to the leucine Leu (L), and the phenylalanine Phe (F) at the 281st amino acid is mutated to the aspartic acid Asn (N).

[0015] The amino acid sequence of the mutant is any one of the sequences shown in SEQ ID No. 2 to 8.

[0016] The present invention provides a gene encoding a mutant protein of the isoeugenol dioxygenase.

[0017] Preferably, the nucleotide sequence of the gene is shown as SEQ ID No. 10 to 16.

[0018] A cloning vector or expression vector of the gene of the present invention.

[0019] The method for preparing the mutant of isoeugenol dioxygenase of the present invention is characterized by comprising the following steps:

[0020] (1) Designing point mutation primers, using a plasmid carrying the wild-type isoeugenol dioxygenase nucleotide sequence gene as a template, and performing PCR reactions using the point mutation primers, respectively, to obtain mutant gene fragments and linearized plasmids after purification;

[0021] (2) Connecting the mutant gene fragment to the linearized plasmid to construct an expression vector, which is then transferred into the host bacteria for induction of expression;

[0022] (3) collecting host bacteria expressing the isoeugenol dioxygenase mutant, resuspending the bacteria and breaking the cells, and centrifuging and collecting the supernatant to obtain a crude enzyme solution containing the isoeugenol dioxygenase mutant.

[0023] Preferably, the point mutation primers are:

[0024]

[0025]

[0026] Preferably, the PCR reaction system is:

[0027]

[0028] The application of the mutant of the isoeugenol dioxygenase of the present invention in the biocatalytic synthesis of vanillin is as follows:

[0029]

[0030] Preferably, the application method is: using isoeugenol as a substrate to catalyze the synthesis of vanillin, and the conditions are a pH range of 7 to 10 and a temperature range of 15 to 35°C.

[0031] Beneficial effects: Compared with the existing technology, the present invention has the following significant advantages: by mutating the active site of isoeugenol dioxygenase, the enzyme is rationally designed, and the mutant finally obtained has a higher yield, realizing the efficient synthesis of high-value spice vanillin from cheap isoeugenol, laying the foundation for the industrial synthesis of vanillin. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The graph shows the vanillin yield of the original enzyme WT, S283A, S283F, S283A / F307L, S283A / F307L / M216A, S283A / F307L / F281A, S283A / F307L / F281S, and S283A / F307L / F281D mutants;

[0033] Figure 2 The relative activity of isoeugenol dioxygenase and its mutants in catalyzing the synthesis of vanillin at different temperatures is shown;

[0034] Figure 3 The relative activity of isoeugenol dioxygenase and its mutants in catalyzing the synthesis of vanillin at different pH values ​​is shown;

[0035] Figure 4 The graph shows the yield of vanillin synthesis catalyzed by isoeugenol dioxygenase and its mutants at different substrate concentrations. DETAILED DESCRIPTION

[0036] The technical solution of the present invention will be further described below in conjunction with embodiments.

[0037] After extensive research, the present invention provides, for the first time, an isoeugenol dioxygenase, its preparation method, and applications. Specifically, by amplifying the isoeugenol dioxygenase gene from Novosphingobium aromaticivorans and using semi-rational design to engineer it through directed evolution, a mutant with significantly improved isoeugenol dioxygenase yield was obtained.

[0038] In the present invention, the sequence and structural information of publicly reported isoeugenol dioxygenases were utilized, and non-redundant searches were performed in databases such as NCBI. Based on the principles of protein structure similarity, conserved site analysis, and host source diversity, the isoeugenol dioxygenase NOV1 gene was selected. After functional expression in an Escherichia coli expression system and subsequent purification, a pure enzyme was obtained.

[0039] The amino acid sequence of the wild-type isoeugenol dioxygenase is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.9.

[0040] Example 1

[0041] 1. Design and synthesis of wild-type isoeugenol dioxygenase NOV1 gene sequence and construction of expression vector

[0042] According to the coding sequence of isoeugenol dioxygenase from Novosphingobium aromaticivorans in the Pdb database (Pdb: 5J55), Suzhou Jinweizhi Biotechnology Co., Ltd. was commissioned to synthesize the gene fragment and construct it on the pET22b vector, named pET22b-NOV1 gene (as shown in SEQ ID NO.9), and its corresponding amino acid sequence is shown in SEQ ID NO.1.

[0043] The vector was then transformed into E. coli Top10 and screened using ampicillin-resistant LB plates to obtain clones. One clone was selected and inoculated into a 20 mL tube of ampicillin-resistant LB medium and cultured at 37°C with shaking at 220 rpm for 12 hours. After the culture, the cells were centrifuged at 12,000 rpm for 1 minute and harvested. A high-purity plasmid miniprep kit was used to extract the plasmid from E. coli Top10 / pET22b-NOV1, which served as a template for iterative mutagenesis. Mutants of the pET22b-NOV1 plasmid were constructed and sequenced by Suzhou Jinweizhi Biotechnology Co., Ltd. A clone with the correct insertion and no mutations was selected to obtain the isoeugenol dioxygenase gene expression vector, designated pET22b-NOV1.

[0044] 2. Expression and preparation of wild-type isoeugenol dioxygenase NOV1

[0045] The expression vector pET22b-NOV1 obtained in Example 1 was transformed into Escherichia coli BL21 (DE3) to obtain the genetically engineered Escherichia coli pET22b-NOV1 / BL21 (DE3) capable of expressing isoeugenol dioxygenase.

[0046] The engineered bacteria pET22b-NOV1 / BL21 (DE3) were inoculated into the culture medium at a 0.1% inoculum size and cultured in a shake flask with a volume of 100 mL / 250 mL (containing 100 mg / L ampicillin). When the OD600 of the bacterial solution reached 0.6-0.8, isopropylthiogalactoside (IPTG) was added to induce the culture at a final concentration of 1 mM. The culture was cooled to 18°C ​​and cultured for approximately 20 hours. The culture was centrifuged at 4000 rpm for 10 minutes, and the cells were collected and resuspended in 100 mM Tris-HCl buffer (pH 9) to obtain cells containing isoeugenol monooxygenase for subsequent catalytic studies and enzyme activity determination.

[0047] Example 3: Construction of recombinant E. coli BL21(DE3) / pET22b-NOV1 mutant S283A

[0048] The target mutant gene was obtained using whole-plasmid PCR. Primers were specifically designed for S283A, and other mutants were designed using this principle and subjected to single-point iterative mutagenesis. The amino acid sequence of S283A is shown in SEQ ID NO. 2, and the nucleotide sequence is shown in SEQ ID NO. 10.

[0049] S283A upstream primer: CTGCTTTGCG GC CCATGTGCTGAACGCGTGGCAAGAAG

[0050] S283A downstream primer: CAGCACATGG GC CGCAAAGCAGTTATCGCGGGTAAACCAGPCR system is shown in Table 1:

[0051] Table 1 PCR reaction system

[0052]

[0053] PCR reaction conditions are shown in Table 2.

[0054] Table 2 PCR reaction conditions

[0055]

[0056] After the PCR amplification was completed, the amplified product was detected by 0.9% agarose gel electrophoresis, and the result showed that the amplified product was a single band with a size of about 7000 bp. The amplified product was purified and recovered using a DNA recovery and purification kit.

[0057] After PCR, 10 μL of each of the 29 PCR products was aspirated and mixed, then 1 μL of the restriction endonuclease DpnI was added to remove the template plasmid. After DNA gel extraction using a DNA gel recovery kit, the cells were transformed into competent E. coli DH5α cells and plated onto plates containing 100 mg / mL ampicillin. The plates were incubated upside down at 37°C for 12 hours. Single colonies were picked and transferred to LB liquid medium for 6 hours. The correctness of the mutation site was verified by sequencing. Once verified, a portion was added with sterile glycerol to a final concentration of 25%, numbered, and stored at -80°C until ready for use. A portion of the colonies was extracted using a plasmid extraction kit, and the recombinant plasmids were stored at -20°C. Using a sterile toothpick, single colonies were picked and transferred to 30 96-well plates filled with sterile LB medium. After incubation at 37°C, 400 rpm, sterile glycerol was added to a final concentration of 10% using a 96-well pipette, pipetted evenly, and stored at -80°C until ready for use.

[0058] The purified gene fragments were digested with DpnI to remove the template and then recombined using a recombinase. The recombinant product was transformed into E. coli DH5α competent cells and plated on the surface of LB solid medium containing 100 μg / mL ampicillin. The cells were incubated at 37°C for 12 hours, and single colonies were picked and transferred to LB liquid culture. Successful transformants were identified by PCR, and the correctness of the mutation site was verified by sequencing. After verification, a portion of the cells was added with sterile glycerol to a final concentration of 25%, numbered, and stored at -80°C until further use. A portion of the cells was used to extract the plasmid using a plasmid extraction kit, and the recombinant plasmids were stored at -20°C.

[0059] The recombinant expression plasmid pET22b that was successfully sequenced was transferred into E. coli BL21 (DE3) as the expression host to construct the recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-NOV1.

[0060] Example 2

[0061] Construction of recombinant E. coli BL21(DE3) / pET22b-NOV1 mutant.

[0062] The target mutant gene was obtained by whole plasmid PCR. The primers required for S283F were specifically designed as follows. Except for the primers, the rest of the operation was the same as in Example 1. The primers are as follows:

[0063] S283F upstream primer: CTGCTTTGCG TTC CATGTGCTGAACGCGTGGCAAGAAG

[0064] S283F downstream primer: CAGCACATGG AACGCAAAGCAGTTATCGCGGGTAAACC

[0065] The amino acid sequence of S283F is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.11.

[0066] Example 3

[0067] Construction of recombinant E. coli BL21(DE3) / pET22b-NOV1 mutant S283A / F307L.

[0068] The target mutant gene was obtained by whole-plasmid PCR. The primers required for S283A / F307L were specifically designed as follows. The mutant constructed in Example 1 was used as a template. Except for the primers, the rest of the operations were the same as in Example 3. The primers were as follows:

[0069] F307L upstream primer: GAAAAAACAACATG TTA CCGTTTTTTCCGGATGTGCATGGC

[0070] F307L downstream primer: GAAAAAACGG GAA CATGTTGTTTTTCGCTTCGCAGGTCAC

[0071] The amino acid sequence of S283A F307L is shown in SEQ ID NO.4, and the nucleotide sequence is shown in SEQ ID NO.12.

[0072] Example 4

[0073] Construction of recombinant E. coli BL21(DE3) / pET22b-NOV1 mutant S283A / F307L / M216A.

[0074] The target mutant gene was obtained by whole-plasmid PCR. The primers required for S283A / F307L / M216A were specifically designed as follows. The mutant constructed in Example 3 was used as a template. Except for the primers, the rest of the operations were the same as in Example 1. The primers were as follows:

[0075] M216A upstream primer: GTATTATTGC GCG ATGCATGATTTTGGCATTACCGAAG

[0076] M216A downstream primer:

[0077] CAAAATCATGCATC GCG CAATAATACGGCACTTTAAACCACAC

[0078] The amino acid sequence of 283AF307L M216A is shown in SEQ ID NO.5, and the nucleotide sequence is shown in SEQ ID NO.13.

[0079] Example 5

[0080] Construction of recombinant E. coli BL21(DE3) / pET22b-NOV1 mutant S283A / F307L / F281R.

[0081] The target mutant gene was obtained by whole-plasmid PCR. The primers required for S283A / F307L / F281R were specifically designed as follows. The mutant constructed in Example 3 was used as a template. Except for the primers, the rest of the operations were the same as in Example 1. The primers were as follows:

[0082] F281R upstream primer: GATAACTGC CGT GCGAGCCATGTGCTGAACGCGTGGCAAGF281R downstream primer: CACATGGCTCGCA CGG CAGTTATCGCGGGTAAACC

[0083] The amino acid sequence of S283A F307L F281R is shown in SEQ ID NO.6, and the nucleotide sequence is shown in SEQ ID NO.14.

[0084] Example 6

[0085] Construction of recombinant E. coli BL21(DE3) / pET22b-NOV1 mutant S283A / F307L / F281S.

[0086] The target mutant gene was obtained by whole-plasmid PCR. The primers required for S283A / F307L / F281S were specifically designed as follows. The mutant constructed in Example 3 was used as a template. Except for the primers, the rest of the operations were the same as in Example 1. The primers were as follows:

[0087] F281S upstream primer: GATAACTGC TCT GCGAGCCATGTGCTGAACGCGTGGCAAG

[0088] F281S downstream primer: CACATGGCTCGCA CCG CAGTTATCGCGGGTAAACC

[0089] The amino acid sequence of S283AF307L F281S is shown in SEQ ID NO.7, and the nucleotide sequence is shown in SEQ ID NO.15.

[0090] Example 7

[0091] Construction of recombinant E. coli BL21(DE3) / pET22b-NOV1 mutant S283A / F307L / F281D.

[0092] The target mutant gene was obtained by whole-plasmid PCR. The primers required for S283A / F307L / F281D were specifically designed as follows. The mutant constructed in Example 3 was used as a template. Except for the primers, the rest of the operation was the same as in Example 1. The primers were as follows:

[0093] F281D upstream primer: GATAACTGC GAT GCGAGCCATGTGCTGAACGCGTGGCAAGF281D downstream primer: CACATGGC TCG CATCGCAGTTATCGCGGGTAAACC

[0094] The amino acid sequence of S283AF307L F281D is shown in SEQ ID NO.8, and the nucleotide sequence is shown in SEQ ID NO.16.

[0095] Performance Testing

[0096] 1. Cultivation of isoeugenol dioxygenase and its mutants and preparation of pure enzyme solution

[0097] The recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-NOV1 was successfully constructed and spread onto a plate containing ampicillin at a final concentration of 100 μg / mL. A single colony was picked and inoculated into 20 mL of LB medium containing resistance and cultured overnight at 37°C at 200 rpm / min. 1% of the inoculum was transferred to 500 mL of LB medium containing resistance and the OD was 0. 600 When the concentration reaches about 0.6, add IPTG with a final concentration of 0.5 mM and induce at 18°C ​​for about 14 hours.

[0098] After centrifugation, the cells were resuspended in buffer and disrupted by sonication in an ice bath (2-second on-time, 5-second interval, 30-minute on-time). The supernatant was collected and filtered through a 0.22 μm aqueous filter for use as a sample. The sample was then purified using a nickel column. The molar absorptivity of the protein, ε, was calculated based on the NOV1 amino acid sequence. The protein concentration was calculated by measuring the absorbance of the purified protein using the A280 method.

[0099] 2. Synthesis of vanillin catalyzed by isoeugenol dioxygenase and its mutants

[0100] The whole cells of the engineered bacteria and mutants thereof capable of expressing isoeugenol dioxygenase constructed and cultured according to Examples 1 to 7 were used as catalysts.

[0101] The reaction system was: whole cell bacterial suspension with OD=80, 300mM isoeugenol, and 100mM Tris-HCl at pH=9 as the reaction buffer. The reaction temperature was controlled at 30°C in a water bath, with magnetic stirring, and the reaction was carried out for 20 hours. The concentration of the product vanillin was detected by gas chromatography. The results are shown in Table 1. Figure 1 .

[0102] Depend on Figure 1 It can be seen that among WT and mutants S283A, S283F, S283A / F307L, S283A / F307L / M216A, S283A / F307L / F281A, S283A / F307L / F281S, and S283A / F307L / F281D, the mutants have improvements compared to WT, among which S283A / F307L / F281D has the most significant improvement compared to WT, with an increase of about 40%.

[0103] 3. Optimal temperature for the synthesis of vanillin catalyzed by isoeugenol dioxygenase and its mutants

[0104] The engineered bacteria and mutants thereof capable of expressing isoeugenol dioxygenase constructed and cultured as described in Example 7 and the obtained whole cells were used as catalysts.

[0105] The reaction system was: whole cell bacterial suspension with OD=80, 300mM isoeugenol, and 100mM Tris-HCl at pH=9 as the reaction buffer. The reaction temperature was controlled at 25°C, 30°C, 35°C, 40°C, and 45°C in a water bath, with magnetic stirring. The reaction was continued for 20 hours, and the concentration of the product vanillin was detected by gas chromatography. The results are shown in Table 1. Figure 2 .

[0106] Depend on Figure 2 It was found that after reacting the isoeugenol dioxygenase and the mutant of Example 7 at different temperatures, the highest enzyme activity measured was 100% relative enzyme activity. The experiment demonstrated that the wild-type isoeugenol dioxygenase had the highest yield at 30°C, while the mutant had the highest yield at 25°C. Temperature measurements showed that the wild-type reacted at 30°C, while the mutant reacted at 25°C. The activity of the wild-type isoeugenol dioxygenase began to decrease when the temperature exceeded 30°C, and the reaction was essentially stopped at 50°C. The activity of the mutant began to decrease when the temperature exceeded 25°C, and the reaction was essentially stopped at 50°C.

[0107] 4. Optimization of pH conditions for the synthesis of vanillin catalyzed by isoeugenol dioxygenase and its mutants

[0108] The engineered bacteria and mutants thereof capable of expressing isoeugenol dioxygenase constructed and cultured as described in Example 7 and the obtained whole cells were used as catalysts.

[0109] The reaction system is: whole cell bacterial liquid with OD=80, 300mM isoeugenol, and the reaction buffer is a buffer of different pH, namely: 50mM disodium hydrogen phosphate-citric acid buffer with pH=6, 50mM sodium phosphate buffer with pH=7, 50mM dipotassium hydrogen phosphate-potassium dihydrogen phosphate buffer with pH=8, 50mM Tris-HCl buffer with pH=9, 50mM glycine-sodium hydroxide buffer with pH=10, and 50mM glycine-sodium hydroxide buffer with pH=11. The reaction temperature is controlled at 30°C in a water bath, magnetic stirring is used, and the reaction is carried out for 16 hours. The concentration of the product vanillin is detected by gas chromatography. The results are shown in FIG. Figure 3 .

[0110] Depend on Figure 3 It can be seen that the highest enzyme activity measured after the isoeugenol dioxygenase and the mutant of Example 7 were reacted at different pH values ​​was 100%. The experiment showed that the wild-type isoeugenol dioxygenase had the highest yield at pH = 9, while the mutant had the highest yield at pH = 10. According to the pH measurement, the wild-type reacted at pH = 9, while the mutant reacted at pH = 10. The mutant's enzyme activity between pH = 7 and 9 was more stable than that of the wild-type.

[0111] 4. Optimization of conditions for the synthesis of vanillin catalyzed by isoeugenol dioxygenase and its mutants at different substrate concentrations

[0112] The whole cells of the engineered bacteria and mutants thereof capable of expressing isoeugenol dioxygenase constructed and cultured according to Examples 1 to 7 were used as catalysts.

[0113] The reaction system was as follows: whole cell bacterial suspension with OD=10, 20, 40, 80, substrate concentration of 100, 150, 200, 250 mM isoeugenol, pH=9 50 mM Tris-HCl buffer, reaction temperature 30°C, magnetic stirring, reaction for 16 h, and gas chromatography to detect the concentration of product vanillin. The results are shown in Table 1. Figure 4 .

[0114] Depend on Figure 4 It can be seen that with the increase of bacterial concentration, the yield of vanillin gradually increased, and the yield of the mutant was always higher than that of the wild type. The optimal conditions were OD = 80 and substrate concentration 250 mM.

[0115] 5. Determination of kinetic parameters

[0116] The initial velocities of the enzymatic reactions of wild-type isoeugenol dioxygenase and mutant F281D / S283A / F307L were measured using isoeugenol as substrate at pH 9 and 30°C. The kinetic parameters (K M , K CAT , K CAT / K M The kinetic parameters of wild-type NOV1 for isoeugenol were K M is 1.2 mol / L, K CAT 149S -1 , K CAT / K M =127; the kinetic parameters of mutants F281D / S283A / F307L for isoeugenol are K M is 0.8 mol / L, K CAT 269S -1 , K CAT / K M =349.

[0117] The analysis results showed that when isoeugenol was used as substrate, the K M It is 0.7 times that of the wild type, indicating that the mutant has a better affinity with the substrate. CAT The K CAT The value was 1.8 times that of the wild type, and K CAT The increase in indicates that the mutant converts more substrate molecules per unit time, which may be because the mutation of the relevant site increases the catalytic rate of the enzyme on the substrate molecules.

Claims

1. A mutant of isoeugenol dioxygenase, characterized in that The mutant is mutated based on the amino acid sequence shown in SEQ ID NO.1, and the amino acid sequence of the mutant is selected from SEQ ID NO.2 and SEQ ID NOs.4-8.

2. A gene encoding a mutant protein of the isoeugenol dioxygenase according to claim 1.

3. The gene of the mutant protein of isoeugenol dioxygenase according to claim 2, characterized in that The nucleotide sequences of the genes are shown in SEQ ID No. 10 and SEQ ID No. 12-16.

4. A cloning vector or expression vector containing the gene according to claim 2.

5. The method for preparing a mutant of isoeugenol dioxygenase according to claim 1, wherein: The steps include: (1) Designing point mutation primers, using the plasmid carrying the wild-type isoeugenol dioxygenase nucleotide sequence gene SEQ ID NO.9 as a template, and using the point mutation primers to perform PCR reactions respectively, and obtaining the mutant gene fragment and linearized plasmid after purification; (2) Connect the mutant gene fragment to the linearized plasmid to construct an expression vector, and then transfer the expression vector into the host bacteria for induced expression; (3) Collecting the host bacteria expressing the isoeugenol dioxygenase mutant, resuspending the bacteria and breaking the cells, and centrifuging and collecting the supernatant to obtain a crude enzyme solution containing the isoeugenol dioxygenase mutant; The mutation primers are: M216A_F GTATTATTGC GCG ATGCATGATTTTGGCATTACCGAAG; M216A_R CAAAATCATGCATC GCG CAATAATACGGCACTTTAAACCACAC; F281R_F GATAACTGC CGT GCGAGCCATGTGCTGAACGCGTGGCAAG; F281R_R CACATGGCTCGCA CGG CAGTTATCGCGGGTAAACC; F281S_F GATAACTGC TCT GCGAGCCATGTGCTGAACGCGTGGCAAG; F281S_R CACATGGCTCGCA CCG CAGTTATCGCGGGTAAACC; F281D_F GATAACTGC GAT GCGAGCCATGTGCTGAACGCGTGGCAAG; F281D_R CACATGGC TCG CATCGCAGTTATCGCGGGGTAAACC; S283A_F CTGCTTTGCG GC CCATGTGCTGAACGCGTGGCAAGAAG; S283A_R CAGCACATGG GC CGCAAAGCAGTTATCGCGGGTAAACCAG; F307L_F GAAAAACAACATG TTA CCGTTTTTTCCGGATGTGCATGGC; F307L_R GAAAAAACGG GAA CATGTTGTTTTTCGCTTCGCAGGTCAC。 6. The method for preparing the mutant of isoeugenol dioxygenase according to claim 5, characterized in that: The PCR reaction system consists of 10× Buffer for KOD-Plus-, 2 mM dNTP, and 25 mM MgSO 4、 DMSO, 10 pmol / μL Forward Primer, 10 pmol / μL Reverse Primer, DNA template, KOD-Plus-, ddH2O, with volumes of 2.5 μL, 2.5 μL, 1.5 μL, 1 μL, 0.75 μL, 0.75 μL, <100 ng, 1 μL, up to 25 μL, respectively.

7. Use of the mutant of isoeugenol dioxygenase according to claim 1 in biocatalytic synthesis of vanillin.

8. The use according to claim 7, wherein the method comprises: using isoeugenol as a substrate to catalyze the synthesis of vanillin under the conditions of a pH range of 7-10 and a temperature range of 15-35°C.