Programmable bicontinuous material based on DNA (deoxyribonucleic acid) aggregate as well as preparation method and application of programmable bicontinuous material

Abstract

The invention belongs to the technical field of nano materials, and relates to a programmable bicontinuous material based on DNA (deoxyribonucleic acid) aggregate as well as a preparation method and application of the programmable bicontinuous material. The programmable bicontinuous material is formed by bridging a double-stranded DNA structure with a DNA liquid drop A and a DNA liquid drop B; a 18bp double-stranded structure is arranged in the middle of the double-stranded DNA structure, and sticky ends are arranged at two ends of the double-stranded DNA structure; each of the DNA liquid drop A and the DNA liquid drop B has a Y-type DNA nano-structure, and each Y-type DNA nano-structure has a double-stranded stem structure and a cohesive end; each of the DNA liquid drop A and the DNA liquid drop B is formed by complementary hybridization of three single-stranded DNAs, two unpaired spacer bases are arranged in the middle of each single-stranded DNA, and two ends of each single-stranded DNA are cohesive ends; the programmable bicontinuous material provided by the invention has good thermal stability, fluidity, permeability, uniformity and high controllability, and all reaction steps can be completed within one hour.

Description

Technical Field

[0001] The invention belongs to the technical field of nanomaterials, and in particular relates to a programmable bicontinuous material based on DNA condensates, and a preparation method and application thereof. Background Art

[0002] Bicontinuous materials have fascinating microstructures and are found at all scales in nature. The macroscopic bicontinuous structures of marine corals achieve an optimal balance between connectivity and surface area for nutrient absorption; the smoothness of the bicontinuous microstructures of sea urchins gives them excellent mechanical properties. At the nanoscale, bicontinuous structures in bird feathers produce beautiful structural colors. The unique topology, smooth morphology, and large surface area of ​​these composites have inspired the development of synthetic mimics for applications such as catalysis, energy storage, cargo delivery and release, as well as nanoreactors and biomolecule selection. Therefore, the formation of bicontinuous materials is crucial to the function of various natural and synthetic systems. The bicontinuous structure facilitates the efficient diffusion of substances into the interior of the material, thereby improving the utilization of active sites. In addition, the ordered bicontinuous structure endows the material with excellent optical and magnetic properties, including tunable photonic band gaps, negative refraction, and multiple equivalent magnetization configurations. These attractive structural advantages and physical properties have inspired scientists to develop strategies for preparing bicontinuous structured materials. Despite this, there are still fundamental challenges in the precise control of the microstructure of bicontinuous materials.

[0003] The synthesis of bicontinuous materials is currently based on two approaches: stagnant phase separation or self-assembly of block copolymers. The former is attractive for its chemical simplicity, the latter for its thermodynamic stability. Although block copolymer self-assembly provides strong control of bicontinuous structures at the macromolecular scale, it cannot produce strong structures at scales much larger than the block copolymers themselves. In contrast, stagnant phase separation uses simpler chemical reactions and easily produces structures with sizes far beyond the macromolecular scale, but easily compromises the uniformity of the bicontinuous structure. Therefore, it remains a major challenge to create new bicontinuous materials with uniform microstructures, controllable at the molecular scale, and excellent mechanical properties. Summary of the invention

[0004] The purpose of the present invention is to overcome the deficiencies in the prior art and to provide a programmable bicontinuous material based on DNA condensates and a preparation method and application thereof.

[0005] In order to achieve the purpose of the present invention, the present invention is implemented by adopting the following technical solutions.

[0006] A programmable double-continuous material based on DNA condensates is formed by a double-stranded DNA structure 2LAB linker bridging a DNA droplet A YA-motif and a DNA droplet B YB-motif; wherein:

[0007] The double-stranded DNA structure 2LAB linker has a double-stranded structure of 18 bp in the middle and sticky ends of 8 nt in length at both ends;

[0008] The DNA droplet A YA-motif and the DNA droplet B YB-motif both have a Y-shaped DNA nanostructure, and the Y-shaped DNA nanostructure has a double-stranded stem structure with a length of 16 bp and a sticky end with a length of 8 nt;

[0009] The DNA droplet A YA-motif is formed by complementary hybridization of three single-stranded DNAs YA-1, YA-2 and YA-3, and each single-stranded DNA has two unpaired spacer bases in the middle and both ends are sticky ends;

[0010] The DNA droplet BYB-motif is formed by complementary hybridization of three single-stranded DNAs YB-1, YB-2 and YB-3, and each single-stranded DNA has two unpaired spacer bases in the middle and both ends are sticky ends.

[0011] As a preferred embodiment of the present invention, the sticky end of each single strand of DNA droplet A or DNA droplet B has the same palindromic sequence, and the ends of the two single strands of the double-stranded DNA structure have the same palindromic sequence as DNA droplet A and DNA droplet B, respectively.

[0012] As a preferred embodiment of the present invention, the 5' end of any single-stranded DNA among the three single-stranded DNAs YA-1, YA-2 and YA-3 is modified with a Cy5 or Cy3 fluorescent group, i.e., YA_Cy5 or YA_Cy3; the 5' end of any single-stranded DNA among the three single-stranded DNAs YB-1, YB-2 and YB-3 is modified with a Cy5 or Cy3 fluorescent group, i.e., YB_Cy5 or YB_Cy3.

[0013] As a preferred embodiment of the present invention, the sequence of the YA_Cy3 or YA_Cy5 is 5'-GCTGTGGACACGTTGATTTGATCACTACCAGGTC-3'; the sequence of the YB_Cy5 or YB_Cy3 is 5'-GCTCACGTTGGATCACTTCTATGACCTGACACAC-3'.

[0014] As a preferred embodiment of the present invention, the YA-1 sequence is 5'-GCTCGAGCGACCTGGTAGTGATCATTGTACTGCGAACGGTAG-3'; the YA-2 sequence is 5'-GCTCGAGCGCTGTGGACACGTTGATTTGATCACTACCAGGTC-3'; and the YA-3 sequence is 5'-GCTCGAGCCTACCGTTCGCAGTACTTTCAACGTGTCCACAGC-3'.

[0015] As a preferred embodiment of the present invention, the YB-1 sequence is 5'-CTCGCGAGGTGTGTCAGGTCATAGTTACAGGAGGTGAGAGTG-3'; the YB-2 sequence is 5'-CTCGCGAGGCTCACGTTGGATCACTTCTATGACCTGACACAC-3'; and the YB-3 sequence is 5'-CTCGCGAGCACTCTCACCTCCTGTTTGTGATCCAACGTGAGC-3'.

[0016] As a preferred embodiment of the present invention, the 2LAB linker sequences are 5'-GCTCGAGCGTGATCTCATACCTGACA-3' and 5'-CTCGCGAGTGTCAGGTATGAGATCAC-3' respectively.

[0017] A method for preparing a programmable bicontinuous material based on DNA condensates comprises the following steps:

[0018] S81, respectively setting up the assembly systems of DNA droplet A and DNA droplet B: adding a certain amount of single-stranded DNA: YA-1, YA-2 and YA-3 or YB-1, YB-2 and YB-3 to the 1×Annealing buffer reaction system, so that the final concentration of YA-1, YA-2, YA-3 or YB-1, YB-2, YB-3 is set to 5.0 μM;

[0019] S82, DNA droplet A YA-motif and DNA droplet B YB-motif assembly process: The three single-stranded DNAs YA-1, YA-2 and YA-3 and the three single-stranded DNAs YB-1, YB-2 and YB-3 in the assembly system are assembled into YA-motif and YB-motif respectively by gradient annealing or 37°C constant temperature reaction, and the DNA droplet A YA-motif and DNA droplet B YB-motif are formed by liquid-liquid phase separation. The annealing conditions are incubation at 95°C for 5 min, annealing at 20°C / min to 25°C, and storage at 4°C.

[0020] S83. Construct double-stranded DNA structure 2LAB linker assembly system: add a certain amount of single-stranded DNA into the 1× Annealing buffer reaction system, and the final concentration of each single-stranded DNA of the double-stranded linker (2LAB) is 20 μM;

[0021] S84, double-stranded DNA structure 2LAB linker assembly process: placing the double-stranded DNA structure 2LAB linker assembly system in a PCR instrument for gradient annealing to assemble into a double-stranded DNA structure 2LAB linker, the annealing program is: incubate at 85°C for 5 minutes, decrease 0.1°C per second, set 600 cycles, slowly cool to 25°C, and store the annealed product in a 4°C refrigerator for later use;

[0022] S85. The formation process of programmable bicontinuous materials based on DNA condensates: the assembled DNA droplet AYA-motif, DNA droplet B YB-motif and double-stranded DNA structure 2LAB linker are mixed, and NaCI solution is added to the mixed system to make its final concentration 350mM; the final concentrations of DNA droplet A YA-motif, DNA droplet B YB-motif and double-stranded DNA structure 2LAB linker are 2μM respectively, and the DNA droplet A YA-motif, DNA droplet B YB-motif and double-stranded DNA structure 2LAB linker are incubated at 37°C for 30min to form a programmable bicontinuous material based on DNA condensates.

[0023] As a preferred embodiment of the present invention, one single-stranded DNA is optionally modified with Cy5 or Cy3 fluorescent group among the three single-stranded DNAs YA-1, YA-2 and YA-3 in step S1, and added to the system at a molar ratio of 10%; and one single-stranded DNA is optionally modified with Cy5 or Cy3 fluorescent group among the three single-stranded DNAs YB-1, YB-2 and YB-3, and added to the system at a molar ratio of 10%; and the final concentration of the selected single-stranded DNA is adjusted.

[0024] Application of a programmable bicontinuous material based on DNA condensates in selective enrichment of streptavidin, wherein the preparation method of the programmable bicontinuous material comprises the following steps:

[0025] S101, respectively set up the assembly system of DNA droplet A: add a certain amount of single-stranded DNA: YA-1, YA-2 and YA-3 or YB-1, YB-2 and YB-3 to the 1×Annealing buffer reaction system, so that the final concentration of YA-1, YA-2, YA-3 or YB-1, YB-2, YB-3 is set to 5.0 μM; select one single-stranded DNA from the three single-stranded DNAs of YA-1, YA-2 and YA-3 to modify the biotin molecule, and add it to the system at a molar ratio of 10%, that is, the final concentration is 0.5 μM; and reduce the final concentration of the selected single-stranded DNA to 4.5 μM;

[0026] S102, assembly process of DNA droplet A YA-motif and DNA droplet B YB-motif: three single-stranded DNAs YA-1, YA-2 and YA-3 and three single-stranded DNAs YB-1, YB-2 and YB-3 in the assembly system are assembled into YA-motif and YB-motif respectively by gradient annealing or constant temperature reaction at 37°C, and DNA droplet A YA-motif and DNA droplet B YB-motif are formed by liquid-liquid phase separation. The annealing conditions are incubation at 95°C for 5 min, annealing at 20°C / min to 25°C, and storage at 4°C.

[0027] S103. Constructing a double-stranded DNA structure 2LAB linker assembly system: adding a certain amount of single-stranded DNA into the 1× Annealing buffer reaction system, the final concentration of each single-stranded DNA of the double-stranded linker (2LAB) is 20 μM;

[0028] S104, double-stranded DNA structure 2LAB linker assembly process: placing the double-stranded DNA structure 2LAB linker assembly system in a PCR instrument for gradient annealing to assemble into a double-stranded DNA structure 2LAB linker, the annealing program is: incubate at 85°C for 5 minutes, decrease by 0.1°C per second, set 600 cycles, slowly cool to 25°C, and store the annealed product in a 4°C refrigerator for later use;

[0029] S105, the formation process of programmable bicontinuous material based on DNA condensate: the assembled DNA droplet AYA-motif, DNA droplet BYB-motif and double-stranded DNA structure 2LAB linker are mixed, and NaCI solution is added to the mixed system to make the final concentration of 350mM; the final concentrations of DNA droplet A YA-motif, DNA droplet B YB-motif and double-stranded DNA structure 2LAB linker are 2μM respectively, and the DNA droplet A YA-motif, DNA droplet B YB-motif and double-stranded DNA structure 2LAB linker are incubated at 37°C for 30min to form a programmable bicontinuous material based on DNA condensate;

[0030] S106. Mix the streptavidin molecule labeled with FITC fluorescent group with the DNDNA droplet A and incubate at a constant temperature of 37°C.

[0031] As a preferred embodiment of the present invention, the 3' end of the selected single-stranded DNA is modified with a biotin molecule, namely YA-2_Biotin, to serve as a binding site for streptavidin.

[0032] As a preferred embodiment of the present invention, the sequence of the YA-2_Biotin is 5'-GCTCGAGCGCTGTGGACACGTTGATTTGATCACTACCAGGTC-3'.

[0033] As a preferred embodiment of the present invention, one single-stranded DNA is optionally modified with Cy5 or Cy3 fluorescent group from the three single-stranded DNAs YA-1, YA-2 and YA-3 in step S101, and added to the system at a molar ratio of 10%, that is, the final concentration is 0.5 μM, and the final concentration of the selected single-stranded DNA is adjusted to 4.5 μM; and one single-stranded DNA is optionally modified with Cy5 or Cy3 fluorescent group from the three single-stranded DNAs YB-1, YB-2 and YB-3, and added to the system at a molar ratio of 10%, that is, the final concentration is 0.5 μM; and the final concentration of the selected single-stranded DNA is adjusted to 4.5 μM.

[0034] Beneficial Effects

[0035] 1. The programmable bicontinuous material based on DNA condensates provided by the present invention has good thermal stability, fluidity, permeability, uniformity and high controllability, and is simple to prepare and reacts quickly. All reaction steps can be completed within one hour, which is superior to the traditional method for preparing bicontinuous materials;

[0036] 2. The programmable bicontinuous material based on DNA condensates provided by the present invention is assembled into bicontinuous microstructures with different particle sizes and different shapes by designing specific DNA sequences, so that the formation of the bicontinuous material can be regulated at the molecular level;

[0037] 3. The programmable bicontinuous material based on DNA condensates provided by the present invention can specifically enrich biological macromolecules, such as streptavidin, through chemically modified DNA sequences, to achieve cargo transportation and distribution. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 (a) is a schematic diagram of the preparation process of DNA droplets based on the YA-motif structure, and (b) is a gel electrophoresis characterization of the YA-motif structure;

[0039] Figure 2 This is a result diagram of the Y-shaped DNA nanostructure of the present invention being assembled into a DNA condensate structure at 37°C;

[0040] Figure 3 The Y-shaped DNA nanostructure of the present invention is gradient annealed and assembled into a DNA condensate structure under the action of a double-stranded DNA linker, wherein: (a) and (c) are characterization diagrams of the formation of two droplets without a linker; (b) and (d) are characterization diagrams of the double continuous structure when the concentration ratio of the two droplets to the linker is 2:2:2;

[0041] Figure 4 The schematic diagram of the principle of selective enrichment of streptavidin in the DNA condensate bicontinuous material of the present invention, wherein: (a) is a schematic diagram of the design principle of the condensate bicontinuous material capturing streptavidin; (b) is a schematic diagram of the selective enrichment of streptavidin in the DNA condensate bicontinuous material;

[0042] Figure 5 The fluorescence images and fluorescence co-localization analysis of the distribution of streptavidin in the DNA condensate bicontinuous material of the present invention, wherein: (a) and (b) are the fluorescence images and fluorescence co-localization analysis diagrams of the distribution of streptavidin in two DNA droplet unassembled states, respectively, with a scale bar of 5 μm; (c) and (d) are the fluorescence images and fluorescence co-localization analysis diagrams of the distribution of streptavidin in two DNA droplet assembled states, respectively, with a scale bar of 5 μm. DETAILED DESCRIPTION

[0043] The present invention will be further described with reference to the accompanying drawings and embodiments.

[0044] As an embodiment of the present invention, Figure 1 and Figure 2As shown, experiments and observations were conducted on the constant temperature assembly of Y-shaped DNA nanostructures into DNA condensate structures. The specific steps are as follows:

[0045] Step 1: Design and analyze DNA sequences using NUPACK software and IDT website. DNA molecules without modification groups were purified by enhanced polyacrylamide gel electrophoresis (UltraPAGE), and modified DNA molecules were purified by high performance liquid chromatography (HPLC). All single-stranded DNA was measured by MALDI-TOF mass spectrometry by Sangon Biotech Co., Ltd.

[0046] YA-1_4: 5'-GCGCGACCTGGTAGTGATCATTGTACTGCGAACGGTAG-3';

[0047] YA-2_4: 5'-GCGCCGTTGTGGACACGTTGATTTGATCACTACCAGGTC-3';

[0048] YA-3_4: 5'-GCGCCTACCGTTCGCAGTACTTTCAACGTGTCCACAGC-3';

[0049] YA-2_4_Cy3: 5'-[Cy3]-GCTGTGGACACGTTGATTTGATCACTACCAGGTC-3';

[0050] YB-1_4: 5'-GGCCGTGTGTCAGGTCATAGTTACAGGAGGTGAGAGTG-3';

[0051] YB-2_4: 5'-GGCCGCTCACGTTGGATCACTTCTATGACCTGACACAC-3';

[0052] YB-3_4: 5'-GGCCCACTCTCACCTCCTGTTTGTGATCCAACGTGAGC-3';

[0053] YB-2_4_Cy5: 5'-[Cy5]-GCTGTGGACACGTTGATTTGATCACTACCAGGTC-3';

[0054] 2LAB-1_4:GCGCTGTCAGGTATGAGATCAC;

[0055] 2LAB-2_4:GGCCGTGATCTCATACCTGACA;

[0056] Step 2: Use ultrapure water to dissolve the DNA solid powder to a final concentration of about 100 μM. The dissolved DNA chain stock solution is quantified by UV spectrophotometry, and its mass concentration (ng / μL) is read using an ultra-micro UV spectrophotometer. Use ultrapure water as a blank control, take the average value of three quantifications, and convert the mass concentration (ng / μL) into molar concentration (mol / L) according to the molecular weight of the single-stranded DNA identified by the synthesis company. The quantified DNA chain stock solution is packaged in 1.5mL EP tubes and stored in a -20°C refrigerator to avoid repeated freezing and thawing.

[0057] Step 3: Assemble the three chains YA-1_4 / YB-1_4, YA-2_4 / YB-2_4, YA-3_4 / YB-3_4 and the fluorescent modified chain YA-2_4_Cy3 / YB-2_4_Cy5 constituting the YA-motif / YB-motif at 37°C, make them complementary and hybridize to form a Y-shaped DNA nanostructure, and undergo liquid-liquid phase separation to form condensate droplets, such as Figure 1 (a) and (b). The reaction system was set to 50 μL, and a certain amount of single-stranded DNA was added to the 1×Annealing buffer reaction system (containing 200 mM Tris-HCl, 350 mM NaCl, 1×TE) to make the final concentration of YA-1_4 / YB-1_4 and YA-3_4 / YB-3_4 5.0 μM, and YA-2_4_Cy3 / YB-2_4_Cy5 was added to the system at a molar ratio of 10%, so the final concentration of YA-2_4 / YB-2_4 was 4.5 μM.

[0058] Step 4: Set the assembly system of 2LAB linker to 20 μL, add a certain amount of single-stranded DNA into the 1×Annealing buffer reaction system (containing 200 mM Tris-HCl, 350 mM NaCl, 1×TE), and the final concentration of each single-stranded DNA of the double-stranded linker (2LAB) is 30 μM.

[0059] Step 5: Place the 2LAB linker assembly system in a PCR instrument for gradient annealing. The annealing program is: incubate at 85°C for 5 minutes, decrease by 0.1°C per second, set 600 cycles, slowly cool to 25°C, and store the annealed product in a 4°C refrigerator for later use.

[0060] Step 6: Mix the assembled DNA droplet A, DNA droplet B and 2LAB linker, add a certain amount of NaCI solution to the system to make its final concentration 350mM; the final concentrations of DNA droplet A, DNA droplet B and 2LAB linker are 2μM respectively, and the total reaction system is 30μL. The above components are incubated at 37°C for 30min to form a programmable bicontinuous material based on DNA condensates.

[0061] Step 7: For DNA droplets prepared with YA-motif / YB-motif structures, in order to characterize the DNA droplet samples under a laser confocal microscope, the 5' end of one of the component chains of the DNA droplet is modified with a Cy3 or Cy5 fluorescent group. The DNA droplet samples prepared by gradient annealing are diluted appropriately with 1×Annealing buffer for imaging observation. The diluted sample is added to the center of the confocal dish and imaged using an oil objective with a magnification of 63×. The Cy3 fluorescent group (excitation wavelength: 550nm; emission wavelength: 570nm) is excited with a 543nm laser, and the fluorescence signal is collected in the range of 560-580nm; the Cy5 fluorescent group is excited with a 633nm laser, and the fluorescence signal is collected in the range of 660-680nm. The image is recorded in the "best signal" shooting mode, as shown in Figure 2. Figure 2 shown.

[0062] As an embodiment of the present invention, Figure 3 As shown, experiments and observations were conducted on the assembly of gradient annealed Y-shaped DNA nanostructures to form DNA condensate structures.

[0063] Step 1: Design and analyze DNA sequences using NUPACK software and IDT website. DNA molecules without modification groups were purified by enhanced polyacrylamide gel electrophoresis (UltraPAGE), and modified DNA molecules were purified by high performance liquid chromatography (HPLC). All single-stranded DNA was measured by MALDI-TOF mass spectrometry by Sangon Biotech Co., Ltd.

[0064] YA-1_8: 5'-GCTCGAGCGACCTGGTAGTGATCATTGTACTGCGAACGGTAG-3';

[0065] YA-2_8: 5'-GCTCGAGCGCTGTGGACACGTTGATTTGATCACTACCAGGTC-3';

[0066] YA-3_8: 5'-GCTCGAGCCTACCGTTCGCAGTACTTTCAACGTGTCCACAGC-3';

[0067] YA-2_8_Cy3: 5'-[Cy3]-GCTGTGGACACGTTGATTTGATCACTACCAGGTC-3';

[0068] YB-1_8: 5'-CTCGCGAGGTGTGTCAGGTCATAGTTACAGGAGGTGAGAGTG-3';

[0069] YB-2_8: 5'-CTCGCGAGGCTCACGTTGGATCACTTCTATGACCTGACACAC-3';

[0070] YB-3_8: 5'-CTCGCGAGCACTCTCACCTCCTGTTTGTGATCCAACGTGAGC-3';

[0071] YB-2_8_Cy5: 5'-[Cy5]-GCTCACGTTGGATCACTTCTATGACCTGACACAC-3';

[0072] 2LAB-1_8:5'-GCTCGAGCGTGATCTCATACCTGACA-3';

[0073] 2LAB-2_8:5'-CTCGCGAGTGTCAGGTATGAGATCAC-3';

[0074] Step 2: Use ultrapure water to dissolve the DNA solid powder to a final concentration of about 100 μM. The dissolved DNA chain stock solution is quantified by UV spectrophotometry, and its mass concentration (ng / μL) is read using an ultra-micro UV spectrophotometer. Use ultrapure water as a blank control, take the average value of three quantifications, and convert the mass concentration (ng / μL) into molar concentration (mol / L) according to the molecular weight of the single-stranded DNA identified by the synthesis company. The quantified DNA chain stock solution is divided into 1.5mL EP tubes and stored in a -20°C refrigerator.

[0075] Step 3: Take a 200 μL EP tube, set the droplet assembly system to 60 μL, add a certain amount of single-stranded DNA to the 1×Annealing buffer reaction system (containing 200 mM Tris-HCl, 350 mM NaCl, 1×TE) to make the final concentration of YA-1_8 / YB-1_8 and YA-3_8 / YB-3_8 5.0 μM, and YA-2_8_Cy3 / YB-2_8_Cy5 is added to the system at a molar ratio of 10%, so the final concentration of YA-2_8 / YB-2_8 is 4.5 μM.

[0076] Step 4: Gradient annealing of the three chains YA-1_8 / YB-1_8, YA-2_8 / YB-2_8, YA-3_8 / YB-3_8 and the fluorescent modified chain YA_8_Cy3 / YB_8_Cy5 constituting the YA-motif and YB-motif; annealing conditions are 95°C for 5 min, 20°C / min annealing to 25°C, and storage at 4°C. The single chain modified with Cy3 / Cy5 fluorescent groups is added to the system at a ratio of 10%.

[0077] Step 5: Set the assembly system of 2LAB linker to 20 μL, add a certain amount of single-stranded DNA into the 1×Annealing buffer reaction system (containing 200 mM Tris-HCl, 350 mM NaCl, 1×TE), and the final concentration of each single-stranded DNA of the double-stranded linker (2LAB) is 20 μM.

[0078] Step 6: Place the 2LAB linker assembly system in a PCR instrument for gradient annealing. The annealing program is: incubate at 85°C for 5 minutes, decrease by 0.1°C per second, set 600 cycles, slowly cool to 25°C, and store the annealed product in a 4°C refrigerator for later use.

[0079] Step 7: Mix the assembled DNA droplet A, DNA droplet B and 2LAB linker, add a certain amount of NaCI solution to the system to make its final concentration 350mM; the final concentrations of DNA droplet A, DNA droplet B and 2LAB linker are 2μM respectively, and the total reaction system is 25μL. The above components are incubated at 37°C for 30min to form a programmable bicontinuous material based on DNA condensates.

[0080] Step 8: The DNA droplet samples prepared by constant temperature assembly are diluted appropriately for imaging observation. The diluted samples are added to the center of the confocal dish and imaged using an oil objective with a magnification of 63×. The Cy3 fluorescent group (excitation wavelength: 550nm; emission wavelength: 570nm) is excited by a 543nm laser, and the fluorescence signal is collected in the range of 560-580nm; the Cy5 fluorescent group is excited by a 633nm laser, and the fluorescence signal is collected in the range of 660-680nm. The image is recorded in the "best signal" shooting mode. Figure 3 Figures (a) and (c) show the characterization of the formation of two types of droplets under linker-free conditions; Figure 3 Figures (b) and (d) are characterization diagrams of the bicontinuous structure when the concentration ratio of the two droplets to the linker is 2:2:2.

[0081] As an embodiment of the present invention, Figure 4 and Figure 5As shown, experiments and confocal observations were performed on the specific enrichment of streptavidin by programmable DNA condensate-based bicontinuous materials.

[0082] Step 1: Design and analyze DNA sequences using NUPACK software and IDT website. DNA molecules without modification groups were purified by enhanced polyacrylamide gel electrophoresis (UltraPAGE); DNA molecules modified with Cy3, Cy5 or biotin were purified by high performance liquid chromatography (HPLC). All single-stranded DNA was determined by MALDI-TOF mass spectrometry by Sangon Biotech Co., Ltd.

[0083] YA-1_8: 5'-GCTCGAGCGACCTGGTAGTGATCATTGTACTGCGAACGGTAG-3';

[0084] YA-2_8: 5'-GCTCGAGCGCTGTGGACACGTTGATTTGATCACTACCAGGTC-3';

[0085] YA-3_8: 5'-GCTCGAGCCTACCGTTCGCAGTACTTTCAACGTGTCCACAGC-3';

[0086] YA-2_8_Cy3: 5'-[Cy3]-GCTGTGGACACGTTGATTTGATCACTACCAGGTC-3';

[0087] YA-2_8_Biotin:5'-GCTCGAGCGCTGTGGACACGTTGATTTGATCACTACCAGGTC-[Biotin]-3';

[0088] YB-1_8: 5'-CTCGCGAGGTGTGTCAGGTCATAGTTACAGGAGGTGAGAGTG-3';

[0089] YB-2_8: 5'-CTCGCGAGGCTCACGTTGGATCACTTCTATGACCTGACACAC-3';

[0090] YB-3_8: 5'-CTCGCGAGCACTCTCACCTCCTGTTTGTGATCCAACGTGAGC-3';

[0091] YB-2_8_Cy5: 5'-[Cy5]-GCTCACGTTGGATCACTTCTATGACCTGACACAC-3';

[0092] 2LAB-1_8:5'-GCTCGAGCGTGATCTCATACCTGACA-3';

[0093] 2LAB-2_8:5'-CTCGCGAGTGTCAGGTATGAGATCAC-3';

[0094] Step 2: Use ultrapure water to dissolve the DNA solid powder to a final concentration of about 100 μM. The dissolved DNA chain stock solution is quantified by UV spectrophotometry, and its mass concentration (ng / μL) is read using an ultra-micro UV spectrophotometer. Use ultrapure water as a blank control, take the average value of three quantifications, and convert the mass concentration (ng / μL) into molar concentration (mol / L) according to the molecular weight of the single-stranded DNA identified by the synthesis company. The quantified DNA chain stock solution is divided into 1.5mL EP tubes and stored in a -20°C refrigerator.

[0095] Step 3: Take a 200 μL EP tube, set the droplet assembly system to 60 μL, add a certain amount of single-stranded DNA to the 1×Annealing buffer reaction system (containing 200 mM Tris-HCl, 350 mM NaCl, 1×TE), so that the final concentration of YA-1_8 / YB-1_8 and YA-3_8 / YB-3_8 is 5.0 μM, YA-2_8_Cy3 / YB-2_8_Cy5 is added to the system at a molar ratio of 10%, and YA-2_8_Biotin is also added to the system at a molar ratio of 10%, so the final concentration of YA-2_8 / YB-2_8 is 4.0 μM.

[0096] Step 4: Gradient annealing of the three chains YA-1_8 / YB-1_8, YA-2_8 / YB-2_8, YA-3_8 / YB-3_8 and the fluorescent modified chain YA_8_Cy3 / YB_8_Cy5 constituting the YA-motif and YB-motif respectively; a certain proportion (10%) of the biotin modified chain YA-2_8_Biotin needs to be added to the DNA droplet A. The annealing conditions are incubation at 95°C for 5 minutes, annealing at 20°C / min to 25°C, and storage at 4°C, so that the complementary hybridization forms a Y-shaped DNA nanostructure, and liquid-liquid phase separation occurs to form a condensate droplet. Single chains modified with Cy3 / Cy5 fluorescent groups and biotin groups are added to the system at a ratio of 10%.

[0097] Step 5: Set the assembly system of 2LAB linker to 20 μL, add a certain amount of single-stranded DNA into the 1×Annealing buffer reaction system (containing 200 mM Tris-HCl, 350 mM NaCl, 1×TE), and the final concentration of each single-stranded DNA of the double-stranded linker (2LAB) is 20 μM.

[0098] Step 6: Place the 2LAB linker assembly system in a PCR instrument for gradient annealing. The annealing program is: incubate at 85°C for 5 minutes, decrease by 0.1°C per second, set 600 cycles, slowly cool to 25°C, and store the annealed product in a 4°C refrigerator for later use.

[0099] Step 7: Mix the assembled DNA droplet A, DNA droplet B and 2LAB linker, add a certain amount of NaCI solution to the system to make its final concentration 350mM; the final concentrations of DNA droplet A, DNA droplet B and 2LAB linker are 2μM respectively, and the total reaction system is 25μL. The above components are incubated at 37°C for 30min to form a programmable bicontinuous material based on DNA condensates.

[0100] Step 8: Mix the streptavidin molecule labeled with FITC fluorescent group with DNA droplet A, with the concentration ratio of biotin to streptavidin being 5:1, and incubate at a constant temperature for 15-20 minutes. Figure 4 As shown in (a) and (b) in the figure. The selective enrichment effect of streptavidin was characterized by Zeiss laser confocal microscopy. The FITC fluorescent group was excited by 488nm laser, and the fluorescent signal was collected in the range of 510-550nm; the Cy3 fluorescent group was excited by 543nm laser, and the fluorescent signal was collected in the range of 560-580nm; the Cy5 fluorescent group was excited by 633nm laser, and the fluorescent signal was collected in the range of 660-680nm; Figure 5 Figures (a) and (b) show the fluorescence images of streptavidin distribution in two unassembled states of DNA droplets and the results of fluorescence co-localization analysis, respectively; Figure 5 Figures (c) and (d) show the fluorescence images of the distribution of streptavidin in two DNA droplet assembly states and the results of fluorescence co-localization analysis, respectively.

[0101] The preferred embodiments of the present invention are described above with reference to the accompanying drawings, but the scope of the rights of the present invention is not limited thereto. Any modification, equivalent substitution and improvement made by a person skilled in the art without departing from the scope and essence of the present invention should be within the scope of the rights of the present invention.

Claims

1. A programmable bicontinuous material based on DNA condensates, characterized in that: The programmable double continuous material is formed by a double-stranded DNA structure 2LAB linker bridging a DNA droplet A YA-motif and a DNA droplet B YB-motif; wherein: The double-stranded DNA structure 2LAB linker has a double-stranded structure of 18 bp in the middle and sticky ends of 8 nt in length at both ends; The DNA droplet A YA-motif and the DNA droplet B YB-motif both have a Y-shaped DNA nanostructure, and the Y-shaped DNA nanostructure has a double-stranded stem structure with a length of 16 bp and a sticky end with a length of 8 nt; The DNA droplet A YA-motif is formed by complementary hybridization of three single-stranded DNAs YA-1, YA-2 and YA-3, and each single-stranded DNA has two unpaired spacer bases in the middle and both ends are sticky ends; The DNA droplet BYB-motif is formed by complementary hybridization of three single-stranded DNAs YB-1, YB-2 and YB-3, and each single-stranded DNA has two unpaired spacer bases in the middle and both ends are sticky ends.

2. A programmable bicontinuous material based on DNA condensates according to claim 1, characterized in that: The end of each single-stranded DNA in the DNA droplet is designed with the same palindromic sequence, and the two single-stranded DNA ends of the double-stranded structure have the same palindromic sequence as the DNA droplet A and the DNA droplet B, respectively.

3. A programmable bicontinuous material based on DNA condensates according to claim 1, characterized in that: The 5' end of any single-stranded DNA of YA-1, YA-2 and YA-3 is modified with Cy5 or Cy3 fluorescent group, i.e. YA_Cy5 or YA_Cy3; the 5' end of any single-stranded DNA of YB-1, YB-2 and YB-3 is modified with Cy5 or Cy3 fluorescent group, i.e. YB_Cy5 or YB_Cy3.

4. The programmable bicontinuous material based on DNA condensates according to claim 3, characterized in that: The sequence of the YA_Cy3 or YA_Cy5 is 5'-GCTGTGGACACGTTGATTTGATCACTACCAGGT C-3'; The sequence of the YB_Cy5 or YB_Cy3 is 5'-GCTCACGTTGGATCACTTCTATGACCTGACACA C-3'.

5. The programmable bicontinuous material based on DNA condensates according to claim 1, characterized in that: The YA-1 sequence is 5'-GCTCGAGCGACCTGGTAGTGATCATTGTACTGCGAACGGTAG-3'; The YA-2 sequence is 5'-GCTCGAGCGCTGTGGACACGTTGATTTGATCACTACCAGGTC-3'; The YA-3 sequence is 5'-GCTCGAGCCTACCGTTCGCAGTACTTTCAACGTGTCCACAGC-3'.

6. The programmable bicontinuous material based on DNA condensates according to claim 1, characterized in that: The YB-1 sequence is 5'-CTCGCGAGGTGTGTCAGGTCATAGTTACAGGAGGTGAGAGTG-3'; The YB-2 sequence is 5'-CTCGCGAGGCTCACGTTGGATCACTTCTATGACCTGACACAC-3'; The YB-3 sequence is 5'-CTCGCGAGCACTCTCACCTCCTGTTTGTGATCCAACGTGAGC-3'.

7. The programmable bicontinuous material based on DNA condensates according to claim 1, characterized in that: The 2LAB linker sequences are 5'-GCTCGAGCGTGATCTCATACCTGACA-3' and 5'-CTCGCGAGTGTCAGGTATGAGATCAC-3' respectively.

8. A method for preparing a programmable bicontinuous material based on DNA condensates, characterized in that: The steps include: S81, respectively setting up the assembly systems of DNA droplet A and DNA droplet B: adding a certain amount of single-stranded DNA: YA-1, YA-2 and YA-3 or YB-1, YB-2 and YB-3 to the 1×Annealing buffer reaction system, so that the final concentration of YA-1, YA-2, YA-3 or YB-1, YB-2, YB-3 is set to 5.0 μM; S82, DNA droplet A YA-motif and DNA droplet B YB-motif assembly process: The three single-stranded DNAs YA-1, YA-2 and YA-3 and the three single-stranded DNAs YB-1, YB-2 and YB-3 in the assembly system are assembled into YA-motif and YB-motif respectively by gradient annealing or 37°C constant temperature reaction, and the DNA droplet A YA-motif and DNA droplet BYB-motif are formed by liquid-liquid phase separation. The annealing conditions are incubation at 95°C for 5 min, annealing at 20°C / min to 25°C, and storage at 4°C. S83. Construct double-stranded DNA structure 2LAB linker assembly system: add a certain amount of single-stranded DNA into the 1× Annealing buffer reaction system, and the final concentration of each single-stranded DNA of the double-stranded linker (2LAB) is 20 μM; S84, double-stranded DNA structure 2LAB linker assembly process: placing the double-stranded DNA structure 2LAB linker assembly system in a PCR instrument for gradient annealing to assemble into a double-stranded DNA structure 2LAB linker, the annealing program is: incubate at 85°C for 5 minutes, decrease 0.1°C per second, set 600 cycles, slowly cool to 25°C, and store the annealed product in a 4°C refrigerator for later use; S85. The formation process of programmable bicontinuous materials based on DNA condensates: the assembled DNA droplet A YA-motif, DNA droplet B YB-motif and double-stranded DNA structure 2LAB linker are mixed, and NaCI solution is added to the mixed system to make its final concentration 350mM; the final concentrations of DNA droplet A YA-motif, DNA droplet B YB-motif and double-stranded DNA structure 2LABlinker are 2μM respectively, and the DNA droplet A YA-motif, DNA droplet B YB-motif and double-stranded DNA structure 2LAB linker are incubated at 37°C for 30min to form a programmable bicontinuous material based on DNA condensates.

9. The method for preparing a programmable bicontinuous material based on DNA condensates according to claim 8, characterized in that: In step S1, one single-stranded DNA is optionally modified with Cy5 or Cy3 fluorescent group from the three single-stranded DNAs YA-1, YA-2 and YA-3, and added to the system at a molar ratio of 10%; and one single-stranded DNA is optionally modified with Cy5 or Cy3 fluorescent group from the three single-stranded DNAs YB-1, YB-2 and YB-3, and added to the system at a molar ratio of 10%; and the final concentration of the selected single-stranded DNA is adjusted.

10. Application of a programmable bicontinuous material based on DNA condensates in selective enrichment of streptavidin, characterized in that: The method for preparing the programmable bicontinuous material comprises the following steps: S101, respectively setting up the assembly systems of DNA droplet A and DNA droplet B: adding a certain amount of single-stranded DNA: YA-1, YA-2 and YA-3 or YB-1, YB-2 and YB-3 to the 1×Annealing buffer reaction system, so that the final concentration of YA-1, YA-2, YA-3 or YB-1, YB-2, YB-3 is set to 5.0 μM; selecting one single-stranded DNA from the three single-stranded DNAs of YA-1, YA-2 and YA-3 to modify the biotin molecule, and adding it to the system at a molar ratio of 10%, that is, the final concentration is 0.5 μM; and adjusting the final concentration of the selected single-stranded DNA to 4.5 μM; S102, assembly process of DNA droplet A YA-motif and DNA droplet B YB-motif: the three single-stranded DNAs YA-1, YA-2 and YA-3 and the three single-stranded DNAs YB-1, YB-2 and YB-3 in the assembly system are assembled into YA-motif and YB-motif respectively by gradient annealing or constant temperature reaction at 37°C, and the DNA droplet A YA-motif and DNA droplet BYB-motif are formed by liquid-liquid phase separation. The annealing conditions are incubation at 95°C for 5 min, annealing at 20°C / min to 25°C, and storage at 4°C. S103. Constructing a double-stranded DNA structure 2LAB linker assembly system: adding a certain amount of single-stranded DNA to the 1× Annealing buffer reaction system, the final concentration of each single-stranded DNA of the double-stranded linker (2LAB) is 20 μM; S104, double-stranded DNA structure 2LAB linker assembly process: placing the double-stranded DNA structure 2LAB linker assembly system in a PCR instrument for gradient annealing to assemble into a double-stranded DNA structure 2LAB linker, the annealing program is: incubate at 85°C for 5 minutes, decrease by 0.1°C per second, set 600 cycles, slowly cool to 25°C, and store the annealed product in a 4°C refrigerator for later use; S105, the formation process of programmable bicontinuous material based on DNA condensate: the assembled DNA droplet A YA-motif, DNA droplet B YB-motif and double-stranded DNA structure 2LAB linker are mixed, and NaCI solution is added to the mixed system to make the final concentration of 350mM; the final concentrations of DNA droplet A YA-motif, DNA droplet B YB-motif and double-stranded DNA structure 2LAB linker are 2μM respectively, and the DNA droplet A YA-motif, DNA droplet B YB-motif and double-stranded DNA structure 2LAB linker are incubated at 37°C for 30min to form a programmable bicontinuous material based on DNA condensate; S106. Mix the streptavidin molecule labeled with FITC fluorescent group with the DNA droplet A and incubate at a constant temperature of 37°C.

11. The use according to claim 10, characterized in that: The biotin molecule, YA-2_Biotin, was modified at the 3' end of the selected single-stranded DNA to serve as the binding site for streptavidin.

12. The use according to claim 11, characterized in that: The sequence of the YA-2_Biotin is 5'-GCTCGAGCGCTGTGGACACGTTGATTTGATCACTACCAGGTC-3'.

13. The use according to claim 10, characterized in that: In step S101, one single-stranded DNA is selected from the three single-stranded DNAs YA-1, YA-2 and YA-3 to be modified with Cy5 or Cy3 fluorescent group, and added to the system at a molar ratio of 10%; and one single-stranded DNA is selected from the three single-stranded DNAs YB-1, YB-2 and YB-3 to be modified with Cy5 or Cy3 fluorescent group, and added to the system at a molar ratio of 10%, that is, the final concentration is 0.5 μM; and the final concentration of the selected single-stranded DNA is adjusted to 4.5 μM.

Images