An mRNA vaccine for preventing or treating malignant tumors and a preparation method and application thereof

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to an mRNA vaccine for preventing or treating malignant tumors and a preparation method and application thereof. The mRNA vaccine is composed of a nucleic acid molecule encoding an NID1 antigen and cationic lipid nanoparticles wrapping the nucleic acid molecule. The nucleic acid molecule or the lipid nanoparticle thereof has good immunogenicity, can induce a strong cellular and humoral immune response of the body in a short time, can express the NID1 protein in the body after being delivered into the body, triggers the immune response of the body, can make the body produce an immune response against tumors, meanwhile, the nucleic acid molecule or the lipid nanoparticle thereof only needs a low dose to effectively inhibit tumor growth, and is fast, simple and convenient to prepare, can be mass-produced in a short time, is beneficial to the industrialization of the drug, and can reduce the cost of the antitumor drug.

Description

An mRNA vaccine for the prevention or treatment of malignant tumors, its preparation method and application Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to an mRNA vaccine for the prevention or treatment of malignant tumors, its preparation method, and its application. Background Technology

[0002] The global pandemic of COVID-19 has brought the development and application of mRNA (messenger ribonucleic acid) vaccines to the forefront of global attention. The maturity and progress of this technology have also revealed the enormous potential of mRNA vaccines in other fields, particularly in cancer treatment. The medical and scientific communities hope that mRNA vaccines can become the next treatment to combat cancer and save patients' lives. Tumor vaccines utilize tumor-associated antigens to induce specific cellular and humoral immune responses in the body, thereby enhancing the body's resistance to tumors and inhibiting tumor growth, thus controlling tumors. Currently, tumor vaccines can be divided into four main categories: whole-cell vaccines based on tumor cells or antigen-presenting cells, tumor peptide vaccines, viral vector-based vaccines, and nucleic acid-based vaccines. Nucleic acid vaccines include DNA vaccines and RNA vaccines. Compared with other types of cancer vaccines, mRNA-based vaccines have significant advantages, including rapid development and production, greater safety, and the ability to induce a more efficient immune response. This is mainly because mRNA vaccines only transiently express tumor antigens and do not interact with genomic DNA, thus reducing the risk of genomic integration associated with traditional vaccines such as viral vector vaccines and DNA vaccines. More importantly, mRNA vaccines allow for more flexible combinations, encoding one or more antigens, including the full length or partial polypeptide segments of antigen proteins. This makes it easier to achieve the efficacy of multivalent vaccines and facilitates the flexible selection of multiple antigens to enhance vaccine effectiveness. Compared to traditional inactivated or recombinant protein vaccines, mRNA vaccines can more efficiently activate cellular responses to achieve better preventative efficacy. These advantages make mRNA tumor vaccines a promising candidate for clinical application and a current research hotspot.

[0003] Currently, most mRNA tumor vaccines are still in clinical trials, and their efficacy remains unclear. Designing stable and safe mRNA tumor vaccines that can induce specific tumor immune responses, have few side effects, and can be mass-produced will be crucial in determining whether an mRNA vaccine can enter clinical trials. Currently, mRNA vaccines target two main types of antigens: tumor-associated antigens (TAAs) and tumor-specific antigens (TSAs). TAAs are antigens highly expressed in tumors but poorly expressed in normal tissues, while TSAs are neoantigens generated by tumor cell mutations, expressed only in tumors, and possess high immunogenicity. Due to their high individual variability, TSAs are more suitable for personalized precision medicine, but their high cost due to difficulties in achieving large-scale survival limits their widespread use. Conversely, mRNA vaccines based on TAAs have relatively lower production costs. However, since TAAs are also expressed in normal tissues, the potential risk of inducing autoimmune toxicity is correspondingly increased. Although mRNAs encoding full-length antigen sequences can overcome HLA type limitations and induce broader T-cell responses, no related mRNA vaccines have yet been approved for clinical use. Leveraging the multi-antigen binding advantage of mRNA, mRNA vaccines containing multiple TAA sequences are currently undergoing clinical trials. For example, BioNTech's LipoMERIT vaccine combines antigen sequences including NY-ESO-1, MAGE-C3, tyroxinase, and gp100 for the treatment of advanced melanoma. CureVac's CV9201 vaccine contains multiple antigens such as MAGE-C1, MAGE-C2, NY-SEO-1, and survivin for the treatment of advanced lung cancer. Domestic and international teams are actively conducting research using mRNA vaccine technology for the prevention and treatment of various cancers, and the application prospects of mRNA tumor vaccines are promising.

[0004] However, existing anti-tumor mRNA vaccines have the following drawbacks: 1) The mainstream LNP systems (DLin-MC3-DMA(MC3), ALC-0315, and SM-102) used in currently approved or clinical trial mRNA vaccines have problems such as poor stability and demanding storage conditions. 2) MRNA vaccines targeting tumor-specific antigens are only suitable for personalized tumor vaccine development, and have the disadvantages of high cost and difficulty in large-scale production. 3) MRNA vaccines targeting tumor-associated antigens have lower production costs, but since normal tissues and cells may also contain low levels of expression of these related antigens, there is a risk of inducing autoimmune toxicity. 4) MRNA vaccines encoding full-length antigen sequences can more effectively induce T cell responses, but no related anti-tumor mRNA vaccines have been approved for marketing yet, and their safety needs further verification. 5) NID1 is highly expressed in various cancers and plays an important regulatory role in the tumor microenvironment. Previous studies have shown that it is a safe and effective pan-cancer target, but there are currently no anti-tumor vaccines targeting NID1 on the market. Summary of the Invention

[0005] In response to the problems existing in current anti-tumor vaccines and the promising prospects of NID1 as a vaccine antigen, this invention provides an mRNA vaccine for the prevention and treatment of malignant tumors, using NID1 as the antigen. This vaccine encodes the full-length protein of NID1, and only requires a low dose to effectively inhibit tumor growth or prevent tumor formation. It has good safety and a simple preparation process.

[0006] To achieve the above objectives, the technical solution adopted by the present invention includes:

[0007] In a first aspect, the present invention provides a nucleic acid molecule encoding the NID1 antigen, the nucleotide sequence of which is shown in (a) or (b):

[0008] (a) The nucleotide sequence is shown in SEQ ID NO: 1 or SEQ ID NO: 2;

[0009] (b) A nucleotide sequence derived from (a) in which the nucleotide sequence in (a) has been substituted, deleted or added at least one nucleotide and has the function of encoding the NID1 antigen.

[0010] The nucleic acid molecule comprises at least one of a 5'-cap structure, a 5'-UTR, a 3'-polynucleotide sequence, and a 3'-UTR. The 5'-UTR has 10-200 nucleotides, preferably 50-100 nucleotides; the 3'-UTR has 50-250 nucleotides, preferably 100-200 nucleotides; and the 3'-polynucleotide sequence has 70-150 nucleotides, more preferably 100-120 nucleotides.

[0011] The nucleic acid molecule described in this invention can encode the full-length NID1 antigen, has good immunogenicity, and can induce a strong cellular and humoral immune response in the body in a short time, thereby achieving the purpose of preventing or treating malignant tumors.

[0012] Preferably, the nucleic acid molecule includes at least one of DNA, ASO, siRNA, miRNA, mRNA and aptamer; more preferably, the nucleic acid molecule is mRNA.

[0013] Secondly, the present invention provides a nucleic acid-liposome complex, the nucleic acid-liposome complex comprising the aforementioned nucleic acid molecule and cationic lipid nanoparticles encapsulating the nucleic acid molecule.

[0014] Preferably, the molar ratio of the cationic lipid nanoparticles to nucleic acid molecules is (2-10):1.

[0015] Preferably, the cationic lipid nanoparticles comprise the following components in molar percentage: 15-49% cationic lipids, 40-50% structural lipids, 5-20% auxiliary lipids, and 1-5% polyethylene glycol-modified lipids.

[0016] Preferably, the structural lipids include cholesterol or its derivatives, the accessory lipids include any one of DSPC, DOPE, DOPG and DOPS, and the PEGylated lipids include PEG-DMG or PEG-DSPE.

[0017] More preferably, the structural lipid is cholesterol, the auxiliary lipid is DSPC, and the PEGylated lipid is PEG-DMG.

[0018] The cationic lipid nanoparticles coated with nucleic acid molecules described in this invention can ensure the effective delivery of mRNA encoding tumor-associated antigens to target cells, prevent their degradation in vivo, and achieve transient expression of tumor-associated antigens, thereby activating the body's immune response. Furthermore, they can promote the initiation and regulation of the immune system to a certain extent, thus enhancing the efficacy of tumor immunotherapy.

[0019] Thirdly, the present invention provides a method for preparing the aforementioned nucleic acid-liposome complex, comprising the following steps:

[0020] S1. Dissolve cationic lipids, structural lipids, auxiliary lipids and polyethylene glycol-modified lipids in an organic solvent to obtain an organic phase;

[0021] S2. Dissolve nucleic acid molecules in solvent buffer to obtain the aqueous phase;

[0022] S3. After thoroughly mixing the organic phase and the aqueous phase, a liposome mixture encapsulating nucleic acid molecules is obtained. Then, the storage buffer is used to replace the solvent buffer in the mixture and the solvent in the organic phase to obtain the nucleic acid-liposome complex.

[0023] Preferably, the total concentration of cationic lipids, structural lipids, auxiliary lipids and polyethylene glycol-modified lipids in the organic phase is 1-30 mg / mL, the concentration of nucleic acid molecules in the aqueous phase is 0.2-1.5 mg / mL, and the volume ratio of the organic phase to the aqueous phase is 1:(2-6).

[0024] More preferably, the total concentration of cationic lipids, structural lipids, auxiliary lipids and polyethylene glycol-modified lipids in the organic phase is 15-20 mg / mL, and the volume ratio of the organic phase to the aqueous phase is 1:3.

[0025] Preferably, the organic solvent includes, but is not limited to, ethanol; the solvent buffer includes, but is not limited to, citrate buffer and sodium acetate solution; and the storage buffer includes, but is not limited to, PBS solution.

[0026] Preferably, the method for replacing the solvent buffer in the mixture and the solvent in the organic phase is as follows: diluting the nucleic acid-encapsulated liposome mixture 10-200 times (preferably 50-100 times) with a stable storage buffer and then concentrating it, or dialyzing the nucleic acid-encapsulated liposome mixture in 1000 times its volume of stable storage buffer and then concentrating it, or using buffer replacement techniques such as tangential flow to replace the solvent buffer and the solvent in the organic phase with a stable storage buffer.

[0027] Fourthly, the present invention provides the use of the aforementioned nucleic acid molecule and / or the aforementioned nucleic acid-liposome complex in the preparation of medicaments for the prevention or treatment of malignant tumors.

[0028] Preferably, the drug includes a vaccine, and the malignant tumor includes liver cancer.

[0029] This invention develops a vaccine using publicly available mRNA nucleic acid molecules encoding the NID1 antigen. Using mRNA as the main component of the vaccine offers advantages such as rapid development, high safety, and ease of industrialization. The mRNA-based vaccine is synthesized via in vitro enzymatic methods, a mature manufacturing process that eliminates the need for cell-based viral proliferation or recombinant protein production. Sufficient protective efficacy can be achieved with extremely small doses, demonstrating superior safety and efficacy compared to other existing tumor vaccine technologies. Furthermore, NID1 is significantly highly expressed in various malignant tumors, and compared to existing anti-tumor mRNA vaccines, the NID1-based mRNA vaccine exhibits significant therapeutic and preventative effects against both lung and liver cancer.

[0030] Preferably, the vaccine is administered via nebulization, intravenous injection, subcutaneous injection, intramuscular injection, or ocular administration.

[0031] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0032] This invention discloses a nucleic acid molecule capable of effectively preventing and treating tumors. The nucleic acid molecule comprises at least one nucleotide encoding the NID1 protein, or lipid nanoparticles of the aforementioned nucleotide. This nucleic acid molecule or its lipid nanoparticles exhibit excellent immunogenicity, inducing a strong cellular and humoral immune response in the body within a short time. After delivery into the body, the nucleic acid molecule or its lipid nanoparticles can express the NID1 protein, triggering an immune response that combats tumors. Furthermore, the nucleic acid molecule or its lipid nanoparticles require only low doses to effectively inhibit tumor growth. In addition, the preparation of this nucleic acid molecule or its lipid nanoparticles is rapid and simple, enabling large-scale production in a short period, which is beneficial for the industrialization of this drug and reducing the cost of anti-tumor drugs. Attached Figure Description

[0033] Figure 1 shows the sequence alignment results of mNID1 (mouse-derived) mRNA before and after optimization;

[0034] Figure 2 shows the sequence alignment results of hNID1 (human) mRNA before and after optimization;

[0035] Figure 3 shows the template plasmid for mRNA vaccine IVT;

[0036] Figure 4 shows the complete structures of unmodified and modified NID1 mRNA;

[0037] Figure 5 shows the agarose gel electrophoresis imaging results of NID1 mRNA;

[0038] Figure 6 shows the results of Western blot analysis of the translation efficiency of artificially prepared NID1 mRNA in HEK293T cells;

[0039] Figure 7 shows the particle size and distribution detection results of the prepared LNP-mRNA;

[0040] Figure 8 is an experimental flowchart of the efficacy of NID1-mRNA vaccine in treating liver cancer;

[0041] Figure 9 shows the effect of NID1-mRNA vaccine in treating liver cancer. Detailed Implementation

[0042] To make the objectives, technical solutions, and effects of this invention clearer and more explicit, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0043] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.

[0044] Example 1. Preparation of mRNA encoding NID1 antigen

[0045] (1) NID1 mRNA sequence optimization:

[0046] Current mainstream codon optimization algorithms primarily use codon efficiency index (CAI) as an indicator, focusing on the degree of consistency between the frequency of codon usage in heterologous mRNA sequences and the optimal codon usage frequency in the host cell. However, codons are not the only factor affecting protein expression. Especially when synthesizing large quantities of mRNA in vitro using T7 RNA polymerase, in addition to CAI, factors such as GC content, secondary structure (free energy), T7 RNA polymerase-sensitive transcription terminators, T7 RNA polymerase-like promoters within the mRNA sequence, and the selection of UTRs must also be considered, as these factors can significantly impact the expression of artificially synthesized mRNA in cells and in vivo.

[0047] This study utilized a software platform developed by Shenzhen Hongxin Biotechnology (magicRNA) specifically for mRNA sequence optimization. Its algorithm emphasizes the balance of multiple factors (GC content, codon usage frequency and secondary structure, transcription terminator, and T7 RNA polymerase promoter avoidance). Using the magicRNA platform technology, the sequences of mNID1 (mouse) and hNID1 (human) were optimized (simultaneously, the optimized sequences avoided the BsaI restriction site, allowing for the use of BsaI enzyme to cleave the plasmid at an artificially designed BsaI restriction site after polyA to obtain a linearized IVT template). Specifically, the GC content of mNID1 was increased from 55.6% to 63.4%, and the CAI from 0.91 to 0.98, resulting in the optimized mNID1 mRNA sequence NID1_a (SEQ ID NO: 1); the GC content of hNID1 was increased from 57.4% to 62.95%, and the CAI from 0.80 to 0.98, resulting in the optimized hNID1 mRNA sequence NID1_b (SEQ ID NO: 1). NO: 2); Figures 1-2 show the sequence alignment results of mNID1 (mouse) and hNID1 (human) mRNA sequences before and after optimization.

[0048] (2) Construction of IVT (in vitro transcription) template plasmid:

[0049] The UTR sequences of the mRNA in this study were derived from the 5'UTR(Mod) and 3'UTR(Mod) of the Morderna COVID-19 vaccine (mRNA-1273). The T7promoter-UTR(Mod)-120A-BsaI tandem sequence was first synthesized by GenScript and inserted between the HindIII and EcoR1 restriction sites of the pUC57 vector to obtain an empty IVT framework vector, named pIVT-T7-UTR(Mod)-120A-BsaI. The sequences of each element are as follows:

[0050] T7 promoter sequence: 5'-TAATACGACTCACTATA-3' (SEQ ID NO: 3);

[0051] 5'-UTR (Morderna) sequence:

[0052] 5'-GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCC GGCGCCGCCACC-3' (SEQ ID NO: 4);

[0053] 3'-UTR (Morderna) sequence:

[0054] 5'-CTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTCCCCCCA GCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGTCTTTGAATAAAGTCT GAGTGGGCGGTAGC (SEQ ID NO: 5);

[0055] polyA(120A) sequence:

[0056] 5'-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA GAGACC (SEQ ID NO: 6) (where “TGAGACC” is the BsaI restriction site).

[0057] Based on this, and according to the principle of seamless cloning, the present invention designed primers (see Table 1) to insert the optimized NID1_a and NID1_b into the empty vector of the IVT framework, respectively, to obtain pIVT-T7-+NID1a-120A-BsaI and pIVT-T7-+NID1b-120A-BsaI plasmids (Figure 3). Colonies with a polyA tail length >110A were screened and preserved by competent transformation and single-clone sequencing. The strains were used for amplification culture to extract IVT template plasmids.

[0058] Table 1 Primers required for NID1 mRNA template plasmid construction

[0059]

[0060] (3) Preparation of NID1 mRNA (m1ψ modified and unmodified mRNA):

[0061] 1) Combine the pIVT-UTR+NID1_a-120A-BsaI constructed in the previous step with...

[0062] The bacterial strain of pIVT-UTR+NID1_b-120A-BsaI plasmid was amplified and cultured in 100 mL LB medium. Then, plasmid extraction was performed using Axygen's plasmid extraction kit (MD-P-25). The plasmid was digested with BsaI restriction endonuclease and then purified using DNA purification magnetic beads (Novizan). The purified plasmid was dissolved in enzyme-free water and stored at -20°C.

[0063] 2) In vitro transcription to synthesize RNA (Table 2):

[0064] Table 2. Components of the in vitro transcription system (100 μL)

[0065] Component Name Concentration 10× Transcription Buffer 10 μL NTP (25 mM each of A, G, C, and U / mL) 7.5 μL DNA Template (linearized template plasmid) Final Concentration: 50 ng / μL Inorganic Pyrophosphatase (10 μM) 5.0 μL RNase Inhibitor (U / μL) 3.0 μL L7 RNA Polymerase (50 U / μL) 10.0 μL Add enzyme-free H2O to total volume 100 μL surface

[0066] After gently mixing, incubate at 37°C for 1 hour. Add 75 μL of Dnase I and eliminate DNA at 37°C for half an hour, mixing once during the process. Then add an equal volume of enzyme-free water and mix well. Finally, add 1.8 times the volume of RNA purification magnetic beads (Novizan) to purify the synthesized RNA.

[0067] 3) RNA capping reaction (10 mL capping reaction system):

[0068] Take 5.0 mg of the RNA synthesized in the previous step, add enzyme-free H2O to a total volume of 7.0 mL, mix well, and incubate at 70°C for 5 minutes for denaturation, then immediately place on ice for 5 minutes. Next, add 1.0 mL of 10× capping buffer; 0.5 mL of GTP (10 mM), 0.5 mL of SAM (4 mM), 0.5 mL of vaccinia virus capping enzyme (Cap0), and 0.5 mL of 2'-O-methyltransferase (Cap1). Mix well and incubate at 37°C for 30 minutes, gently inverting and mixing every 10 minutes. After the capping reaction is complete, finally add 0.5 times the volume of RNA purification magnetic beads (Novizan) for RNA purification.

[0069] 4) Oligo(dT)25 affinity packing material (Thermo) is used to purify and remove RNA products that have been interrupted or degraded during transcription, thereby improving the purity and uniformity of mRNA products.

[0070] 5) RNA quality testing:

[0071] First, the concentrations of four NID1 mRNAs (m1ψ-modified or naturally unmodified NID1_a and NID1_b mRNAs) were measured using a Nano-drop UV spectrophotometer, and the purity of the mRNAs was determined by the values ​​of OD280 / 260 and OD260 / 230. Second, the integrity and size of the mRNAs were detected by agarose gel electrophoresis. The specific steps were as follows: 1.0 μg of mRNA sample was diluted with 5 μL of enzyme-free water, and an equal volume of 2×RNA loading buffer was added and mixed. After denaturation at 85°C for 2 minutes, the sample was immediately placed on ice for 2 minutes. Then, it was electrophoresed on a 1.5% agarose gel at 100V for 30 minutes. An RNA marker (Thermo, SM1821) was used to indicate the size of the sample RNA. The UV gel imaging results are shown in Figure 5.

[0072] 6) Screening of mRNA candidate vaccine translation efficiency at the cellular level:

[0073] Twenty-four hours before mRNA transfection, 293T cells were seeded in 24-well plates, and transfection was performed at a ratio of 0.5 μg mRNA + 1.5 μL lip3000 transfection reagent per well. Cells were collected after 24 hours. Cell samples were lysed with cell lysis buffer, and the supernatant was collected by centrifugation. 5×SDS loading buffer was added, and the samples were denatured at 98°C for 5 minutes before Western blot analysis. The primary antibody was NID1 monoclonal antibody (Abcam). ECL chemiluminescence detection was used to determine the expression levels of the four mRNAs in 293T cells (Figure 6). This invention screened one mRNA each from human and mouse NID1 mRNA for better translational expression for LNP nanoparticle encapsulation and animal experiments.

[0074] Example 2. Encapsulation and Identification of LNP-mRNA Liposome Nanoparticles

[0075] (1) Preparation of liposome nanoparticles:

[0076] First, ionizable lipids (patent number: CN202111017566.1) were dissolved in anhydrous ethanol (organic phase) at a molar ratio of 44.2:9.9:44.2:1.7 with structural lipids (cholesterol), auxiliary lipids (DSPC), and polyethylene glycol-modified lipids (PEG2000-DMG). Then, using a microfluidic preparation system (MIANA, INano E), the organic phase containing dissolved liposomes and a 25 mM sodium citrate solution containing dissolved mRNA (aqueous phase) were mixed in a microfluidic chip at a volume ratio of 1:3 at a flow rate of 12 mL / h to obtain a crude solution of lipid nanoparticles. The obtained solution was then diluted with PBS and ultrafiltered for 20 min at 1500 rcf in 15 mL or 50 mL ultrafiltration centrifuge tubes (Millipore, 100K) at 4 °C for a total of 3 ultrafiltrations, ultimately achieving a molar ratio of ionizable lipids to mRNA of approximately 5:1.

[0077] (2) Characterization of lipid nanoparticles:

[0078] Characterization of particle size, PDI, and potential: The particle size and PDI of the prepared lipid nanoparticles were determined using a Nano-ZSZEN3600 (Malvern) instrument. The prepared LNP-mRNA liposome nanoparticles were diluted 100-fold with PBS solution for particle size and potential measurement. The stabilization time was 120 s, and the cycle was repeated 3 times, with 10 cycles per cycle. The test results showed that the particle sizes of the prepared LNP-NID1_amRNA and LNP-NID1_b mRNA nanoparticles were 82.83 nm and 84.27 nm, respectively, with a PDI less than 0.1 (Figure 7), and the measured potential was approximately 0.5 mV.

[0079] Encapsulation efficiency determination: The encapsulation efficiency was determined according to the standard procedure of the Quant-iT RiboGreen RNA kit. The mRNA concentration before and after x-100 demulsification was measured, and the LNP encapsulation efficiency was calculated. The general procedure was as follows: 498 μL of 1×TE and 498 μL of 2% Triton-100 solution were added to 2 μL of ultrafiltered LNP-mRNA sample, respectively. After adding the chemiluminescent buffer, the absorbance was analyzed using a microplate reader, and the mRNA concentration was calculated based on the standard curve. The results showed that the encapsulation efficiencies of the prepared LNP-NID1_a mRNA and LNP-NID1_b mRNA samples were 93.6% and 94.6%, respectively. 2 >0.99.

[0080] Example 3. Animal experiments to verify the efficacy of mRNA vaccines

[0081] SPF-grade C57BL / 6 mice (6-8 weeks old, weighing 16-20g) that passed quarantine and met weight standards were selected to establish an orthotopic hepatocellular carcinoma model. The orthotopic inoculation of hepatocellular carcinoma was performed as follows: After anesthesia, the mice were placed in a supine position and fixed on a test plate. The skin was disinfected with povidone-iodine after shaving. A longitudinal incision was made below the xiphoid process along the midline of the abdomen, and the skin and peritoneum were cut layer by layer to fully expose the left lobe of the liver. 50μL of a solution containing 1×10⁻⁶ mmol / L was drawn using a 50μL microsyringe. 5 A suspension of 1753p53- / -cMyc cells was injected slowly into the liver parenchyma at a 20° angle, approximately 0.5 cm deep. The injection was allowed to proceed briefly before the needle was withdrawn. Immediately after injection, the needle puncture site was gently pressed with a cotton swab until bleeding ceased on the liver surface. The abdomen was then closed layer by layer. Post-operatively, the mice were allowed free access to food and water. Grouping: Male C57BL / 6 mice were randomly divided into a control group (PBS) and a NID1-mRNA vaccine treatment group, with five mice in each group. Once the orthotopic tumor model was successfully established via biofluorescence (day 7), mice were treated with PBS or the vaccine on days 7 and 14, respectively. Each mouse was injected intramuscularly (IM) with 50 μL (LNP-mRNA) of the vaccine, containing 1 μg, 5 μg, or 10 μg of NID1-mRNA, respectively. The mental state, diet, defecation, weight, and activity of the C57BL / 6 mice were regularly observed. Orthotopic tumor biosignals were measured weekly, and mouse survival was assessed. The experiment ended on day 21 (see Figure 8).

[0082] The results showed that only 1 μg of NID1-mRNA vaccine was needed to prolong the survival of mice with liver cancer. Compared with 1 μg of NID1-mRNA vaccine, 5 μg of vaccine significantly inhibited liver cancer tumor growth. In terms of safety, up to 10 μg of NID1-mRNA vaccine had no significant effect on mouse body weight (see Figure 9). These experiments demonstrate that low-dose NID1-mRNA vaccine can significantly prolong the survival rate of tumor-bearing mice and effectively inhibit tumor growth, while high-dose vaccine still has good safety.

[0083] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A nucleic acid molecule encoding the NID1 antigen, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO: 1 or SEQ ID NO: 2; the nucleic acid molecule is mRNA.

2. A nucleic acid-liposome complex, characterized in that, The nucleic acid-liposome complex comprises the nucleic acid molecule as described in claim 1, and cationic lipid nanoparticles encapsulating the nucleic acid molecule.

3. The nucleic acid-liposome complex according to claim 2, characterized in that, The molar ratio of the cationic lipid nanoparticles to nucleic acid molecules is (2-10):

1.

4. The nucleic acid-liposome complex according to claim 2, characterized in that, The cationic lipid nanoparticles comprise the following components in molar percentage: 15-49% cationic lipids, 40-50% structural lipids, 5-20% auxiliary lipids, and 1-5% polyethylene glycol-modified lipids.

5. The nucleic acid-liposome complex according to claim 4, characterized in that, The structural lipids include cholesterol or its derivatives, the accessory lipids include any one of DSPC, DOPE, DOPG and DOPS, and the PEGylated lipids include PEG-DMG or PEG-DSPE.

6. The method for preparing the nucleic acid-liposome complex as described in claim 4 or 5, characterized in that, Includes the following steps: S1. Dissolve cationic lipids, structural lipids, auxiliary lipids, and polyethylene glycol-modified lipids in an organic solvent to obtain an organic phase; S2. Dissolve nucleic acid molecules in a solvent buffer to obtain an aqueous phase; S3. After thoroughly mixing the organic phase and the aqueous phase, a liposome mixture encapsulating nucleic acid molecules is obtained. Then, a storage buffer is used to replace the solvent buffer in the mixture and the solvent in the organic phase to obtain the nucleic acid-liposome complex.

7. The preparation method according to claim 6, characterized in that, The total concentration of cationic lipids, structural lipids, auxiliary lipids and polyethylene glycol-modified lipids in the organic phase is 1-30 mg / mL, the concentration of nucleic acid molecules in the aqueous phase is 0.2-1.5 mg / mL, and the volume ratio of the organic phase to the aqueous phase is 1:(2-6).

8. The use of the nucleic acid molecule as described in claim 1, and / or the nucleic acid-liposome complex as described in any one of claims 2-5, in the preparation of a medicament for treating liver cancer.

Images