Watermelon KNOX transcription factor ClSPR and its application in cold stress

By using CRISPR/Cas9 technology to edit the KNOX transcription factor ClSPR of watermelon, a new watermelon germplasm resistant to cold damage was created, solving the problem of low temperature stress in watermelons and realizing targeted genetic improvement and stress resistance enhancement of watermelon germplasm.

CN119709777BActive Publication Date: 2025-12-02NORTHWEST A & F UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411937446.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-26
Publication Date
2025-12-02
Estimated Expiration
2044-12-26

AI Technical Summary

Technical Problem

Watermelon, as a warm-season crop, is susceptible to cold damage. Low-temperature stress has a negative impact on watermelon seedlings planted in early spring, affecting yield and quality. Current technology lacks effective cold-resistant germplasm resources.

Method used

By using CRISPR/Cas9 technology to edit the KNOX transcription factor ClSPR of watermelon, knocking out or mutating its function, new germplasm resistant to cold damage was created, and the cold resistance of watermelon was improved through targeted genetic improvement.

Benefits of technology

The newly created watermelon germplasm exhibits strong cold resistance under low temperature stress, normal seedling growth, and no obvious phenotypic changes in other tissues. It provides new materials for the breeding of stress-resistant varieties and has significant potential for production application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119709777B_ABST
    Figure CN119709777B_ABST
Patent Text Reader

Abstract

This invention discloses the watermelon KNOX transcription factor ClSPR and its application in cold stress tolerance, belonging to the field of plant genetic engineering technology. The invention utilizes CRISPR / Cas9 gene editing technology to perform site-specific editing of the watermelon KNOX transcription factor ClSPR, obtaining new cold-resistant watermelon germplasm. Compared with wild-type materials, the new cold-resistant watermelon germplasm created by this invention shows no change in seedling growth, and no visible phenotypic changes in other tissues such as female flowers, leaves, tendrils, stems, and roots. This technology enables targeted genetic improvement of superior watermelon germplasm to resist cold stress, accumulating new materials for the breeding of stress-resistant varieties and possessing significant potential for production application.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and more specifically to the watermelon KNOX transcription factor ClSPR and its application in cold stress tolerance. Background Technology

[0002] Watermelon (Citrullus lanatus), belonging to the genus Citrullus of the family Cucurbitaceae, is one of the most widely cultivated and important cucurbit crops in the world, and also a fruit-type economic crop. According to statistics, in 2022, my country's watermelon planting area reached 1.3919 million hectares, with a total output of 60.5422 million tons, accounting for 47.73% and 60.57% of the world's total cultivated area and output, respectively (FAO, http: / / www.fao.org / ). Therefore, as one of the important cucurbit crops cultivated in my country, watermelon plays a vital role in agricultural restructuring and rural economic development.

[0003] Watermelons originated in the desert regions of Africa and are a warm-season crop that is not cold-hardy. With the rapid development of facility agriculture in my country, early spring cultivation and off-season planting of watermelons have become increasingly common, and have now become one of the important ways for watermelon farmers to increase their income. However, with the frequent occurrence of low-temperature damage, especially extreme weather such as late spring frosts, low-temperature stress often has adverse effects on watermelon seedlings planted in early spring, even causing death, which in turn affects the yield and quality of watermelons. Therefore, exploring and creating superior low-temperature resistant watermelon germplasm and breeding new stress-resistant varieties is of great significance to the healthy development of the watermelon industry.

[0004] Therefore, providing the watermelon KNOX transcription factor ClSPR and its application in cold stress tolerance is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides the watermelon KNOX transcription factor ClSPR and its application in cold stress tolerance.

[0006] In the early stages of this invention, RT-PCR technology was used to discover that the watermelon KNOX transcription factor ClSPR significantly responds to cold stress. Furthermore, CRISPR / Cas9 technology was used to create a material with the gene missing function, which can significantly improve tolerance to cold stress and provide material resources for enriching new stress-resistant watermelon varieties.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] Watermelon KNOX transcription factor ClSPR, the CDS sequence of which is shown in SEQ ID NO.1.

[0009] Furthermore, the application of the watermelon KNOX transcription factor ClSPR in cold stress tolerance.

[0010] Furthermore, the application of biomaterials with knockout of watermelon KNOX transcription factor ClSPR in cold stress tolerance, wherein the CDS sequence of watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.1;

[0011] The biomaterial is any one of the following:

[0012] A: An expression cassette that can silence the watermelon KNOX transcription factor ClSPR;

[0013] B: A recombinant vector containing the expression cassette described in A;

[0014] C: Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B.

[0015] Furthermore, the application of the watermelon KNOX transcription factor ClSPR in watermelon breeding.

[0016] Furthermore, the application of the watermelon KNOX transcription factor ClSPR in the selection of cold-resistant watermelon germplasm.

[0017] Furthermore, a method for creating a new cold-resistant watermelon germplasm involves using CRISPR / Cas9 or other gene editing technologies to perform site-specific editing or knockout of the KNOX transcription factor ClSPR or its conserved domain sequence, thereby causing the gene protein to lose function or mutate, resulting in a phenotype resistant to cold stress; the CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.1.

[0018] This invention is the first to utilize the watermelon KNOX transcription factor ClSPR, identified through gene family identification, and combine it with CRISPR / Cas9 technology to create a new cold-resistant watermelon germplasm. This invention enables targeted genetic improvement of cold-resistant traits in superior watermelon germplasm, accumulating new materials for the breeding of stress-resistant varieties and possessing significant potential for production applications.

[0019] As can be seen from the above technical solution, compared with the prior art, this invention discloses the watermelon KNOX transcription factor ClSPR and its application in cold stress tolerance. For the first time, CRISPR / Cas9 or other gene editing systems are used to edit and knock out the KNOX transcription factor ClSPR or its conserved domains, resulting in the loss of gene function or mutation, thus making it more tolerant to cold stress. Compared with wild-type materials, the new cold-resistant watermelon germplasm created by this invention shows no change in seedling growth, and no visible phenotypic changes in other tissues such as female flowers, leaves, tendrils, stems, and roots. This technology can achieve targeted genetic improvement of superior watermelon germplasm to resist cold stress, accumulating new materials for the breeding of stress-resistant varieties, and has significant potential for production application. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0021] Figure 1 The attached figure shows the sgRNA expression element of the recombinant plasmid of the present invention; wherein U6-26p and U6-29p are promoters, U6-26t is a terminator, gRNA-Sc is the gRNA backbone, and Target1 and Target2 are target sites;

[0022] Figure 2 The attached figures are schematic diagrams of the target structure and phenotypic diagram of the present invention;

[0023] Among them, (a) schematic diagram of ClSPR gene structure; the positions of Target1 and Target2 on the gene, two gene-edited plants Clspr_1 and Clspr_2 were obtained, with 4bp and 1bp deletions in Target1, and 7bp and 6bp deletions in Target2, respectively (- indicates deletion); (b) phenotypes of multiple unedited plants (CK) and edited plants after cold injury, in which CK leaves showed obvious wilting and some leaves dried out, while the wilting degree of edited plants Clspr_1 and Clspr_2 was significantly less;

[0024] Figure 3 The attached figures show the phenotypic diagram of the plants after cold stress according to the present invention, as well as the determination of relative conductivity and malondialdehyde content.

[0025] Among them, (a) phenotypic diagram of individual plants after cold stress, the leaves of CK showed obvious wilting and some leaves dried out, while the wilting of edited plants Clspr_1 and Clspr_2 was significantly less; (b) relative conductivity (REC) measurement; (c) malondialdehyde (MDA) measurement; ** indicates significance at the p<0.01 level. Detailed Implementation

[0026] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0027] The CDS sequence of ClSPR is shown in SEQ ID NO.1.

[0028] ATGGCGGATCTTTACGGACTCCATCCCCTCGCTGATAACTCTTACCAGTCATCTTCAGCGACGACGTTGGGTAGCTTTCCTTCTTGCTAATTCTCCAATGGCTTCTGCAGATTATTCTCATCTACTTCCTGCTTTTGAATCGGAATATTTGCGGACGGTT TCGTCGGCCGCCTGCGACACCGTTGCGGCGGCGGCTGAGATTGAAACAGCGCGAGCTAATTCCGAGTACTCCGCCGGTGTAATTCGAGCGAAAATTGCTTCTCATCCTCTTTACCCTAAACTCGTCGATGCGTTCGTGAACTGCCAAAAGGTCGGTGTACCG CCGGAGTTCGCTGATATTCCAGACCAAAACAACCGTGGAAGTGATATCGGCGAAGAAATTTCCGGCGTTTCAAATTGCTTGGGTGTCGATCCCGAACTCGATGAGTTCATGGAAACATACTACAGGATACTAGCCAAATACGAGTTAGATCTCTCCCAGTCCTTCATGGAAGCATCTTCCTTTCTCAACAACATGGGAATGCAGTTAAACGTGCTTTGCAATAAC GATGAAACTGCTCCGAAAGAGAATATAAGCGCCGGAGAAGTAGAATTACAAGACTCTCTTGTGGTTCCGGGAAATGAAGATCGCGAGCTGAAGGATCGACTTTTGCGGGAGTACGGTGGTCATATTAGTAGCTTAAAGCAGGAATTCTCAAAAACTAAAAAGAAGGCAAATCTGCCGAGAGAAGCCAAACAGATCCTGCTTCACTG GTGGAACAGCCATTCCCAG SEQ ID NO.1.

[0029] Example 1: Selection of editing sites for gene ClSPR

[0030] Gene editing target sites were designed based on the CDS sequence of ClSPR (as shown in SEQ ID NO.1) and the online target site design website CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR2 / news.php, V2). Two editing sites (Target1 and Target2) were designed. Target1 and Target2 are located on the second and fourth exons of the ClSPR gene, respectively.

[0031] Target1 sequence: CCGGAGTTCGCTGATATTC; SEQ ID NO.2;

[0032] Target2 sequence: GTGGAACAGCCATTCCCAG; SEQ ID NO.3.

[0033] Example 2: Construction of CRISPR / Cas9 Editing Vector

[0034] 1) PCR amplification:

[0035] Based on the two target sequences mentioned above, adapter primers Target1F / Target2R were synthesized. Using the intermediate vector pCBC-DT1T2 diluted 100-fold as a template, PCR amplification was performed using the high-fidelity enzyme PrimeStarMax Premix (TaKaRa). The PCR amplification system consisted of: 25 μL PrimeStarMax Premix (2×), 2.5 μL template, 2.5 μL each of forward and reverse primers, and 17.5 μL ddH2O. The PCR reaction program was: 98℃ for 10 s, 58℃ for 5 s, 72℃ for 15 s, for 38 cycles; followed by 72℃ for 5 min.

[0036] The target sequence adapter primers (with the underlined part indicating the target sequence) are as follows:

[0037] Target1 sequence primer: Target1F

[0038] ATATATGGTCTCGATTG GAATATCAGCGAACTCCGG GTTTTAGAGC TAGAAATAGC;SEQ IDNO.4;

[0039] Target2 sequence primer: Target2R

[0040] ATTATTGGTCTCGAAAC CTGGGAATGGCTGTTCCAC CAATCTCTTA GTCGACTCTAC; SEQ ID NO.5.

[0041] 2) Vector enzyme digestion:

[0042] The CRISPR / Cas9 vector PBSE402 was digested using the restriction endonuclease BsaI (NEWENGLANDBioLabs). The digestion system consisted of 2 μg PBSE402, 5 μL CutSmart buffer, 1 μL BsaI, and ddH2O to a final volume of 50 μL. Digestion was carried out at 37°C for 2 h, followed by gel extraction after electrophoresis.

[0043] Ligation of PCR products with vector: The PCR amplified products were ligated with the enzyme-digested vector PBSE402 for homologous recombination. The ligation system was as follows: vector to insert molar ratio approximately 1:2; 4 μL 5× reaction buffer; 1 μL NovoRec Plus recombinase; ddH2O to a final volume of 20 μL. Ligation was carried out at 50℃ for 10 min.

[0044] See recombinant plasmid backbone Figure 1 .

[0045] 3) Transformation with recombinant plasmids:

[0046] Five μl of the ligation product was heat-shocked and transformed into competent E. coli DH5α cells. The cells were then plated on LB agar plates containing 50 mg / L kanamycin and incubated overnight at 37°C. Colonies were then detected for positivity using primers U626-IDF / U629-IDR.

[0047] The specific primer sequences are as follows:

[0048] U626-IDF: TGTCCCAGGATTAGAATGATTAGGC; SEQ ID NO.6;

[0049] U629-IDR: AGCCCTCTCTCTTTCGATCCATCAAC; SEQ ID NO.7.

[0050] After successful sequencing, the recombinant plasmid was extracted and transformed into Agrobacterium competent cells EHA105. After PCR verification, it was used for watermelon genetic transformation. The Agrobacterium transformation steps are as follows:

[0051] Add 1 μl of recombinant plasmid to Agrobacterium EHA105 competent cells, place in an ice box for 5 min, then rapidly freeze in liquid nitrogen for 5 min, and incubate in a 37°C water bath for 5 min. Add 400 μl of antibiotic-free culture medium to each tube for resuscitation, then transfer to a shaker at 200 rpm and 28°C for incubation. Spread 100 μl of the resuscitated bacterial culture onto LB agar plates containing antibiotics, air dry at room temperature, and after the bacterial culture has been fully absorbed, invert the culture dish and incubate at 28°C for 2-3 days.

[0052] Example 3

[0053] 1) Watermelon genetic transformation:

[0054] Take plump watermelon 'TC' seeds, soak them in distilled water at 50-55℃ for about 30 minutes, and then peel off the seed coat. In a clean bench, wash the peeled kernels with 75% alcohol for about 30 seconds, wash them twice with sterile water, then soak them in 3% sodium hypochlorite for 15 minutes for disinfection, wash them 5-7 times with sterile water, dry them, and sow them on MS solid medium. Incubate them in the dark at 25℃ for 3 days.

[0055] After the seeds germinate, remove them, cut off both ends of the cotyledons, and divide the remaining cotyledonary parts into 8 equal pieces for easy infection. Meanwhile, single colonies of EHA105 containing the recombinant plasmid, verified by PCR, are picked and placed in LB liquid medium containing 50 mg / L kanamycin and 20 mg / L rifampin. The bacterial culture is allowed to reach an OD value after shaking. 600When the concentration was 0.8, the bacterial culture was resuspended in MS medium (MS 5194.43 g / L, sucrose 30 g / L, 6-BA 1.5 mg / L) to achieve the final OD concentration. 600 =0.2, to obtain the bacterial suspension. Soak the cut cotyledons in the bacterial suspension for 15 min, remove and air dry, and then co-culture them in a co-culture medium (CM: MS519 4.43 g / L, sucrose 30 g / L, G3251 (PhytoTechLabs) 3 g / L, 6-BA 1.5 mg / L) lined with filter paper, and incubate in the dark at 25℃ for 3 days.

[0056] After co-culturing for 3 days, the cotyledon blocks were removed and washed with sterile water to remove excess Agrobacterium bacterial solution (washing about 5-7 times) until the sterile water was clear. After drying, they were placed on recovery medium (RM: MS5194.43g / L, sucrose 30g / L, G32513g / L, 6-BA 1.5mg / L, 200mg / L Timentin) for recovery culture at 28℃ for 7 days.

[0057] Seven days later, the regenerated cotyledons were transferred to MS medium (selection medium SM) containing 1.5 mg / L 6-BA, 200 mg / L Timentin, and 1.4 mg / L Basta for selective culture. Subculture was carried out at 28°C for 3-4 weeks, with subculture every 7 days. Explants with distinct buds were then transferred to bud elongation medium (containing 4.43 g / L MS524, 30 g / L sucrose, 3 g / L LG3251, 1 g / L inositol, 500 μL / L SH organic solution, 0.01 mg / L NAA, 0.1 mg / L 6-BA, 200 mg / L Timentin, and 1.4 mg / L Basta) under the following conditions: 28°C, 8 h / d darkness, 16 h / d light, and a light intensity of 8000 Lx. Cut off the selected buds (note that the cut should not contain callus) and transfer them to MS medium containing 0.5 mg / L IBA and 200 mg / L Timentin for rooting culture. Culture at 28°C until rooting occurs.

[0058] The SH organic solution contains 10 g / L nicotinic acid, 10 g / L VB1, and 1 g / L VB6.

[0059] When the regenerated seedlings have grown roots and 4-5 true leaves, remove them from the culture bottle, slowly rinse the culture medium off the roots with clean water, transplant them into a substrate that has been sterilized by high temperature and high pressure, water them thoroughly, and keep them warm and moist for cultivation. After 3-4 days, when water droplets are seen on the cover of the seedling tray, gradually open the cover to harden off the seedlings.

[0060] 2) Detection of transgenic watermelon plants:

[0061] The PBSE402 vector carries a GFP fluorescent tag. DNA was extracted from regenerated watermelon seedlings with GFP fluorescence using the CTAB method. The steps were as follows: A small amount of young leaves were rapidly ground into powder in liquid nitrogen and placed in a 1.5 ml centrifuge tube; 800 μl of preheated CTAB extraction buffer was added, and the mixture was incubated at 65°C for 30 min; an equal volume of chloroform-isoamyl alcohol was added, with a chloroform-to-isoamyl alcohol volume ratio of 24:1, and the mixture was centrifuged at 8000 rpm for 10 min; the supernatant was transferred to a new centrifuge tube, 2 / 3 volume of isopropanol was added, and the mixture was gently mixed by inverting; the mixture was centrifuged at 10000 rpm for 10 min; the supernatant was discarded, and the precipitate was washed twice with 75% ethanol. The precipitate was discarded, and the remaining liquid was aspirated. After drying for 3 min, the precipitate was dissolved in 100 μl of ddH2O (containing 0.1% RNase) and stored at 4°C for later use.

[0062] Using the extracted DNA as templates, PCR amplification was performed on the sequences of the two target sites using primers ClSPR-CRJC-F1 / R1 for target site 1 and ClSPR-CRJC-F2 / R2 for target site 2. The positive control was the recombinant plasmid, and the negative control was DNA from non-transgenic plants.

[0063] The specific primer sequences are as follows:

[0064] ClSPR-CRJC-F1:

[0065] ATTATTCTCATCTACTTCCTGCTT;SEQ ID NO.8;

[0066] ClSPR-CRJC-R1:

[0067] TTTTCTTTTTCTTTTATCTACCGT;SEQ ID NO.9;

[0068] ClSPR-CRJC-F2:

[0069] GGAGGGTTGATAGATTGGGGTTT;SEQ ID NO.10;

[0070] ClSPR-CRJC-R2:

[0071] TAGGAGTAAGTTAGCATGTTTGGT; SEQ ID NO. 11.

[0072] The amplification system consisted of: 10 μL of 2×Taq PCR StarMix with loading dye, 1 μL of template, 1 μL each of forward and reverse primers, and 7 μL of ddH2O. The PCR reaction program was: 94℃ for 3 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 1 min, for 30 cycles; 72℃ for 5 min. PCR products were recovered based on band size and TA cloning was performed. After positive PCR detection in bacterial culture, selected clones were sent for confirmation of edit events. Results are shown below. Figure 2 Two gene-edited plants, Clspr_1 and Clspr_2, were obtained, with 4bp and 1bp deleted in Target1, respectively, and 7bp and 6bp deleted in the Target2 target region, respectively.

[0073] 3) Phenotypic observation of transgenic watermelon plants under cold stress:

[0074] Wild-type (WT) and edited plants Clspr_1 and Clspr_2 were planted in a greenhouse and managed normally. Phenotypic observation and photography were conducted after the seedlings reached approximately four leaves and one bud (before treatment). Following this, the seedlings underwent low-temperature treatment in an artificial climate incubator at 4°C for three days (12h light / 12h dark). Phenotypic observation and photography were performed again. Leaf samples were taken for electrical conductivity and MDA measurements. The experiments were repeated three times, and the data were analyzed using Student's t-test for significance.

[0075] (1) Measurement of electrical conductivity (Relative conductivity, REC)

[0076] 1. Remove the fourth true leaf from the treated watermelon plant (counting from bottom to top in growth order). Rinse the leaf twice with distilled water and blot dry with clean filter paper. Use a hole punch to make holes between the veins, avoiding the veins.

[0077] 2. Place the treated leaves into a marked 50mL test tube and accurately add 20mL of distilled water to the test tube to completely submerge the leaves.

[0078] 3. Place the prepared material in a vacuum dryer and use a vacuum pump to remove air from the intercellular spaces for about 15 minutes. Then slowly reinject air to force water into the tissue, causing the leaves to sink (or place at room temperature for 1 day, or shake on a shaker for 1 hour).

[0079] 4. Remove the evacuated material and let it stand on the lab table for 20 minutes. Then, gently stir the blade with a glass rod and measure the conductivity C1 of the solution using a conductivity meter under constant temperature conditions of 20-25℃.

[0080] 5. After measuring the conductivity, boil the material in a 100℃ boiling water bath for 15 minutes to kill the plant tissue. Remove it and cool it in tap water for 10 minutes. Measure its conductivity C2 after boiling under a constant temperature of 20-25℃.

[0081] 6. Calculation result: REC = C1 / C2 × 100%.

[0082] (2) Determination of malondialdehyde (MDA)

[0083] 1.015g leaf sample + 2.5mL 10% trichloroacetic acid, centrifuged at 8000g for 15min;

[0084] 2.1 mL supernatant + 1 mL 0.6% thiobarbituric acid reaction solution;

[0085] 3. Boil for 15 minutes, then immediately place in ice to stop the reaction;

[0086] 4. After centrifugation at 10,000g for 10 min, the absorbance values ​​of the supernatant were measured at 450 nm and 532 nm.

[0087] Calculation formula: MDA(nmol·g) -1 Fw)=(6.45×A532-0.56×A450)×VT / (Vs×Fw)

[0088] Wherein: VT: extraction liquid volume 2.5mL;

[0089] Vs: The volume of the sample used for determination is 1 mL;

[0090] Fw: Fresh weight.

[0091] After three days of low-temperature treatment, the leaves of the CK (unedited plant WT) showed obvious wilting, and some leaves dried out, while the wilting of the leaves of the edited plants Clspr_1 and Clspr_2 was significantly less than that of the control, and their growth was normal. Figure 2 This indicates that the plant has strong cold resistance.

[0092] The relative electrical conductivity (REC) of plant leaves is a commonly used physiological indicator to assess cell membrane integrity and permeability under plant stress. When plants are subjected to environmental stresses (such as drought, salinity, and high temperature), cell membranes may be damaged, leading to the leakage of electrolytes (such as electrolyte leakage) from the cell into the external environment, thereby increasing the leaf's electrical conductivity. Furthermore, by measuring the REC, it was found that under cold stress, the relative electrical conductivity of the control (CK) plants was 55.40%, significantly higher than the 38.28% of the edited plants. Figure 3 This indicates that ClSPR-edited plants are more resistant to low-temperature stress.

[0093] Malondialdehyde (MDA) content is a commonly used indicator. When plant organs age or are damaged under stress, membrane lipid peroxidation usually occurs. MDA, as the final product of membrane lipid peroxidation, reflects the degree of stress damage to the plant. Measuring the MDA content in plant leaves can indirectly reflect the plant's adaptability to stress. Through the determination of MDA content in the leaves of control (CK) and edited plants, it was found that under cold stress, the MDA content in the leaves of CK plants was significantly higher than that of edited plants, further indicating that ClSPR-edited plants are more tolerant to low-temperature stress. Figure 3 ).

[0094] In summary, this invention provides a method for creating cold-resistant watermelon germplasm using gene editing technology. By editing the sequence of the KNOX transcription factor ClSPR, cold-resistant watermelon materials can be obtained rapidly, providing technical support for the targeted improvement of the low-temperature resistance trait of superior watermelon germplasm.

[0095] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. The application of knockout of watermelon KNOX transcription factor ClSPR in watermelon cold stress, characterized by, The CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.

1.

2. Application of biomaterials with knockout of watermelon KNOX transcription factor ClSPR in watermelon cold stress tolerance, characterized in that, The CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.1; The biomaterial is any one of the following: A: An expression cassette that can silence the watermelon KNOX transcription factor ClSPR; B: A recombinant vector containing the expression cassette described in A; C: Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B.

3. The application of knocking out the watermelon KNOX transcription factor ClSPR in watermelon cold-resistant germplasm breeding, characterized by: The CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.

1.

4. The application of knocking out the watermelon KNOX transcription factor ClSPR in the breeding of cold-resistant watermelon germplasm, characterized by, The CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.

1.

5. A method for creating a new cold-resistant watermelon germplasm, characterized in that, The watermelon KNOX transcription factor ClSPR was knocked out using CRISPR / Cas9 gene editing technology; the CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.1.