A Puccinia striiformis f. sp. tritici effector protein gene Pst_4593 and its application

Abstract

The present invention discloses a wheat stripe rust effector protein gene Pst_4593 and its application, belonging to the technical field of genetic engineering. The nucleotide sequence of the open reading frame of the wheat stripe rust effector protein gene Pst_4593 is shown in SEQ ID NO:1. This gene positively regulates the pathogenicity of stripe rust to wheat. Silencing the wheat stripe rust effector protein gene Pst_4593 can improve the resistance of wheat to stripe rust, and the relative expression levels of wheat-related defense genes TaPR1 , TaPR2 , TaPR5 are significantly increased. The wheat stripe rust effector protein gene Pst_4593 is related to the induced expression of the haustorium of stripe rust. The protein encoded by the wheat stripe rust effector protein gene Pst_4593 also has lipase activity and can affect the pathogenicity of stripe rust. The present invention provides a disease-resistant germplasm resource for the cultivation of wheat varieties resistant to stripe rust.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering and relates to a wheat stripe rust effector protein gene Pst_4593 and its application. Background Art

[0002] Wheat stripe rust is one of the important wheat diseases, which is characterized by a wide spread range and a high epidemic frequency. It affects the growth and development of wheat and causes yield reduction at the same time. Wheat stripe rust is an airborne wheat disease caused by Puccinia striiformis f. sp. tritici ( Puccinia striiformis f. sp tritici , Pst). As a biotrophic obligate parasitic fungus, Puccinia striiformis f. sp. tritici needs to infect the host and absorb nutrients from the host to complete its life activities. Puccinia striiformis f. sp. tritici draws nutrients from host cells through the formation of haustoria, an infection structure, to maintain its growth and development. Its infection process includes the penetration period, the hyphal extension period and the disease period. Uredinia appear on the surface of host leaves 14 days after the infection of Puccinia striiformis f. sp. tritici, completing an infection cycle. Due to the characteristics of heteroecious parasitism of Puccinia striiformis f. sp. tritici, its virulence mutates frequently, and new physiological races are likely to appear, resulting in the loss of resistance of many disease-resistant varieties. Therefore, it is of great significance to explore new wheat disease-resistant gene resources and accelerate the creation and cultivation of new wheat varieties resistant to stripe rust.

[0003] Effector proteins are a class of excreted protein molecules secreted by pathogenic bacteria. Through plant-pathogen interactions, they can change the structure and defense pathways of host plant cells, thereby promoting the successful infection and colonization of pathogenic bacteria in host plants or triggering host defense responses. Pathogenic bacteria secrete effector proteins to enter host plant cells, affect different plant disease-resistant related genes, and inhibit the immune response of the host, thus helping the colonization and infection of pathogenic bacteria. Lipase, also known as triacylglycerol acylhydrolase, can hydrolyze triglycerides and is commonly found in animals, plants and microorganisms. During the occurrence of diseases, the lipid homeostasis in the host will be lost, indicating that lipids play an important role in maintaining the healthy state of the host. The lipase secreted by pathogenic bacteria can enhance its pathogenicity by decomposing the lipids of the host. Therefore, it is very important to identify effector proteins with lipase structures for the cultivation of wheat varieties resistant to stripe rust. Summary of the Invention

[0004] To solve the above technical problems, the present invention provides a wheat stripe rust effector protein gene Pst_4593 and its application. The nucleotide sequence of the open reading frame of the wheat stripe rust effector protein gene Pst_4593 is shown in SEQ ID NO:1. This gene positively regulates the pathogenicity of stripe rust to wheat. Silencing the wheat stripe rust effector protein gene Pst_4593The wheat stripe rust resistance can be improved. The wheat stripe rust effector protein Pst_4593 encoded by the gene contains a phospholipase domain, has lipase activity, and can affect the pathogenicity of the stripe rust. The invention provides a disease-resistant germplasm resource for the cultivation of wheat stripe rust-resistant varieties.

[0005] To achieve the technical purpose of the present invention, on the one hand, the present invention provides a wheat stripe rust effector protein gene Pst_4593 , the wheat stripe rust effector protein gene Pst_4593 The nucleotide sequence of the open reading frame is shown in SEQ ID NO: 1. Pst_4593 It has a specific fragment as shown in SEQ ID NO:2.

[0006] On the other hand, the present invention claims protection for the wheat stripe rust effector protein gene Pst_4593 wheat stripe rust effector protein gene Pst_4593 Application of a specific fragment of in breeding wheat stripe rust resistant varieties, the wheat stripe rust effector protein gene Pst_4593 Related to wheat stripe rust immune regulation, wheat stripe rust effector protein gene Pst_4593 Positively regulate the pathogenicity of stripe rust to wheat. Silence the wheat stripe rust effector protein gene Pst_4593 or silencing the wheat stripe rust effector protein gene Pst_4593 Specific fragments of wheat stripe rust, improve wheat stripe rust resistance, improve wheat stripe rust resistance including improving TaPR1 Gene, TaPR2 Gene, TaPR5 Relative expression levels of wheat defense genes such as genes.

[0007] Specifically, the present invention converts the wheat stripe rust effector protein gene Pst_4593 After germination and sowing of silenced plants, it was found that the wheat stripe rust effector protein gene Pst_4593 The number of diseased spores on the leaves of wheat in the silenced plants was significantly less than that in the wild-type control plants, indicating that the wheat stripe rust effector protein gene Pst_4593 Silencing expression can improve plant resistance to wheat stripe rust.

[0008] Specifically, the present invention identifies the wheat stripe rust effector protein gene Pst_4593 Expression of wheat defense genes silenced in wheat plants TaPR1 , TaPR2 , TaPR5 The expression of wheat defense genes TaPR1 , TaPR2 , TaPR5 Significantly upregulated expression, proving the silencing of wheat stripe rust effector protein genes Pst_4593 Can enhance disease resistance of wheat.

[0009] Specifically, the present invention analyzes the effector protein gene of Puccinia striiformis f. sp. tritici Pst_4593 By detecting the area and burst of reactive oxygen species around the infection site of wheat plants with silenced expression after being infected by Puccinia striiformis f. sp. tritici, it is found that the area of reactive oxygen species accumulation in the plants with silenced expression of the effector protein gene of Puccinia striiformis f. sp. tritici Pst_ 4593 is significantly higher than that of the wild type, indicating that silencing the effector protein gene of Puccinia striiformis f. sp. tritici Pst_4593 enhances the disease resistance of wheat. The length and infection area of the hyphae of Puccinia striiformis f. sp. tritici in the plants with silenced expression of the effector protein gene of Puccinia striiformis f. sp. tritici Pst_4593 are significantly lower than those of the control Fielder, indicating that the growth and development of Puccinia striiformis f. sp. tritici in the transgenic wheat with silenced expression of the effector protein gene of Puccinia striiformis f. sp. tritici Pst_ 4593 are inhibited, and its pathogenicity is significantly weakened.

[0010] Furthermore, the present invention screens and clones one effector protein gene of Puccinia striiformis f. sp. tritici from the haustorium transcriptome sequencing Pst_4593 , and the effector protein gene of Puccinia striiformis f. sp. tritici Pst_4593 is related to the induced expression of the haustorium of Puccinia striiformis f. sp. tritici. The protein encoded by the effector protein gene of Puccinia striiformis f. sp. tritici Pst_4593 has lipase activity and affects the pathogenicity of Puccinia striiformis f. sp. tritici.

[0011] Specifically, by detecting the lipase activity of the effector protein Pst_4593 of Puccinia striiformis f. sp. tritici, it is found that neither the negative control GST nor GST+Ebelactone A has lipase activity, while Pst_4593 △sp -GST shows relatively high lipase activity, and the lipase activity of Pst_4593 △sp -GST is significantly reduced after adding a lipase inhibitor, indicating that the effector protein Pst_4593 of Puccinia striiformis f. sp. tritici has lipase activity.

[0012] In addition, the present invention claims a method for cultivating a wheat variety resistant to rust, silencing the above-mentioned effector protein gene of Puccinia striiformis f. sp. tritici Pst_4593 or silencing a specific fragment of the effector protein gene of Puccinia striiformis f. sp. tritici Pst_4593 . After verification, the transgenic wheat obtained by the method of the present invention shows resistance to the main prevalent race CYR32 of Puccinia striiformis f. sp. tritici.

[0013] To understand the technical solution of the present invention completely and without objection, it should be added that the effector protein of Puccinia striiformis f. sp. tritici in the present invention is represented by the non-italic font "Pst_4593", and the effector protein gene of Puccinia striiformis f. sp. tritici is represented by the italic font " Pst_4593Of course, those skilled in the art can clearly and completely understand the meaning and expression of the relevant genes and their encoded proteins based on the description of the present invention.

[0014] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0015] Wheat stripe rust effector protein gene provided by the present invention Pst_4593 Positively regulate the pathogenicity of stripe rust to wheat, silence the gene or silence the specific fragment of the gene, and improve the resistance of wheat to stripe rust. Pst_4593 After germination and sowing of silenced plants, it was found that the wheat stripe rust effector protein gene Pst_4593 The number of diseased spores on the leaves of wheat in the silenced plants was significantly less than that in the wild-type control plants, indicating that the wheat stripe rust effector protein gene Pst_4593 Silencing expression can improve the plant's resistance to wheat stripe rust. The present invention uses RNA interference technology to silence the wheat stripe rust effector protein gene Pst_4593 After gene silencing, the growth and development of stripe rust were inhibited, the pathogenicity of stripe rust was reduced, and the wheat-related defense genes TaPR1 , TaPR2 , TaPR5 The relative expression level of wheat stripe rust effector protein gene was significantly increased, which improved the disease resistance of wheat. Pst_4593 Positively regulates the pathogenicity of stripe rust to wheat.

[0016] The present invention screened and cloned a wheat stripe rust effector protein gene from haustoria transcriptome sequencing Pst_4593 The wheat stripe rust effector protein Pst_4593 encoded by the gene contains a phospholipase domain and has lipase activity. The present invention detects the lipase activity of the wheat stripe rust effector protein Pst_4593 and finds that the negative control GST and GST+Ebelactone A have no lipase activity, while Pst_4593 △sp -GST showed higher lipase activity, and after adding lipase inhibitor Pst_4593 △sp -GST's lipase activity was significantly reduced, indicating that the wheat stripe rust effector protein Pst_4593 has lipase activity.

[0017] The present invention uses genetic engineering technology to silence the wheat stripe rust effector protein gene in wheat plants Pst_ 4593, enhancing the resistance of wheat to stripe rust pathogens. It has been verified that the transgenic wheat obtained by the method of the present invention shows resistance to the main prevalent race CYR32 of stripe rust. The present invention provides a new technical idea for cultivating wheat varieties resistant to stripe rust from the perspective of molecular biology and lays a foundation for the genetic improvement of wheat resistance to stripe rust. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention.

[0019] Figure 1 is the effector protein gene of wheat stripe rust Pst_4593 DNA molecular detection diagram of wheat plants L8, L9, L10, L11, L12, and L13 with silenced expression of the effector protein gene of wheat stripe rust. M is the DNA Marker; Fielder is the wild-type wheat variety; ddH2O is the water control group.

[0020] Figure 2 is the effector protein gene of wheat stripe rust Pst_4593 Phenotype identification result diagram of wheat plants L2, L11, and Fielder with silenced expression of the effector protein gene of wheat stripe rust inoculated with the rust race CYR32 after 14 days.

[0021] Figure 3 is the effector protein gene of wheat stripe rust Pst_4593 in the wild-type wheat plant and the wheat plant with silenced expression of the effector protein gene of wheat stripe rust Pst_4593 Expression analysis diagram. Pst_4593 -RNAi#L2, Pst_4593 -RNAi#L11 are respectively two T1 generation wheat plants with silenced expression of the effector protein gene of wheat stripe rust Pst_4593 plants.

[0022] Figure 4 is the expression of wheat defense genes in the wild-type wheat plant and the wheat plant with silenced expression of the effector protein gene of wheat stripe rust Pst_4593 plants. Figure 4 In which A is the wheat defense gene TaPR1 in the wild-type wheat plant and the wheat plant with silenced expression of the effector protein gene of wheat stripe rust Pst_4593 plants; Figure 4 In which B is the wheat defense gene TaPR2 in the wild-type wheat plant and the wheat plant with silenced expression of the effector protein gene of wheat stripe rust Pst_4593 plants; Figure 4 In which C is the wheat defense gene TaPR5Expression in wild-type wheat plants and wheat stripe rust effector protein genes Pst_ 4593 Expression in wheat plants with silenced expression

[0023] Figure 5 For the wheat stripe rust effector protein gene Pst_4593 Diagram of the burst of reactive oxygen species around the infection site after wheat plants with silenced expression of the wheat stripe rust effector protein gene were infected with Puccinia striiformis f. sp. tritici. SV represents the substomatal cavity; H2O2 is reactive oxygen species

[0024] Figure 6 For the wheat stripe rust effector protein gene Pst_4593 Statistical chart of the area of reactive oxygen species around the infection site after wheat plants with silenced expression of the wheat stripe rust effector protein gene were infected with Puccinia striiformis f. sp. tritici

[0025] Figure 7 For the wheat stripe rust effector protein gene Pst_4593 Statistical chart of the length of Puccinia striiformis f. sp. tritici hyphae and the area of hyphal infection after wheat plants with silenced expression of the wheat stripe rust effector protein gene were infected with Puccinia striiformis f. sp. tritici Figure 7 In A, diagrams of hyphal development at different stages of Puccinia striiformis f. sp. tritici infection Figure 7 In B, statistical chart of the length of Puccinia striiformis f. sp. tritici hyphae at different stages of infection Figure 7 In C, statistical chart of the area of Puccinia striiformis f. sp. tritici hyphal infection at different stages of infection; IH represents primary hyphae; HMC represents haustorial mother cells; H represents haustoria

[0026] Figure 8 Western-blot detection diagram and Coomassie brilliant blue staining diagram of the wheat stripe rust effector protein Pst_4593 △sp Figure 8 In A, Western-blot detection diagram of the wheat stripe rust effector protein Pst_4593 △sp Figure 8 In B, Coomassie brilliant blue staining diagram of the wheat stripe rust effector protein Pst_4593 △sp ; GST is GST-tagged protein △sp Indicates the removal of the signal peptide fragment of this gene; Pst_4593 △sp -GST is the wheat stripe rust effector protein Pst_4593 fused with GST-tagged protein △sp ; Pst_4593 △sp (G199A)-GST means that the glycine (G) at position 199 in the wheat stripe rust effector protein Pst_4593 is mutated to alanine (A); Pst_4593 △sp (D255A)-GST means that the aspartic acid (D) at position 255 in the wheat stripe rust effector protein Pst_4593 is mutated to alanine (A); Pst_4593 △sp ​​(H276A)-GST is the histidine (H) at position 276 in the effector protein Pst_4593 of Puccinia striiformis f. sp. tritici mutated to alanine (A).

[0027] Figure 9 It is a result graph for detecting the lipase activity of the effector protein Pst_4593 of Puccinia striiformis f. sp. tritici. GST and GST + Ebelactone A are negative controls; Pst_4593 △sp -GST + Ebelactone A is the fusion protein with the lipase inhibitor added. Specific implementation manners

[0028] Next, the technical solutions of the present invention will be described in conjunction with embodiments. However, the present invention is not limited to the following embodiments. The experimental methods and detection methods described in each embodiment are all conventional methods unless otherwise specified; the reagents and materials, unless otherwise specified, can all be purchased on the market.

[0029] Embodiment 1

[0030] This embodiment provides the amplification and sequencing of the effector protein gene of Puccinia striiformis f. sp. tritici Pst_4593

[0031] Full-length primers for the effector protein gene of Puccinia striiformis f. sp. tritici are designed. The primers include the forward primer Pst_4593 -F (5’ ATGCAATCGCCTAACTTTTGCT 3’) and the reverse primer Pst_ 4593 -R (5’TCAGAATCCCTTGTCCGGAGA 3’). Using the cDNA of the wheat Shuaiyuan 11 (provided by Northwest A&F University) plant as a template, the effector protein gene of Puccinia striiformis f. sp. tritici is amplified Pst_4593 and sequenced. It is known that the nucleotide sequence of the effector protein gene of Puccinia striiformis f. sp. tritici Pst_4593 is as shown in SEQ ID NO:1. Pst_ 4593

[0032] Embodiment 2

[0033] This embodiment provides the cultivation of plants with silenced expression of the effector protein gene of Puccinia striiformis f. sp. tritici Pst_4593 and the identification of disease resistance.

[0034] Based on the Gateway technology, a recombinant vector for Pst_4593 -RNAi transgenic material is constructed. The interference fragment of Pst_4593 (gene Pst_4593 ​​The specific fragment (the nucleotide sequence is shown in SEQ ID NO: 2) was ligated to the pDonor221 intermediate vector through the BP reaction, and then ligated to the PC336 vector (provided by Northwest A&F University) through the LR reaction to obtain the recombinant vector. After correct sequencing, the recombinant vector was transferred into the Agrobacterium strain EHA105. Using the callus of wheat variety Fielder as the transformation receptor, the wheat stripe rust effector gene Pst_4593 The silencing vector was introduced into the receptor material, and the T0 generation of transgenic plant materials was produced through steps such as screening, pre-regeneration, regeneration, and rooting. After cultivation, the leaves of the T1 generation of wheat stripe rust effector gene Pst_4593 Expression-silenced wheat plants L8, L9, L10, L11, L12, and L13 were used to extract DNA for positive identification, and the identification results are as Figure 1 . As can be seen from Figure 1 , the wheat stripe rust effector gene Pst_ 4593 Expression-silenced plants L8, L9, L10, L11, L12, and L13 were all positive plants after detection.

[0035] The T1 generation of wheat stripe rust effector gene Pst_4593 The expression-silenced plants were soaked in seeds for germination and then sown in holes in 15×15×12 cm flower pots. At the same time, the wild-type material Fielder was sown as a control. In the incubator, it was cultured according to a temperature difference of 16°C / 10°C and a light / dark cycle of 16 h / 8 h. When the second leaf of the seedlings flattened, the physiological race CYR32 of stripe rust was inoculated. It was kept moist in the dark room at 16°C for 24 h and then transferred to normal light for cultivation. After 14 d, phenotypic photographs were taken and statistics were made. The test results are shown in Figure 2 .

[0036] As can be seen from Figure 2 , the number of pathogenic spores on the wheat leaves of the wheat stripe rust effector gene Pst_4593 Expression-silenced plants was significantly less than that of the wild-type control plants, indicating that the silenced expression of the wheat stripe rust effector gene Pst_4593 Can improve the disease resistance of plants to wheat stripe rust.

[0037] Example 3

[0038] This example provides an expression profile analysis of the wheat stripe rust effector gene Pst_4593 .

[0039] Using real-time fluorescence quantitative PCR technology, the expression of the wheat stripe rust effector gene Pst_4593 In the control plant Fielder and the expression-silenced plants was analyzed. Using the T1 generation of wheat stripe rust effector gene Pst_4593Using the wheat plants with silenced expression of L2 and L11 as experimental materials, with the wheat variety Fielder as the control, wheat leaves at different time points (24, 48, 120 h) after inoculation with the physiological race CYR32 of Puccinia striiformis f. sp. tritici were collected. Using their cDNA as a template and the elongation factor gene of Puccinia striiformis f. sp. tritici as the reference gene (PstEF-F: 5’ TTCGCCGTCCGTGATATGAGACAA 3’ and PstEF-R: 5’ATGCGTATCATGGTGGTGGAGTGA 3’), and using gene Pst_4593 specific primers (qPCR-Pst_4593-F: 5’AGGTTACATTGCCCGAGTC 3’ and qPCR-Pst_4593-R: 5’ ACCAAGTTCCGCATCCC 3’) to perform real-time fluorescence quantitative PCR. The nucleotide sequence of the specific fragment of gene Pst_4593 is shown in SEQ ID NO:2. The reaction conditions were: pre-denaturation at 95°C for 3 min; 95°C for 15 sec, 60°C for 30 sec, 72°C for 45 sec, for 40 cycles. Each reaction was repeated 3 times. The Ct values of each repeat, their average values and standard deviations were generated by the quantitative PCR instrument by manually adjusting the baseline. The average Ct value was taken, and the 2 -△△CT method was used to calculate the relative expression level of the effector protein gene of Puccinia striiformis f. sp. tritici Pst_4593 ( Figure 3 ).

[0040] As can be seen from Figure 3 , in the wheat plants with silenced expression of the effector protein gene of Puccinia striiformis f. sp. tritici at different time periods after inoculation with the physiological race CYR32 of Puccinia striiformis f. sp. tritici, the relative expression level of the effector protein gene of Puccinia striiformis f. sp. tritici Pst_4593 was significantly lower than that of the wheat variety Fielder, indicating that the effector protein gene of Puccinia striiformis f. sp. tritici Pst_4593 was successfully silenced. Pst_4593

[0041] Example 4

[0042] This example provides the expression conditions of wheat defense genes in wild-type wheat plants and wheat plants with silenced expression of the effector protein gene of Puccinia striiformis f. sp. tritici Pst_4593 .

[0043] Wheat leaves at different time points (24, 48, 120 h) after inoculation with the physiological race CYR32 of Puccinia striiformis f. sp. tritici were collected. Using their cDNA as a template and the wheat elongation factor gene as the reference gene (TaEF-F: 5’ TGGTGTCATCAAGCCTGGTATGGT 3’ and TaEF-R: 5’ ACTCATGGTGCATCTCAACGGACT 3’), using the wheat defense genes TaPR1 ,​TaPR2 , TaPR5 Specific primers were used for real-time fluorescence quantitative PCR. The reaction conditions were as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 30 sec, extension at 72°C for 45 sec, for 40 cycles. Each reaction was performed in triplicate, and the Ct values, their average values, and standard deviations for each replicate were generated by the quantitative PCR instrument by manually adjusting the baseline. The average Ct value was taken, and the relative expression levels of wheat defense genes were calculated using the 2 -△△CT method ( Figure 4 ).

[0044] Gene TaPR1 specific primers:

[0045] TaPR1-F: 5’ GAGAATGCAGACGCCCAAGC 3’;

[0046] TaPR1-R: 5’ CTGGAGCTTGCAGTCGTTGATC 3’.

[0047] Gene TaPR2 specific primers:

[0048] TaPR2-F: 5’ AGGATGTTGCTTCCATGTTTGCCG 3’;

[0049] TaPR2-R: 5’ AAGTAGATGCGCATGCCGTTGATG 3’.

[0050] Gene TaPR5 specific primers:

[0051] TaPR5-F: 5’ CAAGCAGTGGTATCAACGCAGAG 3’;

[0052] TaPR5-R: 5’ GTGAAGCCACAGTTGTTCTTGATGTT 3’.

[0053] As can be seen from Figure 4 , the wheat defense genes TaPR1 , TaPR2 , TaPR5 were significantly up-regulated in the wheat plants with silenced expression of the effector protein gene of Pst_ 4593 Puccinia striiformis f. sp. tritici, proving that silencing the effector protein gene of Pst_4593 Puccinia striiformis f. sp. tritici can enhance the disease resistance of wheat.

[0054] Example 5

[0055] In this example, by statistical analysis of the effector protein gene of Pst_4593The area and burst situation of reactive oxygen species around the infection sites of the gene - silenced plants after being infected by Puccinia striiformis f. sp. tritici were expressed, and the disease resistance of the gene - silenced plants was identified.

[0056] Wheat leaves at different time points (24, 48, 120 h) after inoculation with the physiological race CYR32 of Puccinia striiformis f. sp. tritici were collected. The leaves were cut into small segments, and their morphological upper ends were placed upward into centrifuge tubes containing DAB staining solution. After being placed under strong light for 5 h, the leaves were taken out and soaked in the decolorizing solution. The decolorizing solution was changed every 24 h until the leaves were transparent. Then the wheat leaves were soaked in chloral hydrate solution, fixed for 24 h, and stored using 30% glycerol. When observing, the bright - field state of an Olympus fluorescence microscope was used to observe and count the area of reactive oxygen species near the infection sites in the leaf tissue ( Figure 5 、 Figure 6 ). The presence of substomatal cavities was used as the basis for determining the infection sites.

[0057] The decolorized and transparent wheat leaves were stained with wheat germ agglutinin WGA (Wheat germ agglutin, which can specifically bind to the small - molecule glycoproteins on the chitin of the fungal cell wall. The infected leaves were stained with fluorescein - conjugated WGA, and clear hyphal structures could be observed under fluorescence). Then, the hyphal structures of Puccinia striiformis f. sp. tritici were observed using the GFP fluorescence channel of an Olympus fluorescence microscope, and the hyphal length and infection area were counted ( Figure 7 ). The hyphal length was counted as the distance from the tip of the longest hypha to the tip of the substomatal cavity. 30 - 50 infection sites were counted for each tissue sample, repeated three times, and a significant difference analysis was performed on the statistical data.

[0058] From Figure 5 and Figure 6 , it can be seen that the area of reactive oxygen species accumulation in the gene - silenced plants of the effector protein gene Pst_4593 of Puccinia striiformis f. sp. tritici was significantly higher than that of the wild - type, indicating that silencing the effector protein gene Pst_4593 of Puccinia striiformis f. sp. tritici enhanced the disease resistance of wheat. From Figure 7 , it can be seen that the hyphal length and infection area of Puccinia striiformis f. sp. tritici in the gene - silenced plants of the effector protein gene Pst_4593 were significantly lower than those of the control Fielder, indicating that the growth and development of Puccinia striiformis f. sp. tritici were inhibited and its pathogenicity was significantly weakened in the transgenic wheat with the silenced effector protein gene Pst_4593 .

[0059] Example 6

[0060] This example provides the detection of the lipase activity of the effector protein Pst_4593 of Puccinia striiformis f. sp. tritici.

[0061] Construct a vector containing the effector protein gene Pst_4593The pGEX-4T-1 recombinant vector and its mutant recombinant vectors. BamH I and Sal I were selected as the restriction enzyme sites. According to the nucleotide sequence of the effector protein gene of Puccinia striiformis f. sp. tritici Pst_4593 , primers were designed using homologous recombination. The cDNA of the urediniospores of the Puccinia striiformis f. sp. tritici physiological race CYR31 was used as a template for amplification, and the obtained amplification products were detected by agarose gel electrophoresis. The gel containing the target DNA fragment was cut, and the target gene fragment was recovered by gel extraction. Subsequently, BamH I and Sal I were selected as the restriction enzyme sites, and pGEX-4T-1 was double-digested. The digestion was carried out at 37 °C for 4 h, and the digested vector was separated by agarose gel electrophoresis. The gel containing the target vector was cut, and the digested vector was recovered by gel extraction. The vector construction was carried out using the OneStep Cloning Kit (Vazyme). After reacting at 37 °C in a metal bath for 30 min and then standing on ice for 5 min, Escherichia coli DH5α strain (purchased from Shanghai Weidi Biotechnology Co., Ltd.) was transformed. After transformation, the grown monoclonal colonies were picked for positive identification, and then the positive colonies were picked into the corresponding antibody LB liquid medium and cultured with shaking at 37 °C for 12 h. Subsequently, the plasmid was extracted and sequenced. The pGEX-4T-1 vector contains a GST tag. The Pst_4593 purified protein was obtained using a GST-tagged protein purification kit (purchased from Shanghai Beyotime Biotechnology Co., Ltd.). Subsequently, Coomassie Brilliant Blue staining and Western-Blot detection were carried out ( Figure 8 ). The protein concentration was measured using a BCA protein concentration assay kit (purchased from Shanghai Beyotime Biotechnology Co., Ltd.). Finally, the lipase (LPS) activity kit (purchased from Shanghai Enzyme-linked Biotechnology Co., Ltd.) was used to measure the enzyme activity of the effector protein Pst_4593 of Puccinia striiformis f. sp. tritici. By the copper soap method, with GST and GST+Ebelactone A as negative controls (Ebelactone A is a lipase inhibitor), the absorbance of the system at 710 nm was measured using a microplate reader and the enzyme activity was calculated ( Figure 9 ).

[0062] As shown by Figure 8 , in the Western-blot detection, a single protein band appeared at 61 KD, which was consistent with the size of the Pst_4593 △sp -GST fusion protein, indicating that the target protein with higher purity was obtained. As shown by Figure 9 , neither the negative control GST nor GST+Ebelactone A had lipase activity, while the Pst_4593 △sp -GST showed higher lipase activity. After adding the lipase inhibitor, the lipase activity of Pst_4593 △sp -GST decreased significantly, indicating that the effector protein Pst_4593 of Puccinia striiformis f. sp. tritici has lipase activity.

[0063] In summary, one effector protein gene of Puccinia striiformis f. sp. tritici was screened and cloned from the haustorium transcriptome sequencing of the present invention Pst_ 4593 , and the nucleotide sequence of its open reading frame is shown in SEQ ID NO: 1. The effector protein Pst_4593 of Puccinia striiformis f. sp. tritici encoded by this gene contains a phospholipase domain and has lipase activity. The present invention uses RNA interference technology to silence the effector protein gene of Puccinia striiformis f. sp. tritici Pst_4593 . After gene silencing, the growth and development of Puccinia striiformis f. sp. tritici are inhibited, the pathogenicity of Puccinia striiformis f. sp. tritici is reduced, and at the same time, the relative expression levels of wheat-related defense genes TaPR1 , TaPR2 , TaPR5 are significantly increased, improving the disease resistance of wheat. Therefore, the effector protein gene of Puccinia striiformis f. sp. tritici Pst_4593 positively regulates the pathogenicity of Puccinia striiformis f. sp. tritici to wheat.

[0064] The above-described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely represents selected embodiments of the present invention. All other embodiments obtained by relevant deductions and substitutions made by those of ordinary skill in the art under the conditions of the present invention's concept without creative efforts fall within the scope of protection of the present invention.

Claims

1. Application of the effector protein gene of Puccinia striiformis f. sp. tritici in cultivating wheat varieties resistant to stripe rust, characterized in that, Pst_4593 The wheat stripe rust effector protein gene Pst_4593 has the nucleotide sequence of the open reading frame as shown in SEQ ID NO: 1; Silencing the effector protein gene of Puccinia striiformis f. sp. tritici Pst_4593 enhances wheat resistance to stripe rust.

2. Application of specific fragment of effector protein gene of Puccinia striiformis f. sp. tritici in cultivating wheat varieties resistant to stripe rust, characterized in that, Pst_4593 The nucleotide sequence of the specific fragment of the wheat stripe rust effector protein gene Pst_4593 is shown in SEQ ID NO: 2; ​ Using the specific fragment of the wheat stripe rust effector protein gene Pst_4593 as the interfering fragment to silence the wheat stripe rust effector protein gene Pst_4593 and improve the resistance of wheat to stripe rust.

3. A method for cultivating a wheat variety resistant to rust, characterized in that, Silencing of the effector protein gene of Puccinia striiformis f. sp. tritici Pst_ 4593 ; The nucleotide sequence of the open reading frame of the wheat stripe rust effector protein gene Pst_4593 is shown in SEQ ID NO:

1.

4. A method for cultivating a wheat variety resistant to rust, characterized in that, Using the specific fragment of the wheat stripe rust effector protein gene Pst_4593 as the interfering fragment to silence the wheat stripe rust effector protein gene Pst_4593 and improve the resistance of wheat to stripe rust; The nucleotide sequence of the specific fragment of the wheat stripe rust effector protein gene Pst_4593 is shown in SEQ ID NO: 2.

Images