Application of soybean C2H2 type zinc finger transcription factor gene GmRGR1

Abstract

The invention discloses an application of a soybean C2H2 type zinc finger transcription factor gene GmRGR1. The invention relates to an application of a soybean C2H2 type zinc finger transcription factor gene GmRGR1 as shown in SEQ ID NO.1 in genetic engineering modification of chlorophyll content of arabidopsis thaliana. The chlorophyll content of arabidopsis thaliana can be reduced through overexpression of the GmRGR1 gene. The soybean C2H2 type zinc finger transcription factor gene GmRGR1 disclosed by the invention can be transformed into arabidopsis thaliana through genetic engineering, and finally, the photochlorophyll content of the arabidopsis thaliana is negatively regulated and controlled.

Description

Technical Field

[0001] The invention relates to application of soybean C2H2 type zinc finger transcription factor gene GmRGR1, and belongs to the field of genetic engineering. Background Art

[0002] Soybean is an important economic and food crop, providing humans with abundant oil and protein. Photosynthesis is the source of food for almost all life on Earth. For plants themselves, organic matter synthesized by photosynthesis, such as glucose and starch, is the material foundation for their growth, development and reproduction. Chlorophyll, as a key pigment for photosynthesis in plants, can absorb light energy and convert it into chemical energy, driving a series of photosynthesis reactions. The chlorophyll content in soybean leaves directly affects the efficiency of light energy absorption. High chlorophyll content can capture more light energy and provide a more sufficient energy source for photosynthesis. When the chlorophyll content in soybeans increases, the efficiency of the light reaction of photosynthesis is usually improved. More chlorophyll molecules can absorb more photons, promote the electron transfer of photosystem I and photosystem II, and thus generate more ATP (adenosine triphosphate) and NADPH (reduced coenzyme II). High chlorophyll content is beneficial to the growth and development of soybean plants. Sufficient chlorophyll can provide more energy and nutrients, promote the growth and development of the root system, and enhance the plant's ability to absorb water and nutrients. At the same time, leaves with high chlorophyll content can carry out photosynthesis more efficiently and synthesize more organic matter, providing sufficient material basis for soybean growth and helping to increase soybean biomass, including the growth of stems, leaves, flowers and pods.

[0003] GmRGR1 encodes a soybean C2H2 zinc finger transcription factor, the core of which is the C2H2 zinc finger domain. This domain consists of a specific amino acid sequence, in which two cysteines (Cys) and two histidines (His) form a stable finger-like structure by binding to a zinc ion. It usually contains multiple such zinc finger domains, which can enhance the binding ability and specificity with DNA. In terms of function, C2H2 zinc finger transcription factors play a key role in gene expression regulation. They can accurately recognize and bind to specific DNA sequences to regulate the transcriptional activity of target genes. They can activate or inhibit gene expression, thereby participating in many biological processes. For example, some C2H2 zinc finger transcription factors regulate cell division, differentiation and organ formation during plant growth and development. Some C2H2 zinc finger transcription factors can sense external adverse environmental signals, such as drought, high salt, low temperature, etc., when responding to environmental stress, and enhance plant stress resistance by regulating the expression of related genes. ZFP179 in rice contains two typical C2H2 zinc finger domains. Under salt stress, this gene can increase plant salt tolerance through three mechanisms: ABA-dependent pathway, ABA-independent pathway and ROS scavenging system. In transgenic rice plants overexpressing ZFP179, the expression of some genes related to salt tolerance in the ABA-dependent pathway was upregulated, and the proline content increased; the expression of some specific genes in the ABA-independent pathway was enhanced; at the same time, it can also increase the ROS scavenging activity of plant cells and reduce oxidative stress. However, it is unpredictable what function a C2H2-type zinc finger transcription factor whose biological function has not yet been identified has. We found that overexpression of this gene will lead to a decrease in the chlorophyll content of Arabidopsis. The discovery of this function lays the foundation for mutating this gene in soybean to increase the chlorophyll content and thus increase yield. Summary of the invention

[0004] The purpose of the present invention is to disclose the application of soybean C2H2 zinc finger transcription factor gene GmRGR1 genetic engineering to improve chlorophyll content. The GmRGR1 gene is mainly expressed in soybean leaves and seeds, followed by flowers and pods, and the expression level in roots and stems is relatively low. Subcellular localization analysis shows that GmRGR1 is mainly located in the nucleus and cytoplasm. Molecular experiments show that GmRGR1 has transcriptional inhibition activity. Overexpression of the gene reduces the chlorophyll content of Arabidopsis.

[0005] The purpose of the present invention can be achieved through the following technical solutions:

[0006] Application of soybean C2H2-type zinc finger transcription factor gene GmRGR1 in genetic engineering modification of chlorophyll content in Arabidopsis thaliana.

[0007] In Arabidopsis, overexpression of this gene reduces the chlorophyll content of Arabidopsis.

[0008] Beneficial effects:

[0009] We found that the GmRGR1 gene was mainly expressed in soybean leaves and seeds, followed by flowers and pods, and relatively low in roots and stems. Subcellular localization analysis showed that GmRGR1 was mainly localized in the nucleus and cytoplasm. Molecular experiments showed that GmRGR1 had transcriptional repression activity. Overexpression of this gene reduced the chlorophyll content of Arabidopsis. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 .Agarose gel electrophoresis after PCR cloning of GmRGR1. Target fragment size 1059bp. Marker: DL2000.

[0011] Figure 2 .Tissue expression pattern of GmRGR1. N=3.

[0012] Figure 3 .Subcellular localization analysis of GmRGR1 protein. GFP, GFP fluorescence; Bright, bright field; Merge, fusion protein; 35S-GFP, empty control; 35S:GmRGR1-GFP, GmRGR1 protein with GFP tag. Scale bar: 20μm. Figure 4 .GmRGR1 has transcriptional repressor activity. (A) Transcriptional autoactivation activity assay of GmRGR1 in yeast cells. BD, pGBKT7; SD / -Trp, synthetic dropout medium lacking tryptophan; SD / -Trp / -Ade / -His, synthetic dropout medium lacking tryptophan, adenine, and histidine. (B)-(D) Transcriptional regulatory activity assay of GmRGR1 using the dual-luciferase (LUC) reporter system in Nicotiana benthamiana leaves. A schematic diagram of the reporter gene and effector is shown in (B). A representative image of a tobacco leaf is shown in (C). The relative LUC / REN measurements in (C) are shown in (D). VP16 and GD1 were used as transcriptional activator and transcriptional repressor controls, respectively, while the GAL4BD vector was a negative control.

[0013] Figure 5 .Overexpression of GmRGR1 reduces chlorophyll content in Arabidopsis thaliana. (A) Representative morphology of Columbia wild-type (Col-0) and three 35S:GmRGR1 transgenic lines. (B) Comparison of chlorophyll content between Col-0 and three 35S:GmRGR1 transgenic lines. The value of each plant is represented by one point. Different letters indicate significant differences at the P < 0.05 level as determined by Duncan's multiple range test. Error bars represent ± standard error (SEM). DETAILED DESCRIPTION

[0014] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0015] Unless otherwise specified, the methods used in the following examples are all conventional methods.

[0016] Example 1

[0017] 1) Cloning of soybean C2H2 zinc finger transcription factor gene GmRGR1

[0018] The soybean variety Kefeng No. 1 was selected as the sample, and its leaves were ground in a mortar. The ground leaves were added to a 1.5 mL EP tube containing lysis solution, and after sufficient shaking, they were transferred to another 1.5 mL EP tube. Total RNA was extracted using the Total RNA Kit (Tiangen, Beijing, China). The quality of total RNA was identified by formaldehyde denaturing gel electrophoresis, and the RNA content was determined by a spectrophotometer. The obtained total RNA was used as a template and the reverse transcription kit (TaKaRa Primer Script TM RT reagent kit, Japan) was used for reverse transcription, and PCR amplification was performed after obtaining the first strand of cDNA. The PCR procedure was as follows: pre-denaturation at 95°C for 3 minutes, followed by denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, and extension at 72°C for 35 seconds, for 35 cycles, and finally incubation at 72°C for 5 minutes, followed by constant temperature at 4°C, to obtain the cDNA of Kefeng No. 1.

[0019] The gene corresponding to GmRGR1 was found in the NCBI database and Phytozome v13 soybean database (Glyma.12G237800, Gene ID: 100794446). Specific primers were designed according to the nucleotide sequence given in the database, and the primer sequences were F1: atgacagatc ctcagtccaa ttt and R1: tcacattgaa ctctccccat catgt. The gene was amplified from the gene coding region (CDS) sequence of the soybean variety Kefeng No. 1. After PCR cloning, the PCR product was tapped, purified, connected and transformed. The positive single clone was selected for sequencing, and the CDS sequence of the soybean GmRGR1 gene with a complete coding region and a length of 1059 bp was finally obtained. The coding region sequence is shown in SEQ ID NO.1, and the size is 1059 bp ( Figure 1 ), the amino acid sequence encoded by the gene is shown in SEQ ID NO.2.

[0020] 2) Tissue expression analysis of GmRGR1

[0021] In order to accurately identify the expression of GmRGR1 in different tissues, various tissues of soybean variety Kefeng No. 1 at different developmental stages were collected. Specifically, roots, stems and leaves in the V4 stage; mature flowers in the R2 stage; and seeds and pods collected 15 days after flowering. The collected samples were quickly placed in liquid nitrogen for quick freezing and then stored in an environment of -80℃. The extraction process of total RNA was consistent with step 1. The total RNA obtained from the above different tissues was used as a template to obtain cDNA by reverse transcription. The fluorescence quantitative primer sequences of GmRGR1 were F2: ctcagagaggcccttcctct and R2: cctctacaacatttgaggaggg. At the same time, the soybean composition internal reference gene Tubulin was selected as an internal reference to detect the expression changes of the GmRGR1 gene in various tissues. The primer sequences of Tubulin were F3: ggagttcacagaggcaga and R3: cacttacgcatcacatagca. On this basis, real-time fluorescence quantitative PCR reaction was carried out.

[0022] The GmRGR1 gene is mainly expressed in soybean leaves and seeds, followed by flowers and pods, and at lower levels in roots and stems ( Figure 2 ).

[0023] Example 2

[0024] 1) Cloning of soybean C2H2 zinc finger transcription factor gene GmRGR1

[0025] The total RNA from the leaves of soybean variety Kefeng No. 1 was used as a template. After the first chain of cDNA was synthesized by reverse transcription, PCR amplification was performed. The primer sequences are shown in F4: acaaatctat ctctctcgag atgacagatc ctcagtccaa ttt and R5: gctcaccatg gatcccattg aactctcccc atcatgt. The PCR program was as follows: pre-denaturation at 95°C for 3 minutes, followed by denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, and extension at 72°C for 35 seconds, and this was repeated for 35 cycles. Finally, the CDS sequence of the soybean GmRGR1 gene without a stop codon was obtained after sequencing.

[0026] 2) Construction of subcellular localization vector

[0027] When constructing the subcellular localization vector, the CDS sequence of the soybean GmRGR1 gene without a stop codon was inserted into the pFGC5941 expression vector with a GFP tag. The expression vector has a 35S promoter, which can strongly induce the expression of the target gene in the receptor. Subsequently, the vector was transferred into the Agrobacterium tumefaciens strain EHA105 using the freeze-thaw method. At the same time, the empty pFGC5941 was also transformed into EHA105 as an empty control.

[0028] 3) Subcellular localization of GmRGR1

[0029] The bacterial suspension containing 35S:GmRGR1-GFP and 35S:GFP was injected into 7- to 8-week-old Nicotiana benthamiana leaves. After 36 to 48 hours of culture, the localization of the reporter gene GFP was observed using a Leica TCSSP2 laser confocal microscope. According to the GFP signal, the GmRGR1-GFP fusion protein was only localized in the cell nucleus, while the GFP in the empty state was localized in the entire tobacco cell. ( Figure 3 ).

[0030] Example 3

[0031] 1) Construction of GmRGR1 transcriptionally active vector

[0032] When the transcriptional activity of GmRGR1 was determined in yeast, the CDS sequence of GmRGR1 was fused to the GAL4 DNA binding domain (BD) in the pGBKT7 vector. These constructs and the empty control BD were transformed into the yeast strain Y2HGold and then screened using the Matchmaker GAL4 two-hybrid system of Clontech, USA.

[0033] When the transcriptional activity of GmRGR1 was determined in Nicotiana benthamiana, GmRGR1 was cloned into the pCAMBIA1307-3×Flag vector as an effector. Other effectors (VP16 and GD1) and reporter genes (UAS) were constructed according to previous methods (Deng et al., 2022, Proceedings of the National Academy of Sciences, 119(50): e2210338119). Empty plasmids GAL4BD, GAL4BD-VP16, and GAL4BD-GD1 were used as negative controls, transcriptional activation controls, and transcriptional repression controls, respectively. The GV3101 strain containing reporter genes, effectors, and control constructs was mixed and co-infected into Nicotiana benthamiana leaves. Luciferase (LUC) imaging and LUC / REN activity detection were performed.

[0034] 1) GmRGR1 has transcriptional repression activity

[0035] When the transcriptional activity of GmRGR1 was measured in yeast, no transcriptional autoactivation activity of GmRGR1 was observed in yeast cells ( Figure 4 A), indicating that there may be a potential inhibitory domain in GmRGR1. Further dual-luciferase reporter gene assays in Nicotiana benthamiana leaves showed that compared with the empty vector GAL4BD, the expression of GmRGR1 resulted in lower luciferase activity, which was close to the enzyme activity of the transcriptional repression vector GAL4BD-GD1 ( Figure 4 BD). These results confirm that GmRGR1 encodes a transcription factor with transcriptional repressive activity on gene expression.

[0036] Example 4 Genetic Engineering Application of Gene GmRGR1

[0037] 1) Construction of plant expression vector

[0038] When constructing the overexpression vector for transforming Arabidopsis, primers F5: ctctctctcaagcttggatccatgacagatcctcagtccaattt R5: gatcaattcgagctcctgcagtcacattgaactctccccatcatgt were used to amplify and obtain the CDS sequence of GmRGR1 with restriction sites. The pHB vector (Shanghai Pujie Biotechnology Co., Ltd., China) was double-digested, and the restriction sites were divided into BamHI and PstI. The sequence was connected to the double-digested vector by homologous recombination to obtain the pHB-GmRGR1 plant overexpression vector. The plant transformation vector pHB contains a strong 35S promoter, which can strongly induce the expression of the target gene GmRGR1 in the receptor. The vector was then transferred into the Agrobacterium tumefaciens strain EHA105 by freeze-thaw method.

[0039] 2) Obtaining transgenic Arabidopsis plants

[0040] Arabidopsis thaliana was transformed using the flower-dip method. The wild-type Col-0 buds of Arabidopsis thaliana were immersed in the bacterial solution of the Agrobacterium tumefaciens strain EHA105 containing pHB-GmRGR1 in step 1) and infected for 30 seconds to 1 minute. The plants were wrapped with plastic wrap or a fresh-keeping bag to maintain humidity and cultured in the dark for 24 hours. Afterwards, the plants could be transformed again after a new batch of inflorescences grew out, depending on their growth conditions. The Arabidopsis thaliana was placed under normal conditions to continue growing and the seeds were harvested. Three homozygous 35S:GmRGR1 overexpressing transgenic Arabidopsis thaliana lines were selected for investigation of the chlorophyll phenotype, and the chlorophyll content of Arabidopsis thaliana was measured using a chlorophyll meter, SPAD-502. Figure 5A shows that compared with Col-0, the growth of 35S:GmRGR1 overexpressing transgenic Arabidopsis is weaker. Chlorophyll content determination shows that the chlorophyll content of 35S:GmRGR1 overexpressing transgenic Arabidopsis is significantly lower than that of Col-0 ( Figure 5 B), showing that overexpression of the GmRGR1 gene reduced the chlorophyll content in Arabidopsis thaliana.

Claims

1. Application of soybean C2H2-type zinc finger transcription factor gene GmRGR1 shown in SEQ ID NO.1 in genetic engineering modification of chlorophyll content in Arabidopsis thaliana.

2. The use according to claim 1, characterized in that Overexpression of the GmRGR1 gene can reduce the chlorophyll content in Arabidopsis thaliana.

Images