Method for increasing content of catharanthine in hairy roots of catharanthus roseus

Abstract

The invention belongs to the technical field of natural medicines, and particularly relates to a method for increasing the content of catharanthine in hairy roots of catharanthus roseus, which is characterized by comprising the following steps: extracting RNA (Ribonucleic Acid) of the catharanthus roseus, carrying out reverse transcription to obtain cDNA (Complementary Deoxyribonucleic Acid), carrying out PCR (Polymerase Chain Reaction) amplification by taking the cDNA as a template to respectively obtain GS (Glutathione S) and CS (Citrus S), with the nucleotide sequence of the GS as shown in SEQ ID NO.9 and the nucleotide sequence of the CS as shown in SEQ ID NO.10; gS and CS are jointly cloned into an overexpression vector, and a double-gene expression vector is obtained; infecting the catharanthus roseus by using the double-gene expression vector; the infected catharanthus roseus is sequentially subjected to screening culture and subculture, an inducer is added in the subculture process, and the inducer is dexamethasone. Through the method provided by the invention, the content of catharanthine in the catharanthus roseus can be increased by 67% or above. The method for increasing the content of the vinblastine in the hairy roots of the catharanthus roseus is established, and a foundation is laid for large-scale production of the direct precursor vinblastine of an anti-cancer drug through the hairy roots.

Description

Technical Field

[0001] The invention belongs to the technical field of natural medicines, and in particular relates to a method for increasing the content of catharanthine in catharanthus roseus hairy roots. Background Art

[0002] Vinblastine and its derivatives are the most widely used class of chemotherapeutic drugs in clinical practice. They belong to a class of secondary metabolites synthesized by the plant Catharanthus roseus, called monoterpenoid indole alkaloids, or MIAs for short. However, due to the complex structure and difficulty of chemical synthesis of MIAs, the vinblastine supply chain relies on low-yield extraction and purification of precursors vindoline and vinblastine from the plant Catharanthus roseus, followed by simple in vitro chemical coupling and reduction to form industrial-scale vinblastine. However, the content of MIAs in Catharanthus roseus is extremely low, with the content of vinblastine in the dry weight of Catharanthus roseus being only 1g / 1000kg, and the content of its precursors vindoline and vindoline being only about one thousandth. Therefore, the development of bio-metabolism reactors for large-scale and stable production of vinblastine or its precursors vindoline or vindoline has always been an urgent problem to be solved in the field of metabolic engineering.

[0003] Catharanthus roseus MIAs metabolic network is huge, involving more than 30 enzymes and more than 40 intermediate metabolites. The MIAs metabolic pathway is complex and there are many competing pathways for the synthesis of catharanthus alkaloids. In the past, the targets of metabolic engineering transformation of Catharanthus roseus hairy roots were mostly concentrated in the upstream or midstream of the MIAs synthesis pathway, such as STR, G10H, AS, TDC and other genes, but the transformation of these genes had little effect on the content of catharanthus alkaloids. Therefore, it is urgent to provide a new method to increase the content of catharanthus alkaloids in Catharanthus roseus. Summary of the invention

[0004] The invention aims to provide a method for increasing the content of catharanthine in hairy roots of Catharanthus roseus, thereby solving the problem of low yield of catharanthine produced by Catharanthus roseus in the prior art.

[0005] The technical solution adopted by the present invention is:

[0006] The present invention provides a method for increasing the content of catharanthine in hairy roots of Catharanthus roseus, comprising the following steps:

[0007] Extract RNA from Catharanthus roseus, reverse transcribe to obtain cDNA, use cDNA as template to perform PCR amplification to obtain GS and CS respectively, the nucleotide sequence of GS is shown in SEQ ID NO.9, and the nucleotide sequence of CS is shown in SEQ ID NO.10; clone GS and CS into an expression vector to obtain a double gene expression vector; use the double gene expression vector to infect Catharanthus roseus; perform screening culture and subculture on the infected Catharanthus roseus in sequence, and add an inducer during the subculture process, wherein the inducer is dexamethasone.

[0008] Preferably, the overexpression vector comprises any one of pBI121, pCAMBIA1301 and pTA7002.

[0009] Preferably, the process of infecting Catharanthus roseus with the double gene expression vector is: transferring the double gene expression vector into Agrobacterium rhizogenes competent cells; expanding the culture to obtain Agrobacterium rhizogenes bacterial solution; and using the Agrobacterium rhizogenes bacterial solution to infect Catharanthus roseus seedlings.

[0010] Preferably, the Agrobacterium rhizogenes competent cell is any one of ATCC15834, C58C1, MSU440 and K599.

[0011] Preferably, the infected site of the Catharanthus roseus seedlings is the hypocotyl.

[0012] Preferably, the conditions for the expanded culture are 28° C., 4 h.

[0013] Preferably, the working concentration of dexamethasone is 3 μM to 3.5 μM.

[0014] Preferably, the working concentration of dexamethasone is 3 μM.

[0015] Preferably, the screening culture medium for screening culture has a formula of 30 g sucrose, 1.55 g Gamborg's B-5 basic mixed salts, 10 mL full-strength Gamborg's vitamins, 30 mg hygromycin, 30 mg cephalosporin and 6 g agar per liter of screening culture medium, and the remainder is made up to 1 L with water; the formula of full-strength Gamborg's vitamins is that each liter of full-strength Gamborg's vitamins contains 1 mg thiamine, 1 mg pyridoxine, 1 mg niacin, 100 mg inositol and 0.01 mg biotin, and the remainder is made up to 1 L with water.

[0016] Preferably, the formula of the subculture medium for subculture is that each liter of the subculture medium contains 30 g of sucrose, 1.55 g of Gamborg's B-5 basic mixed salts, 10 mL of full-strength Gamborg's vitamins, and the rest is made up to 1 L with water; the formula of the full-strength Gamborg's vitamins is that each liter of full-strength Gamborg's vitamins contains 1 mg of thiamine, 1 mg of pyridoxine, 1 mg of niacin, 100 mg of inositol and 0.01 mg of biotin, and the rest is made up to 1 L with water.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The present invention provides a method for increasing the content of catharanthine in hairy roots of Catharanthus roseus, comprising the following steps:

[0019] Extract RNA from Catharanthus roseus, reverse transcribe to obtain cDNA, use cDNA as template for PCR amplification, obtain GS and CS respectively, the nucleotide sequence of GS is shown in SEQ ID NO.9, and the nucleotide sequence of CS is shown in SEQ ID NO.10; clone GS and CS into an expression vector to obtain a double gene expression vector; use the double gene expression vector to infect Catharanthus roseus; perform screening culture and subculture on the infected Catharanthus roseus in sequence, and add an inducer during the subculture process, wherein the inducer is dexamethasone. The method of the present invention can increase the content of vinblastine in Catharanthus roseus by more than 67%.

[0020] The object of the present invention is to overcome the deficiencies of the prior art and provide a metabolic engineering method for increasing the content of catharanthus in hairy roots of Catharanthus roseus. The key enzyme gene cloning, expression vector construction, Agrobacterium transformation, molecular detection, alkaloid extraction and content determination, and fluorescence quantitative qPCR analysis involved in the present invention are used in the present invention to establish a method for increasing the content of catharanthus in hairy roots of Catharanthus roseus, laying a foundation for large-scale production of catharanthus, the direct precursor of anticancer drugs, through hairy roots. The hairy root system induced by Agrobacterium rhizogenes has the advantages of fast growth rate, good production stability, genetic transformation, and scalable production, especially the content of catharanthus is equivalent to that of stem and leaf tissues, and is an ideal catharanthus synthesis bioreactor.

[0021] The invention extracts RNA from Catharanthus roseus seedlings, reversely transcribes it into cDNA, clones GS and CS genes respectively, constructs them into pTA7002 inducible expression vector, transfers pTA7002 expression vector into Agrobacterium rhizogenes ATCC15834, and transfers GS and CS genes into Catharanthus roseus hairy roots at the same time through Agrobacterium rhizogenes mediation. PCR and fluorescence quantitative qPCR are used to detect the expression of exogenous genes, and high performance liquid chromatography is used to determine the content of related alkaloids in Catharanthus roseus hairy roots. By the method of the invention, the content of vinblastine produced by Catharanthus roseus is significantly increased. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the colony PCR screening of recombinants for pUCGALA-GS. Lanes 1 to 10 are 10 randomly selected single colonies.

[0023] Figure 2 This is the colony PCR screening of recombinants for pUCGALA-CS. Lanes 1 to 14 are 14 different single colonies randomly picked.

[0024] Figure 3 This is the colony PCR screening of recombinants of pTA7002-GS. Lanes 1 to 10 are 10 randomly selected single colonies.

[0025] Figure 4 This is the colony PCR screening of recombinants of pTA7002-GS-CS. Lanes 1 to 9 are 9 different single colonies randomly picked.

[0026] Figure 5 The GS mRNA content changes at different times.

[0027] Figure 6 The changes in CS mRNA content at different times.

[0028] Figure 7 is the vinblastine content at different time points after overexpression of GS and CS genes. DETAILED DESCRIPTION

[0029] The present invention is further described below by specific examples, but the scope of the present invention is not limited thereto. The details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications or replacements all fall within the protection scope of the present invention.

[0030] The inventive concept of the present invention is as follows:

[0031] In Catharanthus roseus, the MIA metabolic pathway is complex and there are many competing pathways for the synthesis of catharanthus alkaloids. In the past, the targets of metabolic engineering transformation of Catharanthus roseus hairy roots were mostly concentrated in the upstream or midstream of the MIA synthesis pathway, such as STR, G10H, AS, TDC and other genes, but the transformation of these genes had little effect on the content of catharanthus alkaloids.

[0032] Based on this, the present invention provides a method for increasing the content of catharanthine in hairy roots of Catharanthus roseus, comprising the following steps:

[0033] Extract RNA from Catharanthus roseus, reverse transcribe to obtain cDNA, use cDNA as template to perform PCR amplification to obtain GS and CS respectively, the nucleotide sequence of GS is shown in SEQ ID NO.9, and the nucleotide sequence of CS is shown in SEQ ID NO.10; clone GS and CS into an expression vector to obtain a double gene expression vector; use the double gene expression vector to infect Catharanthus roseus; perform screening culture and subculture on the infected Catharanthus roseus in sequence, and add an inducer during the subculture process, wherein the inducer is dexamethasone.

[0034] The geissoschizine synthase, GS for short, and the catharanthine synthase, CS for short, of the MIA metabolic pathway are located at the mid- and downstream branch nodes of the MIA metabolic pathway and are key enzymes for synthesizing catharanthine. The present invention co-transforms the GS and CS genes into Catharanthine hairy roots to overexpress both genes, thereby breaking the key rate-limiting bottleneck and increasing the catharanthine content, obtaining catharanthine high-yield hairy roots, and providing an innovative solution for large-scale production of catharanthine.

[0035] In order to enable those skilled in the art to better understand the technical solution of the present invention and implement it, the present invention is further described below in conjunction with specific embodiments. In the description of the present invention, unless otherwise specified, the reagents used are all commercially available, and the methods used are all conventional techniques in the art.

[0036] Example 1

[0037] A method for increasing the content of catharanthine in hairy roots of Catharanthus roseus, the method is as follows:

[0038] (1) Aseptic culture of Catharanthus roseus, as follows:

[0039] Soak Catharanthus roseus seeds in 40% sodium hypochlorite disinfectant for 10 minutes, rinse with sterile water 4 times until no sodium hypochlorite disinfectant remains, inoculate in a hormone-free solid culture medium, and culture in an incubator at 25°C, 16 h light / 8 h dark to obtain Catharanthus roseus sterile seedlings. After the seedlings grow to about 6 cm in about 4 weeks, cut the leaves for RNA extraction.

[0040] The formula of the solid medium is: 30 g / L sucrose, 1.55 g / L Gamborg's B-5 basic mixed salts, 6 g / L agar, 10 mL / L full-strength Gamborg's vitamins, and the solvent is water.

[0041] Full strength Gamborg's vitamins are formulated with 1 mg / L thiamine, 1 mg / L pyridoxine, 1 mg / L niacin, 100 mg / L inositol and 0.01 mg / L biotin in water.

[0042] (2) RNA extraction, purification, and reverse transcription into cDNA are as follows:

[0043] Weigh 0.1g of sterile leaves of Catharanthus roseus seedlings, put them into a pre-cooled mortar, add liquid nitrogen and grind them quickly, add 1mL Trizol, Trizol Reagents, purchased from Beyotime, continue grinding, transfer to a 1.5mL centrifuge tube, vortex and mix, and place on ice for 10min. During this period, continue to vortex and oscillate intermittently to ensure that the ground plant material and Trizol are evenly mixed. Centrifuge the sample at 12000rpm for 10min at 4℃, aspirate the supernatant into a new 1.5mL centrifuge tube, add 200μL 4℃ pre-cooled chloroform, vortex and oscillate, let stand on ice for 3min, vortex and oscillate again, let stand on ice for 2min. Centrifuge the sample at 12000rpm for 10min at 4℃, aspirate the supernatant into a new 1.5mL centrifuge tube, add 100μL 4℃ pre-cooled chloroform, vortex and oscillate, let stand on ice for 3min. Vortex and oscillate again, let stand on ice for 2min. Centrifuge the sample at 12000rpm for 10min at 4℃, aspirate the supernatant into a new 1.5mL centrifuge tube, add 100μL 4℃ pre-cooled chloroform, vortex and oscillate, let stand on ice for 3min. At 4°C, centrifuge the sample at 12000rpm for 10 minutes, aspirate the supernatant into a new 1.5mL centrifuge tube, add an equal volume of 4°C pre-cooled isopropanol, invert to mix evenly, and let stand at -20°C for 30 minutes. Centrifuge the sample after low-temperature standing at 4°C at 12000rpm for 10 minutes, discard the supernatant, add 1mL of 4°C pre-cooled 75% ethanol, and wash the precipitate. Centrifuge the sample at 4°C, 12000rpm for 10 minutes, discard the supernatant, and dry the residual ethanol. Add 20μL of 4°C pre-cooled DEPC water to dissolve the precipitate to obtain total RNA. Use TAKARA's reverse transcription kit, namely PrimeScript TM RT reagent Kitwith gDNAEraser, Catalog No. RR047Q, reverse transcribe RNA into cDNA.

[0044] (3) PCR amplification of target genes GS and CS as follows:

[0045] According to the coding sequence of GS and CS, primers were designed respectively. The primer sequences are shown in Table 1. Xho I and Spe I restriction endonuclease sites were introduced into the upstream and downstream primers respectively to construct the expression vector. Using cDNA as template, the two target genes GS and CS were amplified respectively using the Q5 High-Fidelity 2X Master Mix kit of NEB Company. The PCR cycle parameters were 95℃, 3min; 95℃, 15s; 67℃, 15s; 72℃, 1min; 35 cycles, 72℃, 5min; finally, the PCR product was stored at 4℃. Gel electrophoresis verified the correct size of the PCR product.

[0046] Table 1 Primer sequence list

[0047] GS-F 5'-CCGCTCGAGATGGCCGGAGAAACAAC-3' SEQ ID NO.1 GS-R 5'-GACTAGTTCATTCCTCAAATTTCAATGTATTTCCAATGTC-3' SEQ ID NO.2 CS-F 5'-CCGCTCGAGATGAATTCCTCAACTGATCC-3' SEQ ID NO.3 CS-R 5'-GACTAGTTTACTCATGTTTGATGAAAGATGC-3' SEQ ID NO.4

[0048] The nucleotide sequence of GS used to construct the subsequent vector is shown in SEQ ID NO.9, and the nucleotide sequence of CS is shown in SEQ ID NO.10.

[0049] SEQ ID NO.9:

[0050]

[0051] SEQ ID NO.10:

[0052] ATGAATTCCTCAACTGATCCAACTTCAGATGAGACTATTTGGGATCTTTCTCCATATATTAAAATTTTCAAAGATGGAAGAGTAGAAAGACTCCATAATAGTCCTTATGTTCCCCCATCACTTAATGATCCAGAAACTGGCGTTTCTTGGAAAGATGTCCCGATTTCATCACAAGTTTCCGCTAGGGTATACATTCCAAAAATCAGCGACCATGAAAAACTCCCTATTTTTGTGTATGTGCATGGGGCTGGCTTTTGTCTAGAATCTGCCTTCAGATCATTTTTCCACACTTTTGTCAAACACTTCGTAGCCGAAACCAAAGTTATTGGGGTTTCGATTGAATATAGACTTGCCCCAGAGCACCTTTTACCCGCAGCTTATGAAGATTGTTGGGAAGCCCTTCAATGGGTTGCTTCTCATGTGGGTCTCGACAATTCCGGCCTAAAGACAGCTATTGATAAAGATCCATGGATAATAAACTATGGTGATTTCGATAGACTGTATTTGGCGGGTGACAGTCCTGGTGCTAATATTGTTCACAACACACTTATCAGAGCTGGAAAAGAGAAACTGAAGGGCGGAGTGAAAATTTTGGGGGCAATTCTTTACTACCCATATTTCATTATCCCAACCAGCACGAAACTTAGTGATGATTTTGAGTATAACTACACATGTTACTGGAAATTGGCTTATCCAAATGCTCCTGGCGGGATGAATAACCCAATGATAAACCCCATAGCTGAAAATGCTCCAGACTTGGCTGGATACGGTTGCTCGAGGTTGTTGGTTACCCTGGTTTCCATGATTTCAACGACTCCAGATGAGACTAAAGACATAAATGCGGTTTATATTGAGGCATTAGAAAAGAGTGGATGGAAAGGGGAATTGGAAGTGGCTGATTTTGACGCAGATTATTTTGAACTCTTCACCTTGGAAACGGAGATGGGCAAGAATATGTTCAGACGTTTAGCATCTTTCATCAAACATGAGTAA。

[0053] (4) Construction of a plant double gene expression vector containing GS and CS genes is as follows:

[0054] In order to facilitate gene preservation and experiment convenience and practicality, the present invention constructs GS and CS into pUCGALA-GS respectively, obtains two recombinant vectors pUCGALA-GS and pUCGALA-CS, and then amplifies the sequences of GS and CS from pUCGALA-GS and pUCGALA-CS respectively to construct the double gene expression vector PTA7002-GS-CS. The fragments of GS and CS amplified from cDNA can also be directly used, and the sequence information of the GS and CS fragments is shown in SEQ ID NO.9 and SEQ ID NO.10, to construct the double gene expression vector PTA7002-GS-CS.

[0055] (4.1) Construction of pUCGALA-GS and pUCGALA-CS vectors is as follows:

[0056] The pUCGALA vector was used, which has a GAL4-UAS inducible promoter and a 3A terminator. The pUCGALA vector, GS and CS fragments were double-digested with Xho I and Spe I, and the GS and CS genes after digestion were ligated to the pUCGALA vector using TAKARA's T4 DNA ligase, transformed into competent Escherichia coli DH5α, and screened on LB medium containing ampicillin. The colony PCR test was verified using the Novizan 2×TaqMasterMix kit, and the results were as follows: Figure 1 and Figure 2 Select Figure 1 Colony No. 3, Figure 2 The No. 13 colony was sent for sequencing, and it was confirmed that No. 3 was a pUCGALA-GS recombinant and No. 13 was a pUCGALA-CS recombinant.

[0057] (4.2) Construction of the double gene expression vector pTA7002-GS-CS is as follows:

[0058] The intermediate vector pUGGALA-GS was double-digested with Xho I and Spe I to obtain the GS gene coding sequence DNA fragment. The linearized plant expression vector pTA7002 was digested with Xho I and Spe I. The GS gene was ligated to the linearized vector pTA7002 using TAKARA's T4 DNA ligase, and transformed into Escherichia coli DH5α. The cells were screened on LB medium containing kanamycin. Single clones were selected for colony PCR screening using Novizan 2×TaqMasterMix. The results are shown in the figure. Figure 3, and the GS gene expression vector pTA7002-GS was obtained. Colony No. 4 was selected and sent to BGI for sequencing. The intermediate vector pUCGALA-CS was digested with Xho I and SbfI, and the CS gene expression cassette was recovered by electrophoresis and gel cutting, and connected with the pTA7002-GS linearized by SbfI, and transformed into Escherichia coli DH5α, screened on LB medium containing kanamycin, and a single colony was picked for colony PCR screening. The results are as follows: Figure 4 , colony No. 7 was selected and sent to BGI for sequencing, and the dual-gene expression vector pTA7002-GS-CS driven by an inducible promoter was obtained.

[0059] (5) The dual gene expression vector pTA7002-GS-CS was used to infect Catharanthus roseus, and the GS and CS genes were genetically transformed into Catharanthus roseus mediated by Agrobacterium rhizogenes to obtain transgenic hairy roots as follows:

[0060] (5.1) The dual gene expression vector pTA7002-GS-CS was transformed into Agrobacterium rhizogenes.

[0061] The plant double gene expression vector pTA7002-GS-CS was extracted and purified, and then transferred into the competent state of Agrobacterium rhizogenes ATCC15834 using BIO-RAD, GenePulserXCell electroporator. The conditions for electroporation were voltage 2.5KV, resistance 200Ω, and electroporation cup size 2mm. Immediately after electroporation, 1mL YEM medium was added, and cultured for 4 hours at 28℃ to obtain the Agrobacterium rhizogenes bacterial solution. The bacterial solution was applied to the YEM solid medium containing kanamycin and placed in a 28℃ incubator overnight. Single colonies were picked for PCR verification. The results showed that the plant double gene expression vector containing the GS and CS gene expression frames had been successfully constructed into the Agrobacterium rhizogenes strain.

[0062] (5.2) Agrobacterium rhizogenes-mediated transformation of GS and CS genes into Catharanthus roseus.

[0063] Agrobacterium rhizogenes infects Catharanthus roseus seedlings to obtain hairy roots: Agrobacterium rhizogenes successfully transferred with the double gene expression vector is cultured in a shaking incubator until the OD is about 0.7, and the hypocotyl of the Catharanthus roseus seedling is wounded with tweezers after dipping in the bacterial solution to infect Catharanthus roseus. Hairy roots are formed at the wound after 8 weeks.

[0064] (6) Screening culture and subculture.

[0065] Screening culture: Transgenic hairy roots were screened in a screening medium containing hygromycin and cephalosporin, and the screened hairy roots were stably subcultured in liquid. The hygromycin resistance gene HPT was used to screen hairy roots with the target gene, and cephalosporin was used to remove excess Agrobacterium in the culture medium. A transgenic hairy root that could grow in the screening medium was obtained and named #10-2. The transgenic hairy root grew rapidly, with an increasing number of root hairs and branches, and had the characteristics of a typical hairy root.

[0066] Subculture: #10-2 was transferred to subculture medium for subculture. 18 days after subculture, the inducer dexamethasone was added to the culture medium for continued culture.

[0067] The formula of the screening medium is: 30g / L sucrose, 1.55g / L Gamborg's B-5 basic mixed salts, 10mL / L full strength Gamborg's vitamins, 30μg / ml hygromycin, 30μg / ml cephalosporin and 6g / L agar, and the solvent is water.

[0068] The formula of the secondary culture medium is: 30g / L sucrose, 1.55g / L Gamborg's B-5 basic mixed salts, 10mL / L full-strength Gamborg's vitamins, and the solvent is water.

[0069] Fluorescence quantitative qPCR was used to detect the overexpression of GS and CS genes in transgenic Catharanthus roseus hairy roots, as follows:

[0070] 1. Liquid subculture of Catharanthus roseus hairy roots.

[0071] After screening and cultivation, seven transgenic Catharanthus roseus hairy roots of about 7 cm in diameter were taken in a clean bench and placed in a 250 ml conical flask containing 50 ml of hairy root liquid culture medium, which consisted of 30 g / L sucrose,

[0072] 1.55g / L Gamborg's B-5 basic mixed salt and Gamborg's vitamins were used. The culture flasks were placed in a shaking incubator at 26°C and 110 rpm for culture and subcultured after three weeks.

[0073] 2. Induce overexpression of GS and CS genes in transgenic hairy roots.

[0074] At the late exponential growth stage of hairy roots, i.e. 18 days after subculture, they were divided into two groups. One group was added with 3 μM inducer dexamethasone in the culture medium to induce overexpression of GS and CS genes in #10-2 hairy roots, recorded as induced overexpression group; the other group was added with 0.1% ethanol in the culture medium, as the control group uninduced. Samples were collected after 0h, 24h, 48h, 72h, and 96h of induction, respectively, for subsequent fluorescence quantitative qPCR detection and alkaloid content determination. Each treatment had three biological replicates.

[0075] 3. Fluorescence quantitative qPCR was used to detect the changes in mRNA content of GS and CS in transgenic Catharanthus roseus hairy roots.

[0076] The hairy root samples were dried with paper towels, ground with liquid nitrogen, and RNA from the hairy roots was extracted using Trizol. The reverse transcription kit from TAKARA, PrimeScript TM RT reagent Kit with gDNA Eraser, catalog number RR047Q, reverse transcription to synthesize cDNA, and dilute cDNA 10 times to 200 μL with nuclease-free water as qPCR template. qPCR primers are shown in Table 2. The 20 μL qPCR reaction system contains 1 μL cDNA, 0.8 μL primers, 10 μL 2xTaqPro Universal SYBRqPCRMasterMix enzyme and nuclease-free water. qPCR amplification was performed in the BIO-RAD Real-Time PCR detection system, and the program was 95°C 30s, 1 cycle; 95°C 10s, 60°C 30s, 40 cycles; measure the CT value. The relative changes in the mRNA content of GS and CS at each time were calculated using the ΔΔCT method, and the results are shown in the figure. Figure 5 and Figure 6 As shown, after the addition of inducer, the mRNA expression levels of the transferred genes GS and GS increased significantly compared with the control, indicating that the transgenic and induced gene overexpression was successful.

[0077] Table 2 Fluorescence quantitative PCR primers for GS and CS

[0078] qPCR-GS-F 5'-TTACCGTGAGCAAGGGGAAC-3' SEQ ID NO.5 qPCR-GS-R 5'-TCCTGGCTTATCGAGTCCCA-3' SEQ ID NO.6 qPCR-CS-F 5'-ACGACTCCAGATGAGACTAAA-3' SEQ ID NO.7 qPCR-CS-F 5'-AACATATTCTTGCCCATCTCC-3' SEQ ID NO.8

[0079] The content of MIAs in transgenic Catharanthus roseus hairy roots was determined by HPLC as follows:

[0080] 1. Chromatographic conditions and preparation of standard solutions.

[0081] Chromatographic column: C-18 reverse phase silica gel column, purchased from Agilent, parameters: 5μm, 250mm×4.6mm. The detection wavelength of vinblastine and vinblastine is 254nm, the detection wavelength of hydrolicycyrrhizine is 329nm, the column temperature is 28℃, the flow rate is 1mL / min, and the injection volume is 10μL. Accurately weigh 1mg of vinblastine, vinblastine, vinblastine and hydrolicycyrrhizine, respectively, and completely dissolve them with 1mL of methanol to obtain a 1mg / mL reference solution as a standard stock solution, which is stored at -20℃ for use. HPLC mobile phase A: contains 50% methanol / 50% acetonitrile, mobile phase B: 5mM diamine phosphate buffer at pH 7.3. HPLC chromatographic conditions: 0min~5min, mobile phase A: mobile phase B is 3:7, 10min~30min, mobile phase A: mobile phase B is 8:3, 35min~50min, mobile phase A: mobile phase B is 4:1, 50min~60min, mobile phase A: mobile phase B is 3:7, and the flow rate is 1mL / min. The retention times of catharanthine, anacardine, scutellarine and glycyrrhizine are 22.5min, 23.2min, 18.6min and 38.9min respectively. The peak shape is good.

[0082] 2. Preparation of standard curve.

[0083] The reference solution was diluted to 50 μg / mL, 100 μg / mL, 200 μg / mL, 300 μg / mL, 400 μg / mL, and 500 μg / mL, respectively, and the sample was injected under the corresponding chromatographic conditions, and the chromatographic parameters were recorded. The peak area was used to perform regression analysis on the concentration of the standard, wherein the peak area was represented by Y, the concentration of the standard was represented by X, and the unit of the concentration of the standard was μg / mL. Through the study, the linear regression equations of the reference substances of catharanthine, argan, scutellariae, and glycyrrhizine were obtained as shown in Table 3. Where Y catharanthine、 Y tabersonine , Y serpentine and Y ajmalicine The peak areas are catharanthine, glycyrrhizine, scutellarine and anesthetic, respectively.

[0084] Table 3 Linear regression equation

[0085] name Regression equation R2 Catharanthine <![CDATA[Y catharanthine =5.612x+12.605]]> R2＝0.9997 Glycyrrhizin <![CDATA[Y tabersonine =46.226x-770.12]]> <![CDATA[R 2 =0.9932]]> Snake skin alkaloid <h2 style=";text-align:left;direction:ltr"><![CDATA[Y <h2 style=";text-align:left;direction:ltr"> serpentine <h2 style=";text-align:left;direction:ltr"> =133.33x-4444.1]]><h2 style=";text-align:left;direction:ltr"> <![CDATA[R 2 =0.9965]]> Anephrine <![CDATA[Y ajmalicine =18.28x-70.819]]> <![CDATA[R 2 =0.9936]]>

[0086] 3. Sample preparation and determination of MIAs content.

[0087] At the late exponential growth stage of hairy roots. 18 days after subculture, they were divided into two groups: one group was added with 3 μM inducer dexamethasone to induce overexpression of GS and CS genes, which was the induced overexpression group; the other group was added with an equal volume of ethanol, which was the control group uninduced. Samples were collected after 0h, 24h, 48h, 72h, and 96h of induction. There were three biological replicates for each treatment. The hairy roots were dried and frozen at -80℃. The hairy roots were freeze-dried using a freeze dryer, and the freeze-dried samples were ground in a mortar. 50 mg of powder was weighed, 25 mL of methanol was added, and the extract was extracted for 10 min using a BRANSON ultrasonic purchased from Digital Sonicator. The extract was centrifuged at 6000 rpm and 4℃ for 15 min. The supernatant was concentrated to 2 mL using a vortex evaporator. The manufacturer and model of the vortex evaporator were LABCONCO, RapidVap 7670520, and the HPLC sample was obtained by filtration with a 0.22 mm nylon membrane. The alkaloids in the samples were analyzed according to the above chromatographic conditions, and the MIAs content in the samples was calculated according to the linear regression equation of the standard curve. The results are shown in Figure 7 , overexpression of GS and CS genes for 96 hours increased the content of vinblastine by 67% compared with the control. Figure 7 In the table, different lowercase letters indicate significant differences in the values ​​of samples under different treatments at the same time, p < 0.05; different uppercase letters indicate significant differences in the values ​​of samples under the same treatment at different times, p < 0.05. Values ​​are expressed as mean ± standard deviation, n = 3.

[0088] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0089] The above-mentioned embodiments only express several implementation methods of the present invention, and the description is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A method for increasing the content of catharanthine in hairy roots of Catharanthus roseus, characterized in that: The following steps are involved: Extract RNA from Catharanthus roseus, reverse transcribe to obtain cDNA, use cDNA as template for PCR amplification to obtain GS and CS, respectively. The nucleotide sequence of GS is shown in SEQ ID NO.9, and the nucleotide sequence of CS is shown in SEQ ID NO.

10. GS and CS were co-cloned into the overexpression vector to obtain a double gene expression vector; Catharanthus roseus was infected with a double gene expression vector; After infection, the Catharanthus roseus is subjected to screening culture and subculture in sequence, and an inducer is added during the subculture process, wherein the inducer is dexamethasone.

2. The method according to claim 1, characterized in that The overexpression vector includes any one of pBI121, pCAMBIA1301 and PTA7002.

3. The method according to claim 1, characterized in that The process of infecting Catharanthus roseus with the double gene expression vector is as follows: The double gene expression vector was transformed into Agrobacterium rhizogenes competent cells; Expand the culture to obtain Agrobacterium rhizogenes bacterial solution; Use Agrobacterium rhizogenes to infect Catharanthus roseus seedlings.

4. The method according to claim 3, characterized in that The Agrobacterium rhizogenes competent cell is any one of ATCC15834, C58C1, MSU440 and K599.

5. The method according to claim 3, characterized in that The infected part of the Catharanthus roseus seedlings is the hypocotyl.

6. The method according to claim 3, characterized in that The conditions for the expanded culture are 28° C., 4 h.

7. The method according to claim 1, characterized in that The working concentration of dexamethasone is 3 μM to 3.5 μM.

8. The method according to claim 7, characterized in that The working concentration of dexamethasone was 3 μM.

9. The method according to claim 1, characterized in that The screening medium for screening culture is formulated as follows: per liter of screening medium, 30 g sucrose, 1.55 g Gamborg's B-5 basic mixed salts, 10 mL full-strength Gamborg's vitamins, 30 mg hygromycin, 30 mg cephalosporin and 6 g agar, and the remainder is made up to 1 L with water; The full-strength Gamborg's vitamins have a formula of 1 mg thiamine, 1 mg pyridoxine, 1 mg niacin, 100 mg inositol and 0.01 mg biotin per liter of full-strength Gamborg's vitamins, with the remainder made up to 1 liter with water.

10. The method according to claim 1, characterized in that The formula of the subculture medium for subculture is that each liter of subculture medium contains 30g sucrose, 1.55g Gamborg's B-5 basic mixed salts, 10mL full-strength Gamborg's vitamins, and the rest is made up to 1L with water; The full-strength Gamborg's vitamins have a formula of 1 mg thiamine, 1 mg pyridoxine, 1 mg niacin, 100 mg inositol and 0.01 mg biotin per liter of full-strength Gamborg's vitamins, with the remainder made up to 1 liter with water.

Images