Application of wheat TaNIP1-D1 gene in increasing wheat tiller number

Abstract

The invention discloses a wheat tillering related gene TaNIP1-D1, the CDS (Coding Sequence) of the gene is as shown in SEQ ID No.3, and the sequence of a protein coded by the gene is as shown in SEQ ID No.4. The invention also discloses the phenotype change of the TaNIP1-D1 gene overexpression vector and the CRISPR / Cas9 gene knockout vector. Wheat genetic transformation experiments and further phenotypic analysis find that compared with wild Fielder, the tiller number of a TaNIP1-D1 overexpressed plant is increased, meanwhile, the ear length is increased, grains are enlarged, the thousand seed weight is increased, and finally the yield of a single plant can be increased; however, the tiller number of the TaNIP1-D1 gene knockout plant is reduced, meanwhile, the ear length is shortened, grains become small, the thousand seed weight is reduced, and finally the yield of a single plant is reduced. The experimental result can be used in the field of transgenic breeding, and can lay a theoretical foundation for wheat yield increase and character improvement.

Description

Technical Field

[0001] This research belongs to the field of plant genetic engineering and wheat molecular breeding, and specifically involves the application of a wheat TaNIP1-D1 gene in increasing the number of wheat tillers. Background Art

[0002] Wheat (Triticum aestivum L.) is the second largest food crop in my country. Improving its yield and quality is of great significance to ensuring my country's food security. In recent years, due to the reduction and destruction of cultivated land and the increase of natural disasters, wheat production has dropped sharply, posing a huge hidden danger to my country's food security. It is urgent to cultivate new wheat varieties with stable and high yield.

[0003] The key to wheat yield lies in three core factors, namely the number of ears per plant, the number of grains per ear, and the thousand-grain weight. The number of ears per plant is usually the key factor among the three core factors, while the formation of tillers and ear formation are the key factors that determine the number of ears. In addition, the shape and number of wheat grains are directly related to the yield. Therefore, studying the molecular mechanism and developmental laws of wheat tillering, ear formation, and wheat grain formation is of great significance to improving wheat yield and plant type improvement.

[0004] Tillering of Gramineae plants starts from axillary meristem (AM), and its occurrence requires two continuous special processes: the initiation of axillary meristem and the elongation of lateral buds. The production of tillers is regulated by genetic factors, as well as hormones and the external environment. For example, in rice, the MOC1 (MONOCULM1) gene is a key tillering regulatory gene. The occurrence and growth of axillary meristems in moc1 mutants are simultaneously inhibited, resulting in a single-stem phenotype. The overexpression of MOC1 transgenic lines has significantly increased tillers, especially the tiller buds on the upper elongated internodes can also develop into high-position tillers, indicating that MOC1 is not only involved in the initiation and maintenance of axillary meristems, but also in the formation of spikelet meristems. MOC3 / TAB1 encodes a member of the WOX protein family and is the orthologous gene of the Arabidopsis WUS gene in rice. The tab1 mutant cannot form axillary buds, has no tillers, and has a single-stem phenotype; in the reproductive stage, it can only produce one inflorescence, with a reduced number of spikelets and morphological defects. MOC3 / TAB1 may be located downstream of MOC1 or LAX1, or regulate the formation of tiller buds through a pathway that is independent of MOC1 or LAX1.

[0005] Plant hormones play a key regulatory role in the tillering process. Auxin and cytokinin are the two most important hormones. Auxin is mainly produced at the top of the plant and reaches the axil through polar transport. The function of auxin is to inhibit the growth of axillary meristems and maintain the apical dominance of plants. Cytokinins are mainly synthesized in the roots. After being transported to the aboveground part, they can promote the activity of axillary meristems and stimulate the growth of tillering buds. For example, in corn plants, when the synthesis of root cytokinins increases and is transported to the axils of leaves, it can break the apical dominance maintained by auxin and promote the occurrence of tillers. In addition to auxins and cytokinins, other hormones such as gibberellins and abscisic acid are also involved in the regulation of tillering. These hormones interact with each other to form a complex balance system.

[0006] Common wheat is an allohexaploid with a large genome, a long growth cycle, and relatively little information in the genome. The discovery and functional identification of wheat tillering genes are more complicated than many crops, and related research progress is relatively slow. So far, domestic and foreign scholars have identified very limited genes related to the number of wheat tillers, and there are still a large number of genes with unknown functions in wheat. Therefore, fully exploring the genes related to the number of wheat tillers and conducting functional research can lay a theoretical foundation for increasing wheat yield and improving traits, which will help achieve high and stable yields of wheat and increase economic benefits. Summary of the invention

[0007] In view of the current research status, the purpose of the present invention is to provide a wheat gene TaNIP1-D1 and conduct a simple biological analysis and construct wheat TaNIP1-D1 transgenic plants, analyzing the function of the TaNIP1-D1 gene in the growth and development of wheat.

[0008] To achieve the above object, the present invention adopts the following technical solution:

[0009] In a first aspect, the present invention provides the use of the TaNIP1-D1 gene in the following (1) or (2):

[0010] (1) Regulate wheat yield per plant;

[0011] (2) Cultivate high-yield wheat varieties;

[0012] The TaNIP1-D1 gene is a DNA molecule as shown in the following i) or ii) or iii):

[0013] i) the nucleotide sequence is the DNA molecule shown in SEQ ID NO.3;

[0014] ii) a DNA molecule encoding the amino acid sequence shown in SEQ ID NO.4 other than i);

[0015] iii) a DNA molecule having 90% or more identity with the DNA fragment defined in i) or ii), and encoding a protein that is functionally equivalent to the protein shown in SEQ ID NO.4.

[0016] The term "identity" refers to sequence similarity to a native nucleic acid sequence.

[0017] The wheat yield per plant includes: tiller number, ear length, grain size and thousand-grain weight.

[0018] In a second aspect, the present invention provides the use of the protein encoded by the TaNIP1-D1 gene in any one of the following (1)-(4):

[0019] (1) Regulate the number of wheat tillers;

[0020] (2) Regulating wheat ear length;

[0021] (3) Regulating wheat grain size;

[0022] (4) Regulating wheat thousand-grain weight;

[0023] The protein encoded by the TaNIP1-D1 gene is the protein shown in (A1) or (A2) below:

[0024] (A1) a protein consisting of the amino acid sequence shown in SEQ ID NO.4 in the sequence listing;

[0025] (A2) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1).

[0026] In a third aspect, the present invention provides the use of a recombinant expression vector or genetically engineered bacteria containing the TaNIP1-D1 gene in any one of the following (1) to (5):

[0027] (1) Regulate the number of wheat tillers;

[0028] (2) Regulating wheat ear length;

[0029] (3) Regulating wheat grain size;

[0030] (4) Regulating wheat thousand-grain weight;

[0031] (5) Cultivate high-yield wheat varieties.

[0032] A fourth aspect of the present invention provides a method for increasing the number of wheat tillers, comprising the following steps:

[0033] The number of wheat tillers can be increased by overexpressing the wheat TaNIP1-D1 gene or increasing the activity of the protein encoded by the wheat TaNIP1-D1 gene.

[0034] A fifth aspect of the present invention provides a method for breeding high-yield wheat varieties, comprising the following steps:

[0035] A recombinant overexpression vector containing the TaNIP1-D1 gene was constructed, and the recombinant overexpression vector was exogenously transferred into wheat starting plants to overexpress the TaNIP1-D1 gene, thereby obtaining a wheat variety with high-yield traits.

[0036] The above-mentioned method of exogenously transferring the recombinant overexpression vector into the wheat starting plant includes: Agrobacterium transformation method or gene gun method.

[0037] The high-yield trait is manifested as: an increase in the number of tillers of the wheat variety, an increase in ear length, an increase in grain size, and an increase in thousand-grain weight.

[0038] Beneficial effects of the present invention:

[0039] The present invention studies and confirms for the first time that the unknown functional gene TaNIP1-D1 is a gene related to the wheat tiller number trait. Furthermore, the present invention constructs wheat TaNIP1-D1 transgenic plants, and through wheat genetic transformation experiments and phenotypic analysis, it is found that: compared with the wild-type Fielder, the TaNIP1-D1 overexpressing plants have an increased number of tillers, an increased spike length, larger grains, and an increased thousand-grain weight, which can ultimately increase the yield per plant; while the TaNIP1-D1 gene knockout plants have a reduced number of tillers, a shortened spike length, smaller grains, and a reduced thousand-grain weight, which ultimately leads to a decrease in the yield per plant. The research results of the present invention provide important information for the regulatory mechanism of wheat tiller number and other yield traits, and lay a theoretical foundation for achieving high-yield molecular breeding and trait improvement of wheat. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Analysis of the expression pattern of TaNIP1-D1.

[0041] Figure 2 Subcellular localization of TaNIP1-D1 protein.

[0042] Figure 3 The tillering number and panicle number of TaNIP1-D1-OE plants and TaNIP1-d1 gene knockout plants are counted; Figure 3 A in the middle shows the wild-type Fielder and TaNIP1-D1-OE plants at the booting stage; Figure 3 Middle B shows the wild-type Fielder and TaNIP1-d1 plants at the booting stage; Figure 3 Middle C is the statistics of tiller numbers of wild-type Fielder, TaNIP1-D1-OE and TaNIP1-d1 plants at the booting stage; Figure 3D in the middle shows the mature plants of wild-type Fielder and TaNIP1-D1-OE; Figure 3 Middle E shows the mature plants of wild-type Fielder and TaNIP1-d1; Figure 3 F in the middle is the statistics of panicle number of mature plants of wild-type Fielder, TaNIP1-D1-OE and TaNIP1-d1; Figure 3 *: P < 0.05, **: 0.01 <P<0.001,***:P<0.001。

[0043] Figure 4 Detailed phenotypic analysis of TaNIP1-D1-OE plants and TaNIP1-d1 knockout plants; Figure 4 A in the middle shows the ears of wild-type Fielder, TaNIP1-D1-OE, and TaNIP1-d1 plants; Figure 4 Middle B shows the grains of wild-type Fielder, TaNIP1-D1-OE, and TaNIP1-d1 plants; Figure 4 Figure C shows the spike length statistics of wild-type Fielder, TaNIP1-D1-OE and TaNIP1-d1 plants (n=10, *: P<0.05, **: 0.01 <P<0.001,***:P<0.001); Figure 4 D is the grain length statistics of wild-type Fielder, TaNIP1-D1-OE and TaNIP1-d1 plants (n=100, *: P<0.05, **: 0.01 <P<0.001,***:P<0.001); Figure 4 Middle E is the grain width statistics of wild-type Fielder, TaNIP1-D1-OE and TaNIP1-d1 plants (n=100, *: P<0.05, **: 0.01 <P<0.001,***:P<0.001); Figure 4 F in the figure is the single plant yield statistics of wild-type Fielder, TaNIP1-D1-OE and TaNIP1-d1 plants (*: P<0.05, **: 0.01 <P<0.001,***:P<0.001); Figure 4 G in the figure shows the thousand-grain weight of wild-type Fielder, TaNIP1-D1-OE and TaNIP1-d1 plants (*: P<0.05, **: 0.01 <P<0.001,***:P<0.001); Figure 4 Figure H shows the plant height statistics of wild-type Fielder, TaNIP1-D1-OE and TaNIP1-d1 plants (n=30, *: P<0.05, **: 0.01 <P<0.001,***:P<0.001)。

[0044] Figure 5 Differential analysis of auxin-related genes in tiller bud RNA-seq between wild-type Fielder and TaNIP1-D1-OE. DETAILED DESCRIPTION

[0045] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0046] As mentioned above, fully exploring the genes related to wheat tiller number and conducting research on their functions will help us understand the regulatory mechanism of wheat tillering and provide a theoretical basis for high-yield molecular breeding of wheat.

[0047] In view of this, the present invention studies the unknown functional gene TaNIP1-D1 in the wheat genome. The CDS nucleotide sequence of the TaNIP1-D1 gene is 2841 bp in length, and the specific sequence information is shown in SEQ ID No.3:

[0048] SEQ ID No.3:

[0049]

[0050] The amino acid sequence of the protein encoded by the TaNIP1-D1 gene is 946 aa in length, and the specific sequence information is shown in SEQ ID No. 4:

[0051] SEQ ID No.4:

[0052] 。

[0053] The present invention conducted biological analysis on the wheat TaNIP1-D1 gene. According to the expression pattern analysis results, the TaNIP1-D1 gene was expressed at the highest level in the spikelet primordium (SP), followed by the stem apical meristem (SAM) and tiller bud (TB), and the expression levels in the roots and leaves were relatively low. Subcellular localization results showed that TaNIP1-D1 was localized in the cell nucleus. Furthermore, in order to explore the function of TaNIP1-D1, TaNIP1-D1 overexpression vector and TaNIP1-D1 CRISPR / Cas9 gene knockout vector were constructed. Wild-type Fielder wheat immature embryos were used as materials, and transgenic plants were obtained by genetic transformation mediated by Agrobacterium. Phenotypic analysis of TaNIP1-D1 transgenic plants showed that compared with the wild type, some important yield traits of TaNIP1-D1 overexpression lines had beneficial changes, including increased tiller number, longer spike length, higher grain length, grain width, 1000-grain weight and yield per plant than the wild type, while TaNIP1-d1 gene knockout lines had reduced tiller number, shorter spike length, lower grain length, grain width, 1000-grain weight and yield per plant than the wild type. Total RNA was extracted from tiller buds of TaNIP1-D1 overexpression lines, and RNA-Seq analysis showed that TaNIP1-D1 may regulate wheat growth and development by changing the transcription level of auxin-related genes.

[0054] The present invention proves through a series of experiments that the TaNIP1-D1 gene is a gene related to the tillering number of wheat, and overexpression of the TaNIP1-D1 gene can increase the tillering number of the plant, increase the ear length, enlarge the grains, and increase the thousand-grain weight, which can ultimately increase the yield per plant; knocking out the TaNIP1-D1 gene reduces the tillering number of the plant, shortens the ear length, reduces the grains, and reduces the thousand-grain weight, which ultimately leads to a decrease in the yield per plant. The above experimental results can be used in the field of transgenic breeding, and help lay a theoretical foundation for increasing wheat yield and improving traits.

[0055] The present invention will be further described below through specific examples. The examples described below are only preferred embodiments of the present invention and should not be interpreted as any form of limitation to the present invention. Any simple modification, equivalent changes and modifications made to the embodiments according to the technical essence of the present invention are within the scope of the technical solution of the present invention. It should be noted that the methods described in the following examples are all conventional experimental methods or conditions recommended by the experimental material manufacturers unless otherwise specified.

[0056] The wheat material used in this study was wild-type Fielder.

[0057] Example 1: Cloning of wheat TaNIP1-D1 gene

[0058] The CDS sequence of wheat TaNIP1-D1 gene and its encoded amino acid sequence were found on the WheatOmics 1.0 website and the Ensembl Plants website, and the sequence was compared using DNAMAN software. According to the base sequence of TaNIP1-D1 gene obtained on the website, primers for amplifying TaNIP1-D1 gene were designed (sequences are shown in SEQ ID No.1-SEQ ID No.2), and PCR amplification was performed using the stem tip cDNA of spring wheat wild type Fielder as a template, and the obtained amplified product was sequenced. The sequencing results showed that the CDS of TaNIP1-D1 gene was 2841bp in length, encoding 946 amino acid residues, the CDS nucleotide sequence was shown in SEQ ID No.3, and the amino acid sequence encoded by TaNIP1-D1 gene was shown in SEQ ID No.4.

[0059] TaNIP1-D1-F: 5'ATGATCAACTTGTTCGACCT3' (SEQ ID No. 1);

[0060] TaNIP1-D1-R: 5'CTACAGATTTGGCATTGGCA3' (SEQ ID No. 2).

[0061] Example 2: Analysis of the expression pattern of TaNIP1-D1

[0062] (1) Expression levels of the TaNIP1-D1 gene in different parts of wheat

[0063] Fresh wheat tissue was taken and ground in liquid nitrogen. Total RNA was extracted using the New Saimei Total RNA Column Extraction Kit (M5102), and RNA was reverse transcribed using the Tiangen FastKing cDNA First-Strand Synthesis Kit (KR116).

[0064] The fluorescence quantitative reagent SuperReal PreMix Plus (SYBR Green) of Mona Biotechnology Co., Ltd. was used for fluorescence quantitative PCR. The reaction system preparation process should be carried out in the dark. Three biological replicates and three technical replicates were set for each sample to ensure the reliability of the experimental data. The sample was placed in the Roche Light Cycler 96 real-time fluorescence quantitative PCR instrument. The upstream and downstream primers of the target gene are shown in SEQ ID No.5-SEQ ID No.6, and the upstream and downstream primers of the internal reference are shown in SEQ ID No.7-SEQ ID No.8:

[0065] TaNIP1-D1-RT-F: 5'GACCAAACTTCTTCAGGACTG3' (SEQ ID No. 5);

[0066] TaNIP1-D1-RT-R: 5'CTTTGTCTGAGGTGGTGCAGC3' (SEQ ID No. 6).

[0067] ACTIN-F: 5'GCCATGTACGTCGCAATTCA3' (SEQ ID No. 7);

[0068] ACTIN-R: 5'AGTCGAGAACGATACCAGTAGTACGA3' (SEQ ID No. 8).

[0069] To detect the expression level of TaNIP1-D1 in different parts of wheat plants, the tiller buds (TB), leaves, roots, stem apical meristems (SAM) and spikelet primordium (SP) of wild-type Fielder wheat were used as experimental materials to quantitatively detect the expression level of TaNIP1-D1. The results showed that TaNIP1-D1 was expressed in TB, leaves, roots, SAM and SP, with the highest expression level in SP, followed by SAM and TB, and relatively low expression in roots and leaves ( Figure 1 ).

[0070] (2) Subcellular localization of wheat TaNIP1-D1

[0071] According to the CDS sequence of wheat TaNIP1-D1 gene, DNAman software was used to design primers for gene cloning. Two restriction sites, BmaHI and KpnI, were selected in the expression vector 35S::GFP and added to the 5' end of the forward and reverse primers, respectively. The CDS sequence of TaNIP1-D1 was amplified by PCR and recovered by gel. The specific primer sequences are shown in SEQ ID No.9-SEQ ID No.10:

[0072] TaNIP1-D1-PORK2-F(SEQ ID No.9):

[0073] 5'GCACGGGGGACTCTAGAATGATCAACTTGTTCGACCTGAGC3';

[0074] TaNIP1-D1-PORK2-R(SEQ ID No.10):

[0075] 5'CATGGTACCCTCGAGCAGATTTGGCATTGGCATTGCGAG3'.

[0076] The TaNIP1-D1 gel product was connected to the 35S::GFP vector to construct the fusion protein expression vector 35S::TaNIP1-D1-GFP, which was transformed into the competent E. coli TOP10, screened and sequenced to obtain the plasmid, and transformed into the competent Agrobacterium GV3101. After the correct screening, the recombinant vector 35S::TaNIP1-D1-GFP bacterial solution was injected into the lower epidermis of tobacco leaves by transient transfection. After 48 hours, the lower epidermis of tobacco was torn off and observed using a Zeiss laser confocal microscope (LSM880). The results showed that 35S::TaNIP1-D1-GFP and mCherry were co-localized in the cell nucleus, indicating that TaNIP1-D1 is localized in the cell nucleus (see Figure 2 ).

[0077] Example 3: Creation of TaNIP1-D1 transgenic wheat

[0078] In order to explore the function of TaNIP1-D1, we constructed TaNIP1-D1 overexpression vector and TaNIP1-D1CRISPR / Cas9 gene knockout vector, and used immature embryos of wild-type Fielder wheat as materials for genetic transformation using Agrobacterium-mediated method.

[0079] 1. Construction of wheat TaNIP1-D1 overexpression vector

[0080] Primers were designed using DNAman software according to the CDS sequence of wheat TaNIP1-D1 gene (primer sequences are shown in SEQ ID No.11-SEQ ID No.12). The CDS sequence of TaNIP1-D1 was amplified, connected to the pENTR-D-TOPO vector by seamless cloning, transformed into Escherichia coli competent TOP10, and shaken for testing of single colonies. The bacteria with correct sequencing were selected for shaking to extract plasmids, and the plasmids were digested with PvuI enzyme. The fragments successfully digested were recovered by gel and LR reaction was performed. The LR reaction system was 1 μL fragment, 1 μL PC186 expression vector and 0.5 μL LR enzyme. After culturing at 25°C for 3 hours, Escherichia coli competent was transformed, and plasmids were extracted by screening sequencing, and Agrobacterium competent (EHA105) was transformed. The immature embryos of wild-type Fielder wheat were used as experimental materials, and wheat genetic transformation was performed by Agrobacterium-mediated method.

[0081] TaNIP1-D1-eF: CACCATGATCAACTTGTTCGACCT (SEQ ID No. 11);

[0082] TaNIP1-D1-eR: CTACAGATTTGGCATTGGCA (SEQ ID No. 12).

[0083] 2. Construction of wheat TaNIP1-D1 CRISPR / Cas9 gene knockout vector

[0084] The immature embryos of wild-type Fielder wheat were used as experimental materials, and the CRISPR / Cas9 knockout vector of the TaNIP1-D1 gene was constructed using pBUE411 as the vector backbone. The wheat was genetically transformed by Agrobacterium-mediated method, and the TaNIP1-D1 transgenic knockout strain was obtained.

[0085] The steps for constructing CRISPR / Cas9 vector are as follows:

[0086] (1) Target design: A 19 bp specific sequence was selected from the CDS sequence of the target gene, and the sequence was used for target prediction on the website (http: / / www.e-crisp.org / E-CRISP / ). A suitable target was selected, and the selected target was correctly filled with the primer template to finally obtain the primer sequences shown in SEQ ID No. 13 to SEQ ID No. 16:

[0087] MT1T2-BsF:aataatGGTCTCAAGCg ATGAACCCACATCAAACGG (SEQ ID No. 13);

[0088] MT1T2-F0: g ATGAACCCACATCAAACGG gttttagagctagaaatagc(SEQ ID No.14);

[0089] MT1T2-R0: ATCTGTCCACCCCGTAAAG CGCTTCTTGGTGCC(SEQ ID No.15);

[0090] MT1T2-BsR:attattGGTCTCTAAAC ATCTGTCCACCCCGTAAAG (SEQ ID No.16).

[0091] Note: The underlined sequence is the 19bp specific sequence that constitutes each primer.

[0092] (2) Four-primer PCR amplification was performed using pCBC-MT1T2 diluted 100 times as the template. -BsF / -BsR is the normal primer concentration; -F0 / -R0 is diluted 20 times.

[0093] (3) Purify and recover the PCR product, perform enzyme digestion and ligation according to the reaction system shown in the table below, gently invert the prepared reaction system mixture to mix, and briefly centrifuge. The reaction system mixture was incubated at 37°C for 5 hours, 50°C for 5 minutes, and 80°C for 10 minutes.

[0094]

[0095] (4) Take 5 μL of competent E. coli, screen with Kan plate, identify by PCR, and confirm by sequencing. Select the strain with the correct sequencing to extract the plasmid, transform it into competent Agrobacterium EHA105, and perform PCR screening and sequencing after a single colony grows.

[0096] In summary, this example uses the immature embryos of wild-type Fielder wheat as experimental materials, performs Agrobacterium-mediated genetic transformation on the constructed TaNIP1-D1 overexpression vector and TaNIP1-D1CRISPR / Cas9 gene knockout vector, and then identifies the gene-edited plants to finally obtain the overexpression strain TaNIP1-D1-OE and the TaNIP1-d1 gene knockout strain.

[0097] Example 4: Phenotypic analysis of TaNIP1-D1 transgenic plants

[0098] We identified the genetically transformed plants with TaNIP1-D1-OE and TaNIP1-d1 knockout genes, and selected three overexpression lines 1#, 2# and 7# and TaNIP1-d1 knockout lines for field planting, observed the phenotypes and analyzed their agronomic traits. The results showed that at the booting stage, the number of tillers in the wild-type plants (Fielder) was 18, the number of tillers in the TaNIP1-D1-OE plants was 23-27, and the number of tillers in the TaNIP1-d1 plants was 15 (see Figure 3 A, B, C); at maturity, the number of panicles in wild-type plants was 15, the number of panicles in TaNIP1-D1-OE plants was 19-22, and the number of panicles in TaNIP1-d1 plants was 10 (see Figure 3 D, E, F). The above statistical results show that overexpression of TaNIP1-D1 gene can promote tillering in wheat.

[0099] Statistics of other agronomic traits showed that, compared with the wild type, some important yield traits of the three TaNIP1-D1 overexpression lines underwent beneficial changes, including increased ear length, higher grain length, grain width, 1000-grain weight and yield per plant than the wild type, while the ear length of the TaNIP1-d1 gene knockout line was shortened, and the grain length, grain width, 1000-grain weight and yield per plant were lower than those of the wild type (see Figure 4 ).

[0100] Example 5: RNA-Seq analysis of TaNIP1-D1-OE plants

[0101] RNA-Seq materials: Wild-type Fielder and TaNIP1-D1-OE plants were grown in an artificial climate chamber with 16 h of light and 8 h of darkness at 25 °C. Total RNA was extracted from tiller buds of the above materials 15 days after growth. Three biological replicates were set for each sample.

[0102] Since plant hormones play a key regulatory role in the tillering process. We carefully studied the DEGs involved in the plant hormone signaling pathway. Among them, the number of differentially expressed genes related to auxin was the largest, including genes related to auxin synthesis, auxin transport, and auxin signal transduction, all of which were up-regulated and down-regulated to varying degrees. Among the genes related to auxin synthesis, tryptophan decarboxylases were up-regulated to varying degrees; most of the flavin-containing monooxygenases were down-regulated; among the genes related to auxin transport, ABCB transporters were up-regulated or down-regulated to varying degrees; typical auxin influx carriers (AUX1 / LAX) and auxin efflux carriers (PIN) related genes were up-regulated to varying degrees. Among the genes related to auxin signal transduction, the auxin response factor (ARFs) related gene ARF was up-regulated; the transcriptional repressor AUX / IAA related gene IAA was up-regulated or down-regulated to varying degrees; the auxin downstream target gene (including AUX / IAA) GH3 was up-regulated to varying degrees, and most of the SAUR family proteins were up-regulated and a few were down-regulated (see Figure 5 ). The above analysis results indicate that TaNIP1-D1 may regulate wheat growth and development by changing the transcription levels of auxin-related genes.

[0103] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. Use of TaNIP1-D1 gene in the following (1) or (2): (1) Regulate wheat yield traits; (2) Cultivate high-yield wheat varieties; The TaNIP1-D1 gene is a DNA molecule as shown in the following i) or ii) or iii): i) the nucleotide sequence is the DNA molecule shown in SEQ ID NO.3; ii) a DNA molecule encoding the amino acid sequence shown in SEQ ID NO.4 other than i); iii) a DNA molecule having 90% or more identity with the DNA fragment defined in i) or ii), and encoding a protein that is functionally equivalent to the protein shown in SEQ ID NO.

4.

2. The use according to claim 1, characterized in that: The wheat yield traits include: tiller number, ear length, grain size and thousand-grain weight.

3. Use of the protein encoded by the TaNIP1-D1 gene according to claim 1 in any one of the following (1)-(4): (1) Regulate the number of wheat tillers; (2) Regulating wheat ear length; (3) Regulating wheat grain size; (4) Regulating wheat thousand-grain weight; The protein encoded by the TaNIP1-D1 gene is the protein shown in (A1) or (A2) below: (A1) a protein consisting of the amino acid sequence shown in SEQ ID NO.4 in the sequence listing; (A2) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1).

4. Use of a recombinant expression vector or genetically engineered bacteria containing the TaNIP1-D1 gene according to claim 1 in any one of the following (1) to (5): (1) Regulate the number of wheat tillers; (2) Regulating wheat ear length; (3) Regulating wheat grain size; (4) Regulating wheat thousand-grain weight; (5) Cultivate high-yield wheat varieties.

5. A method for increasing the number of wheat tillers, characterized in that: The following steps are involved: The number of wheat tillers can be increased by overexpressing the wheat TaNIP1-D1 gene or increasing the activity of the protein encoded by the wheat TaNIP1-D1 gene.

6. A method for breeding high-yield wheat varieties, characterized in that: The following steps are involved: A recombinant overexpression vector containing the TaNIP1-D1 gene of claim 1 is constructed, and the recombinant overexpression vector is exogenously transferred into wheat starting plants to overexpress the TaNIP1-D1 gene, thereby obtaining a wheat variety with high-yield traits.

7. The method according to claim 6, characterized in that The high-yield trait is manifested in that the number of tillers of the wheat variety increases, the ear length increases, the grains become larger, and the thousand-grain weight increases.

Images