Method for simultaneously regulating soybean plant height and flowering time and its application

Abstract

The present invention relates to the field of biotechnology, and specifically provides a method for simultaneously regulating the plant height and flowering time of soybeans and its application. The method includes: knocking out any one or more of the following genes in soybeans: GmPHDLa, GmPHDLb, GmPHDLc or GmPHDLd; wherein, the nucleotide sequence of the GmPHDLa gene is SEQ ID NO: 1; the nucleotide sequence of the GmPHDLb gene is SEQ ID NO: 2; the nucleotide sequence of the GmPHDLc gene is SEQ ID NO: 3; the nucleotide sequence of the GmPHDLd gene is SEQ ID NO: 4. When knocking out the above genes in soybeans, the plant height of soybeans becomes shorter and the flowering time is delayed. Regulating the plant height and flowering time of soybeans can make the plants more adaptable to the local growth environment, thereby contributing to increasing the soybean yield.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular, to a method for simultaneously regulating the plant height and flowering time of soybeans and its application. Background Art

[0002] Dwarf plants can make full use of arable land, enhance photosynthetic efficiency, lodging resistance, pest and disease resistance, thereby increasing yields and enhancing the output value per unit area. Therefore, dwarf breeding and cultivation have become a popular research direction for current crops. Especially when facing extreme climates, shorter soybean plants have multiple advantages: on the one hand, it can improve the absorption efficiency of water and nutrients; on the other hand, it can reduce losses caused by lodging and ensure yield stability. In some cases, a slower growth rate may extend the growth period, enabling the plant to obtain more photosynthetic products in a suitable environment, which also helps to increase yields. At the same time, in agricultural production, shorter plants are easier to manage mechanically, convenient to operate, and can reduce production costs. Generally speaking, the dwarf cultivation characteristics of soybeans can enhance the adversity resistance, resource utilization rate, and economic benefits of crops under specific conditions.

[0003] Flowering is a key link in the plant growth cycle. Plants need to integrate internal factors and external signals to determine the optimal flowering period. This process is crucial for plant reproduction, and in crops, it is directly related to yields. Delaying the flowering time of soybeans also has many benefits: on the one hand, it can better adapt to adverse environments such as drought and low temperature, reducing the risk of flowering under harsh climate conditions; on the other hand, selecting late-flowering varieties according to the climate conditions in different regions can improve the adaptability of planting. Therefore, the late-flowering characteristics of soybeans have significant advantages in agricultural production, especially in coping with climate change and increasing crop yields.

[0004] Currently, known genes for controlling the plant height of soybeans include Dt1, Dt2, and DW1, etc., and genes for regulating the flowering time of soybeans are E1, GmFT2a, and GmFT5a, etc. However, in addition to these known genes, there are many other genes, especially those that can simultaneously regulate plant height and flowering time, which are rarely found. Summary of the Invention

[0005] The main object of the present invention is to provide a method for simultaneously regulating the plant height and flowering time of soybeans and its application, so as to solve the problem in the prior art of the lack of a method for simultaneously regulating the plant height of soybeans and delaying the flowering time of soybeans.

[0006] To achieve the above object, according to the first aspect of the present invention, there is provided a method for simultaneously regulating the plant height and flowering time of soybeans, the method comprising: knocking out any one or more of the following genes in soybeans: GmPHDLa, GmPHDLb, GmPHDLc, or GmPHDLd;

[0007] Among them, the nucleotide sequence of the GmPHDLa gene is SEQ ID NO: 1;

[0008] The nucleotide sequence of the GmPHDLb gene is SEQ ID NO: 2;

[0009] The nucleotide sequence of the GmPHDLc gene is SEQ ID NO: 3;

[0010] The nucleotide sequence of the GmPHDLd gene is SEQ ID NO: 4.

[0011] Furthermore, gene editing is used for knockout to obtain any one or more of the following gene-knockout soybeans: GmPHDLa, GmPHDLb, GmPHDLc or GmPHDLd.

[0012] Furthermore, the CRISPR-Cas9 gene editing system is used for knockout.

[0013] Furthermore, the CRISPR-Cas9 gene editing system includes sgRNA; the sgRNA includes:

[0014] sgRNA1 or sgRNA2 targeting the GmPHDLa gene;

[0015] sgRNA5 or sgRNA2 targeting the GmPHDLb gene;

[0016] sgRNA3 or sgRNA4 targeting the GmPHDLc gene;

[0017] sgRNA6 or sgRNA4 targeting the GmPHDLd gene;

[0018] Among them, the nucleotide sequence of sgRNA1 is SEQ ID NO: 5; the nucleotide sequence of sgRNA2 is SEQ ID NO: 6; the nucleotide sequence of sgRNA3 is SEQ ID NO: 7; the nucleotide sequence of sgRNA4 is SEQ ID NO: 8; the nucleotide sequence of sgRNA5 is SEQ ID NO: 59; the nucleotide sequence of sgRNA6 is SEQ ID NO: 66.

[0019] Furthermore, the GmPHDLa gene is knocked out by any one of the following methods: deletion of the T base at the 9344th position in the nucleotide sequence of the GmPHDLa gene;

[0020] deletion of the A base at the 10054th position in the nucleotide sequence of the GmPHDLa gene;

[0021] A 28-base deletion at positions 10041 to 10068 of the nucleotide sequence of the GmPHDLa gene;

[0022] Or a 662-base deletion at positions 9413 to 10074 of the nucleotide sequence of the GmPHDLa gene.

[0023] Furthermore, the GmPHDLb gene is knocked out by any one of the following methods: adding 1 A base between positions 3486 and 3487 of the nucleotide sequence of the GmPHDLb gene;

[0024] Deleting the A base at position 3486 and the G base at position 3487 of the nucleotide sequence of the GmPHDLb gene;

[0025] A 10-base deletion at positions 3477 to 3486 of the nucleotide sequence of the GmPHDLb gene;

[0026] Or deleting the C base at position 2716 of the nucleotide sequence of the GmPHDLb gene.

[0027] Furthermore, the GmPHDLc gene is knocked out by any one of the following methods: adding 1 T base between positions 2735 and 2736 of the nucleotide sequence of the GmPHDLc gene;

[0028] Adding 1 T base between positions 2576 and 2577 of the nucleotide sequence of the GmPHDLc gene;

[0029] Deleting the T base at position 2576 of the nucleotide sequence of the GmPHDLc gene;

[0030] Or a 5-base deletion at positions 2576 to 2580 of the nucleotide sequence of the GmPHDLc gene.

[0031] Furthermore, the GmPHDLd gene is knocked out by any one of the following methods: a 3-base deletion at positions 2494 to 2496 of the nucleotide sequence of the GmPHDLd gene;

[0032] A 3-base deletion at positions 2654 to 2656 of the nucleotide sequence of the GmPHDLd gene;

[0033] A 4-base deletion at positions 2655 to 2658 of the nucleotide sequence of the GmPHDLd gene;

[0034] A 7-base deletion at positions 2491 to 2497 of the nucleotide sequence of the GmPHDLd gene;

[0035] A 10-base deletion at positions 2494 to 2503 in the nucleotide sequence of the GmPHDLd gene;

[0036] A 37-base deletion at positions 2494 to 2530 in the nucleotide sequence of the GmPHDLd gene;

[0037] An insertion of 33 bases between positions 2495 and 2496 in the nucleotide sequence of the GmPHDLd gene;

[0038] Or a 9-base deletion at positions 2484 to 2492 in the nucleotide sequence of the GmPHDLd gene.

[0039] Furthermore, the method includes: knocking out the following gene combinations in soybean: GmPHDLc + GmPHDLd or GmPHDLa + GmPHDLb + GmPHDLc + GmPHDLd.

[0040] Furthermore, the GmPHDLc + GmPHDLd genes are knocked out in the following manner: an insertion of 1 T base between positions 2576 and 2577 in the nucleotide sequence of the GmPHDLc gene and a 10-base deletion at positions 2494 to 2503 in the nucleotide sequence of the GmPHDLd gene.

[0041] Furthermore, the GmPHDLa + GmPHDLb + GmPHDLc + GmPHDLd genes are knocked out in the following manner:

[0042] 1) A 28-base deletion at positions 10041 to 10068 in the nucleotide sequence of the GmPHDLa gene;

[0043] An insertion of 1 A base between positions 3486 and 3487 in the nucleotide sequence of the GmPHDLb gene;

[0044] An insertion of 1 T base between positions 2735 and 2736 in the nucleotide sequence of the GmPHDLc gene;

[0045] And a 4-base deletion at positions 2655 to 2658 in the nucleotide sequence of the GmPHDLd gene;

[0046] Or

[0047] 2) A 662-base deletion at positions 9413 to 10074 in the nucleotide sequence of the GmPHDLa gene;

[0048] A 10-base deletion at positions 3477 to 3486 in the nucleotide sequence of the GmPHDLb gene;

[0049] Insert one T base between the 2735th and 2736th positions of the nucleotide sequence of the GmPHDLc gene;

[0050] And there is a deletion of 4 bases at positions 2655 to 2658 of the nucleotide sequence of the GmPHDLd gene.

[0051] To achieve the above object, according to the second aspect of the present invention, there is provided an application of the above method for simultaneously regulating soybean plant height and flowering time in soybean cultivation.

[0052] Applying the technical solution of the present invention, knock out any one or more of the following genes in soybean: GmPHDLa, GmPHDLb, GmPHDLc or GmPHDLd; wherein, the nucleotide sequence of the GmPHDLa gene is SEQ ID NO: 1; the nucleotide sequence of the GmPHDLb gene is SEQ ID NO: 2; the nucleotide sequence of the GmPHDLc gene is SEQ ID NO: 3; the nucleotide sequence of the GmPHDLd gene is SEQ ID NO: 4.

[0053] Beneficial technical effects: When knocking out the above genes in soybean, the soybean plant height becomes shorter and the soybean flowering time is delayed. By regulating the soybean plant height, the plant can be made more adaptable to the local growth environment, the yield and quality can be improved, and it helps to improve the production efficiency of soybean. Delaying the soybean flowering time helps to increase the time of vegetative growth of the plant and improve the biomass of soybean, thereby further increasing the soybean yield. Brief Description of the Drawings

[0054] The specification drawings forming a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0055] Figure 1 Shows the phylogenetic tree analysis of the proteins encoded by the GmPHDLa / b / c / d genes according to the embodiments of the present invention.

[0056] Figure 2 Shows the map of the empty vector pCAMBIA3300 - GmU6 according to the embodiments of the present invention.

[0057] Figure 3 Shows the schematic diagram of the knockout target sequence of the GmPHDLa / b / c / d genes according to the embodiments of the present invention; wherein, (+) represents the sense strand; (-) represents the antisense strand.

[0058] Figure 4 Shows the schematic diagram of the mutation type of the CRISPR - GmPHDL editing material phdla according to the embodiments of the present invention.

[0059] Figure 5 Shows a schematic diagram of the mutation types of the CRISPR-GmPHDL editing material phdlb according to an embodiment of the present invention.

[0060] Figure 6 Shows a schematic diagram of the mutation types of the CRISPR-GmPHDL editing material phdlc according to an embodiment of the present invention.

[0061] Figure 7 Shows a schematic diagram of the mutation types of the CRISPR-GmPHDL editing material phdld according to an embodiment of the present invention.

[0062] Figure 8 Shows the flowering phenotypes of each editing material taken in January 2024 during the growth period from November 2023 to June 2024 under long-day conditions (16 h of light / 8 h of darkness, and light intensity of 120 μmol / (m 2 •s)) in the laboratory of the CRISPR-GmPHDL editing material according to an embodiment of the present invention.

[0063] Figure 9 Shows the flowering phenotypes of each editing material taken in January 2024 during the growth period from November 2023 to June 2024 under long-day conditions (16 h of light / 8 h of darkness, and light intensity of 120 μmol / (m 2 •s)) in the laboratory of the CRISPR-GmPHDL editing material according to an embodiment of the present invention; *p < 0.05, **p < 0.01, ***p < 0.001 (t-test).

[0064] Figure 10 Shows the flowering phenotypes of each editing material taken in December 2023 during the growth period from November 2023 to March 2024 under short-day conditions (8 h of light / 8 h of darkness, and light intensity of 400 μmol / (m 2 •s)) in the laboratory of the CRISPR-GmPHDL editing material according to an embodiment of the present invention.

[0065] Figure 11 Shows the flowering phenotypes of each editing material taken in December 2023 during the growth period from November 2023 to March 2024 under short-day conditions (8 h of light / 8 h of darkness, and light intensity of 400 μmol / (m 2 •s)) in the laboratory of the CRISPR-GmPHDL editing material according to an embodiment of the present invention; *p < 0.05, **p < 0.01, ***p < 0.001 (t-test).

[0066] Figure 12Shows the flowering phenotypes of each edited material at the flowering stage in July 2024 under natural long-day conditions (outdoor natural environment in Weifang City, Shandong Province from June to October 2024 (36°30'39"N, 119°25'46"E)) of the CRISPR-GmPHDL edited materials according to the embodiments of the present invention.

[0067] Figure 13 Shows the statistical chart of the flowering time of each edited material of the CRISPR-GmPHDL edited materials under natural long-day conditions (outdoor natural environment in Weifang City, Shandong Province from June to October 2024 (36°30'39"N, 119°25'46"E)) of the CRISPR-GmPHDL edited materials according to the embodiments of the present invention; *p<0.05, **p<0.01, ***p<0.001 (t-test).

[0068] Figure 14 Shows the statistical chart of the plant height of each edited material at the full flowering stage in July 2024 under natural long-day conditions (outdoor natural environment in Weifang City, Shandong Province from June to October 2024 (36°30'39"N, 119°25'46"E)) of the CRISPR-GmPHDL edited materials according to the embodiments of the present invention; *p<0.05, **p<0.01, ***p<0.001 (t-test).

[0069] Figure 15 Shows the phenotypes of the plant height of each edited material at the mature stage in October 2024 under natural long-day conditions (outdoor natural environment in Weifang City, Shandong Province from June to October 2024 (36°30'39"N, 119°25'46"E)) of the CRISPR-GmPHDL edited materials according to the embodiments of the present invention.

[0070] Figure 16 Shows the data analysis of the plant height at the mature stage in October 2024 under natural long-day conditions (outdoor natural environment in Weifang City, Shandong Province from June to October 2024 (36°30'39"N, 119°25'46"E)) of the CRISPR-GmPHDL edited materials according to the embodiments of the present invention; *p<0.05, **p<0.01, ***p<0.001 (t-test).

[0071] Figure 17Shows the phenotypes of the plant heights at the maturity stage in October 2024 of the CRISPR-GmPHDL editing materials phdla-3+phdlb-1+phdlc-1+phdld-3 and phdla-4+phdlb-3+phdlc-1+phdld-3 under natural long-day conditions (outdoor natural environment in Weifang City, Shandong Province from June to October 2024 (36°30'39"N, 119°25'46"E)) in field planting.

[0072] Figure 18 Shows the analysis of the flowering times of each editing material in January 2025 of the CRISPR-GmPHDL editing materials according to the embodiments of the present invention under natural short-day conditions (outdoor natural environment in Sanya City, Hainan Province (18°09'34"N, 108°56'30"E)) in field planting. Detailed implementation manners

[0073] It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other. The present invention will be described in detail below with reference to the embodiments.

[0074] Term explanation:

[0075] Flowering time: The flowering time in the present invention refers to the total number of days elapsed from the germination of soybeans to the opening of the first flower.

[0076] As mentioned in the background art, dwarf plants help improve the absorption efficiency of water and nutrients by soybean plants and reduce the losses caused by lodging, ensuring yield stability. At the same time, shorter plants are easier to manage mechanically, reducing production costs. Delaying the flowering time of soybeans helps soybeans better adapt to adverse environments such as drought and low temperature, reduces the risk of flowering under harsh climate conditions, helps improve the adaptability of planting, and thus helps increase the soybean yield. In the present invention, the inventors tried to genetically modify soybeans so that their plant heights and flowering times are easily controllable, and thus proposed the protection scheme of the present invention.

[0077] In the first typical implementation manner of the present invention, a method for simultaneously regulating the plant height and flowering time of soybeans is provided. The above method includes: knocking out any one or more of the following genes in soybeans: GmPHDLa, GmPHDLb, GmPHDLc or GmPHDLd;

[0078] Among them, the nucleotide sequence of the above-mentioned GmPHDLa gene is SEQ ID NO: 1; the nucleotide sequence of the above-mentioned GmPHDLb gene is SEQ ID NO: 2; the nucleotide sequence of the above-mentioned GmPHDLc gene is SEQ ID NO: 3; the nucleotide sequence of the above-mentioned GmPHDLd gene is SEQ ID NO: 4.

[0079] Knocking out the above genes in soybeans results in shorter plant height and delayed flowering time of soybean plants. The shorter plant height of soybeans helps to reduce the losses caused by lodging, promotes the effective absorption of nutrients and water by soybeans in the soil layer, and increases the effective planting area, thereby further increasing soybean yield.

[0080] Delaying the flowering time of soybeans helps to extend the growth period of soybeans, enables plants to obtain more photosynthetic accumulation during the growth season, increases the biomass and yield per plant, helps soybeans better adapt to adverse environmental conditions such as drought or low temperature, etc., and reduces the risk of soybeans flowering under unsuitable climate conditions. It helps soybeans avoid the peak periods of some common pests and diseases, reduces the occurrence risk of pests and diseases, thereby reducing the use of pesticides, increasing the environmental friendliness, and helps soybeans adapt to different planting areas. Selecting late-flowering varieties can better adapt to the local climate conditions and improve the planting success rate.

[0081] It should be noted that gene knockout refers to deleting or inactivating a specific gene from the genome of an organism through gene editing technology to study the impact of the gene on the physiology, development, or diseases of the organism. Methods for achieving gene knockout include but are not limited to: 1) Using homologous recombination to replace the target gene with a non-functional or disrupted version by introducing a modified DNA fragment. When the exogenous DNA undergoes homologous recombination with a gene with the same or similar sequence in the receptor cell genome, the target gene is replaced and inactivated; 2) Using RNA interference to silence or degrade the mRNA of the target gene by utilizing small RNA molecules, preventing its translation into protein, thereby achieving gene knockout; or 3) Using the CRISPR / Cas9 system to introduce a targeted DNA break at a specific position in the genome by using sgRNA and Cas9 enzyme, resulting in gene disruption. CRISPR / Cas9 generates frameshift mutations or fragment deletions at the break site through the non-homologous end joining repair pathway, silencing the gene and causing loss of function.

[0082] In a preferred embodiment of the present invention, the above knockout is carried out by gene editing to obtain any one or more of the following gene-edited soybeans: GmPHDLa, GmPHDLb, GmPHDLc, or GmPHDLd. In a preferred embodiment of the present invention, the above knockout is carried out using the CRISPR-Cas9 gene editing system. Using the above method to knockout the above genes has the beneficial effect of simple operation.

[0083] In a preferred embodiment of the present invention, the CRISPR-Cas9 gene editing system includes sgRNA; the sgRNA includes: sgRNA1 or sgRNA2 targeting the GmPHDLa gene; sgRNA5 or sgRNA2 targeting the GmPHDLb gene; sgRNA3 or sgRNA4 targeting the GmPHDLc gene; sgRNA6 or sgRNA4 targeting the GmPHDLd gene. Among them, the nucleotide sequence of the above sgRNA1 is SEQ ID NO: 5; the nucleotide sequence of the above sgRNA2 is SEQ ID NO: 6; the nucleotide sequence of the above sgRNA3 is SEQ ID NO: 7; the nucleotide sequence of the above sgRNA4 is SEQ ID NO: 8; the nucleotide sequence of the above sgRNA5 is SEQ ID NO: 59; the nucleotide sequence of the above sgRNA6 is SEQ ID NO: 66. Using the above sgRNA for gene editing has the advantage of high editing efficiency.

[0084] In a preferred embodiment of the present invention, any one of the following methods is used to knockout the GmPHDLa gene: deletion of the T base at the 9344th position in the nucleotide sequence of the GmPHDLa gene; deletion of the A base at the 10054th position in the nucleotide sequence of the GmPHDLa gene; deletion of 28 bases from the 10041st to the 10068th positions in the nucleotide sequence of the GmPHDLa gene; or deletion of 662 bases from the 9413th to the 10074th positions in the nucleotide sequence of the GmPHDLa gene. When the GmPHDLa gene undergoes the above mutations, the function of the gene is inactivated, which may help to reduce the plant height of soybeans and delay the flowering time of soybeans, and further may help to increase the yield of soybeans.

[0085] In a preferred embodiment of the present invention, any one of the following methods is used to knockout the GmPHDLb gene: addition of 1 A base between the 3486th and 3487th positions in the nucleotide sequence of the GmPHDLb gene; deletion of the A base at the 3486th position and the G base at the 3487th position in the nucleotide sequence of the GmPHDLb gene; deletion of 10 bases from the 3477th to the 3486th positions in the nucleotide sequence of the GmPHDLb gene; or deletion of the C base at the 2716th position in the nucleotide sequence of the GmPHDLb gene. When the GmPHDLb gene undergoes the above mutations, the function of the gene is inactivated, which may help to reduce the plant height of soybeans and delay the flowering time of soybeans, and further may help to increase the yield of soybeans.

[0086] In a preferred embodiment of the present invention, the above-mentioned GmPHDLc gene is knocked out by any one of the following methods: adding 1 T base between the 2735th and 2736th positions of the nucleotide sequence of the above-mentioned GmPHDLc gene; adding 1 T base between the 2576th and 2577th positions of the nucleotide sequence of the above-mentioned GmPHDLc gene; deleting the T base at the 2576th position of the nucleotide sequence of the above-mentioned GmPHDLc gene; or deleting 5 bases from the 2576th to 2580th positions of the nucleotide sequence of the above-mentioned GmPHDLc gene. When the GmPHDLc gene undergoes the above mutations, the function of the gene is inactivated, which may help reduce the plant height of soybeans and delay the flowering time of soybeans, and further may help increase the soybean yield.

[0087] In a preferred embodiment of the present invention, the above-mentioned GmPHDLd gene is knocked out by any one of the following methods: deleting 3 bases from the 2494th to 2496th positions of the nucleotide sequence of the above-mentioned GmPHDLd gene;

[0088] deleting 3 bases from the 2654th to 2656th positions of the nucleotide sequence of the above-mentioned GmPHDLd gene;

[0089] deleting 4 bases from the 2655th to 2658th positions of the nucleotide sequence of the above-mentioned GmPHDLd gene;

[0090] deleting 7 bases from the 2491st to 2497th positions of the nucleotide sequence of the above-mentioned GmPHDLd gene;

[0091] deleting 10 bases from the 2494th to 2503rd positions of the nucleotide sequence of the above-mentioned GmPHDLd gene;

[0092] deleting 37 bases from the 2494th to 2530th positions of the nucleotide sequence of the above-mentioned GmPHDLd gene;

[0093] adding 33 bases between the 2495th and 2496th positions of the nucleotide sequence of the above-mentioned GmPHDLd gene;

[0094] or deleting 9 bases from the 2484th to 2492nd positions of the nucleotide sequence of the above-mentioned GmPHDLd gene.

[0095] When the GmPHDLd gene undergoes the above mutations, the function of the gene is inactivated, which helps reduce the plant height of soybeans and delays the flowering time of soybeans, and may help increase the soybean yield.

[0096] In a preferred embodiment of the present invention, the above method comprises: knocking out the following gene combinations in soybean: GmPHDLc + GmPHDLd or GmPHDLa + GmPHDLb + GmPHDLc + GmPHDLd. Knocking out the above genes in soybean can significantly reduce the plant height of soybean and delay the flowering time of soybean, thereby possibly contributing to increasing the soybean yield.

[0097] In a preferred embodiment of the present invention, the GmPHDLc + GmPHDLd genes are knocked out in the following manner: adding 1 T base between the 2576th and 2577th positions of the nucleotide sequence of the GmPHDLc gene and deleting 10 bases from the 2494th to 2503rd positions of the nucleotide sequence of the GmPHDLd gene. When the GmPHDLc + GmPHDLd genes undergo the above mutations, the plant height of soybean is significantly reduced and the flowering time of soybean is significantly delayed, thereby possibly contributing to increasing the soybean yield.

[0098] In a preferred embodiment of the present invention, the GmPHDLa + GmPHDLb + GmPHDLc + GmPHDLd genes are knocked out in the following manner:

[0099] 1) Deleting 28 bases from the 10041st to 10068th positions of the nucleotide sequence of the GmPHDLa gene;

[0100] Adding 1 A base between the 3486th and 3487th positions of the nucleotide sequence of the GmPHDLb gene;

[0101] Adding 1 T base between the 2735th and 2736th positions of the nucleotide sequence of the GmPHDLc gene; and deleting 4 bases from the 2655th to 2658th positions of the nucleotide sequence of the GmPHDLd gene;

[0102] Or

[0103] 2) Deleting 662 bases from the 9413th to 10074th positions of the nucleotide sequence of the GmPHDLa gene;

[0104] Deleting 10 bases from the 3477th to 3486th positions of the nucleotide sequence of the GmPHDLb gene;

[0105] Adding 1 T base between the 2735th and 2736th positions of the nucleotide sequence of the GmPHDLc gene; and deleting 4 bases from the 2655th to 2658th positions of the nucleotide sequence of the GmPHDLd gene.

[0106] When the GmPHDLa + GmPHDLb + GmPHDLc + GmPHDLd genes undergo the above mutations, the plant height of soybeans decreases and the flowering time is delayed, which may contribute to increasing soybean yield.

[0107] In the second typical embodiment of the present invention, an application of the above method for controlling the plant height of soybeans and delaying the flowering time of soybeans in soybean cultivation is provided.

[0108] It should be noted that the meanings expressed by "phdlc-3 phdld-1" and "phdlc-3+phdld-1" in the accompanying drawings of the specification are the same.

[0109] The meanings expressed by "phdlc-3 phdld-7" and "phdlc-3+phdld-7" are the same.

[0110] The meanings expressed by "phdlc-2 phdld-5" and "phdlc-2+phdld-5" are the same.

[0111] The meanings expressed by "phdla-2 phdlb-2 phdlc-1 phdld-2" and "phdla-2+phdlb-2+phdlc-1+phdld-2" are the same.

[0112] The meanings expressed by "phdla-3 phdlb-1 phdlc-1 phdld-3" and "phdla-3+phdlb-1+phdlc-1+phdld-3" are the same.

[0113] The meanings expressed by "phdla-4 phdlb-3 phdlc-1 phdld-3" and "phdla-4+phdlb-3+phdlc-1+phdld-3" are the same.

[0114] The meanings expressed by "phdla-1 phdlb-4 phdlc-4 phdld-8" and "phdla-1+phdlb-4+phdlc-4+phdld-8" are the same.

[0115] The present invention will be further described in detail below in conjunction with specific embodiments, and these embodiments should not be construed as limiting the scope claimed by the present invention.

[0116] Example 1 Construction of Soybean GmPHDLa / b / c / d Knockout Expression Vectors

[0117] (1)Phylogenetic tree analysis: We named the four homologous genes encoding a PHD domain in soybean as GmPHDLa, GmPHDLb, GmPHDLc, and GmPHDLd, respectively. Using the MEGA11 software, we performed a homology alignment of their protein sequences, and the results of the phylogenetic tree analysis are as shown in Figure 1 shown.

[0118] According to the search in the Phytozome 13 database for the soybean V6 version: The DNA sequence of GmPHDLa is located on chromosome 10 of soybean at 37843511 - 37857643 forward, and the nucleotide sequence of GmPHDLa (Glyma.10G127700) is as shown in SEQ ID NO: 1; The DNA sequence of GmPHDLb is located on chromosome 20 of soybean at 32474180 - 32487711 forward, and the nucleotide sequence of GmPHDLb (Glyma.20G079100) is as shown in SEQ ID NO: 2; The DNA sequence of GmPHDLc is located on chromosome 16 of soybean at 3901434 - 3905906 reverse, and the nucleotide sequence of GmPHDLc (Glyma.16G041900) is as shown in SEQ ID NO: 3; The DNA sequence of GmPHDLd is located on chromosome 19 of soybean at 39513761 - 39517411 forward, and the nucleotide sequence of GmPHDLd (Glyma.19G110500) is as shown in SEQ ID NO: 4.

[0119] (2)Construction of the soybean GmPHDL knockout vector: We constructed the knockout vector using the reported CRISPR-Cas9 technology. The structure of the empty vector pCAMBIA3300-GmU6 is shown in Figure 2 , and the specific steps are as follows: First, we designed the sgRNA for the coding sequence of GmPHDL using the website http: / / crispr.hzau.edu.cn / .

[0120] According to the score, for GmPHDLa, we selected sgRNA1 (with the nucleotide sequence shown in SEQ ID NO: 5) or sgRNA2 (with the nucleotide sequence shown in SEQ ID NO: 6) as the target;

[0121] For GmPHDLb, we selected sgRNA5 (with the nucleotide sequence shown in SEQ ID NO: 59) or sgRNA2 (with the nucleotide sequence shown in SEQ ID NO: 6) as the target;

[0122] Select sgRNA3 (with the nucleotide sequence shown in SEQ ID NO: 7) or sgRNA4 (with the nucleotide sequence shown in SEQ ID NO: 8) as the target for GmPHDLc.

[0123] Select sgRNA6 (with the nucleotide sequence shown in SEQ ID NO: 66) or sgRNA4 (with the nucleotide sequence shown in SEQ ID NO: 8) as the target for GmPHDLd;

[0124] Construct sgRNA1 and sgRNA3 into the pCAMBIA3300-GmU6 vector, and name the vector pCAMBIA3300-GmU6-sgRNA1 / 3; at the same time, construct sgRNA2 and sgRNA4 into the pCAMBIA3300-GmU6 vector, and name the vector pCAMBIA3300-GmU6-sgRNA2 / 4. Since the sgRNA1 sequence of the target gene of GmPHDLa has a potential off-target probability of 87.5% and can act on the sgRNA5 sequence of the homologous gene GmPHDLb; similarly, the sgRNA3 sequence of the target gene of GmPHDLc has a potential off-target probability of 64.3% and can act on the sgRNA6 sequence of the homologous gene GmPHDLd, so the target sequence of pCAMBIA3300-GmU6-sgRNA1 / 3 in GmPHDLb is the sgRNA5 sequence, and the target sequence in GmPHDLd is the sgRNA6 sequence.

[0125] Among them, the nucleotide sequence of SEQ ID NO: 5 is as follows: ATCATATGCCTGGACAGCCA; the nucleotide sequence of SEQ ID NO: 6 is as follows: AAAGTGGTACTGGTAGAGGA; the nucleotide sequence of SEQ ID NO: 7 is as follows: TTAGGGACTATAGGCAACGG; the nucleotide sequence of SEQ ID NO: 8 is as follows: GGGTTGATCAACATCCATCG; the nucleotide sequence of SEQ ID NO: 59 is as follows: ATCATAAGCCTGGACAGCCA; the nucleotide sequence of SEQ ID NO: 66 is as follows: TTAGGGACTATAGGCAATGG. Figure 3 The GmPHDL knockout target sequence and schematic diagram are shown.

[0126] The primers required for constructing the vector are respectively:

[0127] sgRNA1-F (SEQ ID NO: 9): GGATTGATCATATGCCTGGACAGCCA.

[0128] sgRNA1-R (SEQ ID NO: 10): AAACTGGCTGTCCAGGCATATGATCA.

[0129] sgRNA2-F (SEQ ID NO: 11): GGATTGAAAGTGGTACTGGTAGAGGA.

[0130] sgRNA2-R (SEQ ID NO: 12): AAACTCCTCTACCAGTACCACTTTCA.

[0131] sgRNA3-F (SEQ ID NO: 13): GGATTGTTAGGGACTATAGGCAATGG.

[0132] sgRNA3-R (SEQ ID NO: 14): AAACCCATTGCCTATAGTCCCTAACA.

[0133] sgRNA4-F (SEQ ID NO: 15): GGATTGGGTTGATCAACATCCATCG.

[0134] sgRNA4-R (SEQ ID NO: 16): AAACCGATGGATGTTGATCAACCCA.

[0135] 3300-F-XmaI (SEQ ID NO: 17): TTATCCCGGGTGCAAGTGCGGTGACAAGACAAGC.

[0136] 3300-R-XmaI (SEQ ID NO: 18): TATTCCCGGGGCCATTTGTCTGCAGAATT.

[0137] Dilute the upstream and downstream primers of each pair of sgRNAs to 100 μmol, and then mix them evenly at a ratio of 1:1 for annealing. Mix the annealed primers, pCAMBIA3300 vector, BsaI, T4 DNA ligase, and ligase buffer, and perform simultaneous digestion and ligation in a PCR instrument to ligate four target sites respectively; then use the universal primers 3300-F-XmaI and 3300-R-XmaI to amplify target sites 3 and 4 from the vector respectively. At the same time, perform single digestion of the vector ligated with target sites 1 and 2 with XmaI, and then use T4 DNA ligase to ligate target sites 1 and 3 together to construct pCAMBIA3300-GmU6-sgRNA1 / 3; at the same time, ligate target sites 2 and 4 together to construct pCAMBIA3300-GmU6-sgRNA2 / 4. Finally, transform the product into Escherichia coli DH5α. After plasmid extraction of the two vectors with correct sequencing, continue to transform Agrobacterium tumefaciens EHA105, and hand over the bacteria with correct identification to the Biotechnology Platform of the Institute of Modern Agriculture, Peking University for cotyledon node transformation.

[0138] Example 2 Extraction and PCR Detection of Transgenic Soybean Genomic DNA

[0139] (1) Extract the genomic DNA of soybeans by the CTAB method: First, take fresh soybean leaves with a diameter of about 1 cm and put them into a 2.0 mL centrifuge tube, add steel beads with a diameter of about 6 mm that have been cleaned, pre-cool in liquid nitrogen, and then use a grinder to sample at 50 Hz for 1 min; add 500 μL of CTAB extraction buffer: incubate at 65 °C for 1 h after shaking; after cooling to room temperature, add 500 μL of phenol:chloroform:isoamyl alcohol (25:24:1), and mix well; centrifuge at 12000 rpm for 10 min, aspirate the supernatant into a new 1.5 mL centrifuge tube, add 0.6 times the volume of isopropanol, invert and mix well, and precipitate at -20 °C for more than 30 min; centrifuge at 12000 rpm for 1 min at room temperature, discard the supernatant; add 500 μL of 70% ethanol for rinsing, centrifuge at 12000 rpm for 1 min at room temperature, and repeat once; finally, dry the ethanol at room temperature, add 100 μL of ddH2O, dissolve and store at 4 °C.

[0140] (2) PCR detection: First, use the soybean genomic DNA as a template to perform PCR amplification of four homologous genes of GmPHDL. Among them, the amplification reaction system is shown in Table 1, the amplification reaction program is shown in Table 2, and the nucleotide sequences of the amplification primers are shown in Table 3.

[0141] Table 1 PCR Amplification Reaction System

[0142]

[0143] Table 2 PCR Amplification Reaction Program

[0144]

[0145] Table 3 Nucleotide Sequences of Amplification Primers

[0146]

[0147] Table 4 Summary of Mutation Types of CRISPR-GmPHDL Edited Materials

[0148]

[0149] It should be noted that the A of the start codon ATG in Table 4 is the +1 site.

[0150] Secondly, 5 μL of the PCR product was detected by 1% agarose gel electrophoresis. The amplified fragment length was about 1000 bp, and the remaining products were identified by sequencing. The results showed that multiple T1 generation lines were detected with the GmPHDL gene edited, while the wild-type plants were not detected. The sequence alignment results are shown in Figure 4 (phdla), Figure 5 (phdlb), Figure 6 (phdlc) and Figure 7 (phdld). The mutation types of the GmPHDL gene are shown in Table 4. The T2 generation and subsequent generations were all subjected to PCR detection of the target gene and material identification using this method.

[0151] Example 3 Analysis of Flowering Time of T3 / T4 Generation GmPHDLa / b / c / d Transgenic Soybean Materials

[0152] The edited T1 generation soybeans were self-crossed to obtain T2 generation materials, and then continuously self-crossed to obtain stably inherited T3 / T4 generation transgenic soybean materials. The stably inherited transgenic soybean materials were observed and statistically analyzed for flowering time under long and short days.

[0153] The wild-type W82 and transgenic soybean seeds were respectively placed in nutrient soil and subjected to experiments under long-day conditions in the laboratory (16 h of light / 8 h of darkness; light intensity 120 μmol / (m 2 •s)) and short-day conditions in the laboratory (12 h of light / 12 h of darkness; light intensity 400 μmol / (m 2 •s)). They were normally cultured at 25 °C and the flowering time was statistically analyzed (the starting time was counted from germination, and the same was true for subsequent experiments).

[0154] Under long-day conditions, compared with the W82 line, the complete double mutant and complete quadruple mutant knockout lines of GmPHDL showed a significantly late-flowering phenotype, with an average of 24 - 30 days later flowering ( Figure 8 and Figure 9 ). The specific data are shown in Table 5.

[0155] Under short-day conditions, compared with the W82 line, the complete double mutants and complete quadruple mutants of GmPHDL also showed a significant late-flowering phenotype, with an average of 9 - 12 days later flowering ( Figure 10 and Figure 11 ), and the specific data are shown in Table 5.

[0156] Table 5 Average flowering periods of CRISPR-GmPHDL materials under long-day and short-day conditions

[0157]

[0158] It should be noted that since phdld-1, phdld-2, phdld-7, and phdld-8 are all editing types of 3bp or multiples of 3, which do not produce substantial mutations, the double mutants or quadruple mutants containing them are equivalent to single mutants or triple mutants; for example, the double mutant phdlc-3 + phdld-1 is equivalent to the single mutant phdlc-3, and for another example, the quadruple mutant phdla-2 + phdlb-2 + phdlc-1 + phdld-2 is equivalent to the triple mutant phdla-2 + phdlb-2 + phdlc-1.

[0159] The soybean plants showed delayed flowering time and shorter plant height under both long-day and short-day conditions, which is helpful for the popularization and application of soybean varieties under different climate conditions and has important ecological and agricultural significance.

[0160] Example 4 Analysis of flowering and plant height phenotypes of transgenic soybean lines of GmPHDLa / b / c / d in field planting

[0161] The stably inherited transgenic soybeans were uniformly planted in the field according to the standard of row spacing 0.4m and plant spacing 10cm, and the phenotypes such as flowering period and plant height were observed.

[0162] The natural long-day condition for the field experiment was: in the outdoor natural environment of Weifang City, Shandong Province from June to October 2024, 36°30'39"N, 119°25'46"E. The experimental data showed that Wm82 flowered at about 40 days in the field, while phdld-4 flowered 7 days later; phdlc-2 + phdld-5 flowered 8.5 days later; phdla-3 + phdlb-1 + phdlc-1 + phdld-3 and phdla-4 + phdlb-3 + phdlc-1 + phdld-3 flowered 13.5 days and 11.5 days later respectively (see Figure 12 and Figure 13 ).

[0163] The plant height of Wm82 at the full bloom stage in the field is about 52.8 cm. The plant heights of these four late-flowering edited type materials at the full bloom stage are significantly shorter (see Figure 14 ), which are 32.7 cm (phdld-4), 15.1 cm (phdlc-2 + phdld-5), 14.8 cm (phdla-3 + phdlb-1 + phdlc-1 + phdld-3), and 15.3 cm (phdla-4 + phdlb-3 + phdlc-1 + phdld-3) in Figure 14 respectively.

[0164] At the mature stage, the difference in plant height between the late-flowering mutants and Wm82 (94.6 cm) is reduced (see Figure 15 , Figure 16 and Figure 17 ), which are 87.8 cm (phdld-4), 70.3 cm (phdlc-2 + phdld-5), 62.3 cm (phdla-3 + phdlb-1 + phdlc-1 + phdld-3), and 70.1 cm (phdla-4 + phdlb-3 + phdlc-1 + phdld-3) respectively.

[0165] In various determination and analysis experiments involved in this patent, each sample was measured in parallel three times, and the results were expressed as mean ± standard deviation. The significance of the difference between each sample and the control was analyzed by two-tailed t-test (*p < 0.05; **p < 0.01; ***p < 0.001).

[0166] The natural short-day condition for the field experiment was: planted in the outdoor natural environment (18°09'34"N, 108°56'30"E) in Sanya City, Hainan Province in December 2024, and the flowering time of each edited material was analyzed in January 2025. The experimental data showed that Wm82 flowered at about 33 days in the field, while phdlc-3 + phdld-7 flowered 2.5 days later; phdlc-2 + phdld-5 flowered 7.5 days later; phdla-3 + phdlb-1 + phdlc-1 + phdld-3 and phdla-4 + phdlb-3 + phdlc-1 + phdld-3 flowered 6 days and 6.5 days later respectively (see Figure 18 ).

[0167] The full-bloom stage of soybean is a crucial phase in the transition from vegetative growth to reproductive growth. The reduction in plant height at the full-bloom stage of soybean is of great significance in enhancing photosynthetic efficiency, optimizing resource allocation (a shorter plant height at the full-bloom stage may imply that the plant allocates more resources to reproductive growth, such as flowers, pods, and seeds, rather than vegetative growth, thus increasing seed yield and quality), and adapting to the environment, which helps improve yield and planting benefits.

[0168] The plant height at the maturity stage of soybean reflects the final growth amount of the plant and is an important indicator for evaluating the growth potential of materials. The reduction in plant height at the maturity stage of soybean is of great significance in enhancing lodging resistance, adapting to the environment, breeding, mechanized harvesting, and pest and disease control, which helps improve yield and planting benefits.

[0169] From the above description, it can be seen that the above embodiments of the present invention achieve the following technical effects: By knocking out the GmPHDLa / b / c / d genes in soybean, the present invention can reduce the plant height of soybean. The change in soybean plant height may affect the growth and development and yield of soybean plants. By regulating the plant height of soybean, the plants can better adapt to the local growth environment, thereby increasing yield and quality. In addition, the knockout materials of GmPHDLa / b / c / d can also delay the flowering time of soybean, increase the time of vegetative growth of the plants, and thus contribute to improving the yield of soybean.

[0170] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention can have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A method for simultaneously regulating the plant height and flowering time of soybeans, characterized in that, The method includes: knocking out the following gene combinations in soybeans: GmPHDLc + GmPHDLd or GmPHDLa + GmPHDLb + GmPHDLc + GmPHDLd ; Among them, the GmPHDLa nucleotide sequence of the gene is SEQ ID NO: 1; The said GmPHDLb The nucleotide sequence of the gene is SEQ ID NO: 2; The said GmPHDLc The nucleotide sequence of the gene is SEQ ID NO: 3; The GmPHDLd nucleotide sequence of the gene is SEQ ID NO: 4; The knockout is carried out using the CRISPR-Cas9 gene editing system.

2. The method according to claim 1, characterized in that, The CRISPR-Cas9 gene editing system includes sgRNA; the sgRNA includes: Targeting the GmPHDLa sgRNA1 or sgRNA2 of the gene; Targeting the GmPHDLb sgRNA5 or sgRNA2 of the gene; Targeting the GmPHDLc sgRNA3 or sgRNA4 of the gene; Targeting the GmPHDLd sgRNA6 or sgRNA4 of the gene; Among them, the nucleotide sequence of the sgRNA1 is SEQ ID NO: 5; the nucleotide sequence of the sgRNA2 is SEQ ID NO: 6; the nucleotide sequence of the sgRNA3 is SEQ ID NO: 7; the nucleotide sequence of the sgRNA4 is SEQ ID NO: 8; the nucleotide sequence of the sgRNA5 is SEQ ID NO: 59; the nucleotide sequence of the sgRNA6 is SEQ ID NO:

66.

3. The method according to claim 2, wherein Knock out the said GmPHDLc + GmPHDLd gene in the following manner: Insert one T base between the 2576th and 2577th positions of the nucleotide sequence of the said GmPHDLc gene and delete 10 bases from the 2494th to 2503rd positions of the nucleotide sequence of the said GmPHDLd gene.

4. The method according to claim 2, wherein Knock out in the following manner GmPHDLa + GmPHDLb + GmPHDLc + GmPHDLd gene: 1) At the GmPHDLa 28-base deletion from the 10,041st to the 10,068th positions of the nucleotide sequence of the At the position between the 3486th and 3487th nucleotides of the GmPHDLb nucleotide sequence of the gene, one A base is added; Inserting one T base between the 2735th and 2736th positions of the nucleotide sequence of the GmPHDLc gene; and At the GmPHDLd 4-base deletion at positions 2655 to 2658 of the nucleotide sequence of the or 2) At the GmPHDLa 662-base deletion from the 9413th to the 10074th positions of the nucleotide sequence of the At the GmPHDLb 10-base deletion at positions 3477 to 3486 of the nucleotide sequence of the Insert one T base between the 2735th and 2736th positions of the nucleotide sequence of the GmPHDLc gene; and At the GmPHDLd 4-base deletion at positions 2655 to 2658 of the nucleotide sequence of the 5. Use of the method according to any one of claims 1-4 in soybean cultivation.

Images