Application of chicken miR-128-3p cavernous adeno-associated virus vector in improvement of broiler chicken muscle quality

Abstract

The invention provides application of a chicken miR-128-3p sponge adeno-associated virus vector to improvement of broiler chicken muscle quality, and belongs to the technical field of genetic engineering. The miR-128-3p sponge adeno-associated virus vector comprises miR-128-3p sponge, and the nucleotide sequence of the miR-128-3p sponge is shown as SEQ ID NO.1. The invention further provides a preparation method of the chicken miR-128-3p sponge adeno-associated virus vector. The miR-128-3p spongy adeno-associated virus vector has a good knock-down effect on miR-128-3p, the content of crude fat and crude protein in muscles can be increased, and the taste and flavor of chicken are improved.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to an application of a chicken miR-128-3p sponge adeno-associated virus vector in improving the muscle quality of broiler chickens. Background Art

[0002] Chicken is one of the most important sources of protein in the world. With the improvement of people's living standards and changes in dietary structure, the demand for broilers is increasing. White-feathered broilers grow fast and have a short market life. They can provide a large amount of muscle products to the market in a short period of time, effectively meeting people's daily meat consumption needs. Due to the short growth cycle, the accumulation of flavor substances in the muscles of white-feathered broilers is relatively small. Compared with some native chicken varieties with long growth cycles, the meat flavor is not strong enough, the taste is relatively simple, and it lacks unique flavor and mellow taste. In particular, the fat content in the muscle is low. The amount of intramuscular fat deposits in broilers is reduced, while the subcutaneous fat and abdominal fat deposits are increased. Intramuscular fat is the carrier of many flavor substances. The reduction of its content will affect the flavor of the meat, resulting in insufficient chicken flavor. Although it meets the needs of modern people for a healthy diet, it also causes the chicken to be not moist after cooking and taste slightly dry. How to change its muscle fat content and protein content without affecting the market age has become an urgent problem to be solved.

[0003] MicroRNA (miRNA) is an endogenous non-coding single-stranded RNA with a length of 21-25 bases. MiRNA regulates gene expression by binding to the 3'UTR region (untranslated region) of mRNA through the seed sequence. Very few can act on the coding sequence or promoter region. It has a wide range of effects on biological processes such as cell proliferation and differentiation, apoptosis and aging, hormone secretion, and lipid metabolism. A large number of studies have shown that miRNA plays an important role in intramuscular adipocyte differentiation and fat metabolism. Related studies have shown that overexpression of miR-128-3p promotes increased expression of marker genes for proliferation, reduces expression of marker genes for fat differentiation in intramuscular preadipocytes, reduces intracellular triglyceride content and lipid droplet content, and interferes with miR-128-3p expression, resulting in the opposite result. Although at the cellular level, it has been proven that interfering with miR-128-3p promotes the differentiation of preadipocytes, research in complex organisms is still a blank, and it is unclear whether miR-128-3p can regulate lipid deposition in vivo.

[0004] The miRNA sponge is a competitive inhibitor that can adsorb miRNA. It is a series of antisense sequences of several miRNAs connected in series and expressed in a suitable vector. Its transcript "absorbs" the corresponding miRNA, competes with the miRNA target gene, and causes the target gene to be de-inhibited. Normal miRNA regulates gene expression by binding to the target mRNA through complementary pairing. If the sponge sequence is exactly the same as the complementary sequence of the endogenous miRNA, the original RNA interference mechanism in the cell may treat it as an abnormal RNA degradation like double-stranded RNA, and thus fail to effectively play the function of adsorbing miRNA. By mutating the bases in the complementary region of the non-"seed sequence", it is possible to change its structure while ensuring that it can bind to the target miRNA, so that it is not recognized by the degradation mechanism in the cell. Summary of the invention

[0005] The purpose of the present invention is to provide an application of a chicken miR-128-3p sponge adeno-associated virus vector in improving the muscle quality of broilers, so as to increase the crude fat content and crude protein content in broiler muscles, thereby improving the taste and flavor of chicken.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is:

[0007] A chicken miR-128-3p sponge adeno-associated virus vector is used for improving broiler muscle quality. The miR-128-3p sponge adeno-associated virus vector comprises a miR-128-3p sponge. The nucleotide sequence of the miR-128-3p sponge is shown in SEQ ID NO.1.

[0008] The present invention is a pioneering invention. The present invention constructs a chicken miR-128-3p sponge adeno-associated virus vector. When constructing the miR-128-3p sponge expression vector, due to the appropriate design in terms of basic vector selection, the sequence of the mutated antisense binding site, the number of repetitions of the sequence, the spacer sequence, etc., and pAAV-RC is used as a delivery vector in adenovirus packaging, which is a type 9 AAV vector with good affinity for muscle tissue, so that the miR-128-3p sponge adeno-associated virus vector has a significantly higher knockdown effect on miR-128-3p than the basic vector pHBAAV-CMV-MCS-T2A-ZsGreen. Broiler experiments also show that it has outstanding effects on improving the crude fat content and protein content of muscles, especially the improvement of the crude fat content of breast muscles is significantly better than the basic vector pHBAAV-CMV-MCS-T2A-ZsGreen, and an unexpected technical effect is achieved. Therefore, it has important value in solving the problems of low intramuscular fat and poor taste and flavor of broilers.

[0009] Preferably, improving broiler muscle quality comprises increasing the crude fat and / or crude protein content in broiler breast muscle.

[0010] Preferably, improving broiler muscle quality comprises increasing the content of crude fat and / or crude protein in broiler leg muscles.

[0011] Preferably, the miR-128-3p sponge adeno-associated virus vector is prepared by co-transfecting AAV-293 cells with the miR-128-3p sponge expression vector, pAAV-RC and pHelper plasmids.

[0012] Further preferably, the construction method of the miR-128-3p sponge expression vector is: the miR-128-3p sponge sequence is connected to the multiple cloning site of the basic vector pHBAAV-CMV-MCS-T2A-ZsGreen, and the sequence of the miR-128-3p sponge expression vector is shown in SEQ NO: 2

[0013] Further preferably, pAAV-RC is type 9 AAV encoding rep protein and cap protein genes, which has better affinity for muscle tissue.

[0014] Further preferably, the broiler chickens are white-feathered broiler chickens. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 is the interference efficiency of miR-128-3p and the expression level of lipid metabolism-related genes in pectoral muscle in the embodiment of the present invention;

[0016] Figure 2 is the interference efficiency of miR-128-3p and the expression level of genes related to lipid metabolism in leg muscle in the embodiment of the present invention;

[0017] Figure 3 is the interference efficiency of miR-128-3p and the expression level of lipid metabolism-related genes in the liver in the embodiment of the present invention;

[0018] Figure 4 is the weight of the pectoral muscles in the embodiment of the present invention;

[0019] Figure 5 The crude fat and crude protein contents in the embodiment of the present invention;

[0020] Figure 6 This is the oil red staining of the pectoral muscle tissue in the embodiment of the present invention;

[0021] Figure 7 This is the Oil Red staining of the leg muscle tissue in the example of the present invention. DETAILED DESCRIPTION

[0022] The present invention mainly aims at the problems of low intramuscular fat content and poor taste and flavor of broilers in the prior art, and provides an application of a chicken miR-128-3p sponge adeno-associated virus vector in improving the muscle quality of broilers. The miR-128-3p sponge expression vector is constructed by designing the miR-128-3p sponge base sequence, and then the miR-128-3p sponge adeno-associated virus vector is obtained by packaging with an adeno-associated virus. The miR-128-3p sponge adeno-associated virus vector can be injected into the breast of broilers to inhibit the expression of miR-128-3p and increase the crude fat and crude protein contents of the breast muscle and leg muscle, which is beneficial to improving the taste and flavor of chicken.

[0023] The technical solution of the present invention is further described below in conjunction with specific embodiments. Unless otherwise specified, the equipment and reagents used in each embodiment can be obtained from commercial sources.

[0024] In the following examples, unless otherwise specified, the examples are based on conventional experimental conditions or the conditions recommended by the manufacturer's instructions.

[0025] The technical solution of the present invention is further described below in conjunction with specific embodiments.

[0026] The miR-128-3p sponge is shown in SEQ ID NO: 1: AAAGAGACCAACCACTGTGATATACAAAGA GACCAACCACTGTGAACATCAAAGAGACCAACCACTGTGATCTTCAAAAGAGACCAAC CACTGTGA;

[0027] The sequence of the miR-128-3p sponge expression vector is shown in SEQ ID NO: 2 in the sequence listing;

[0028] The reverse complementary sequence of the miR-128-3p mutation is shown in SEQ ID NO: 3: AAAGAGACCAACCACTGTGA;

[0029] The reverse complementary sequence of miR-128-3p is shown in SEQ ID NO: 4: AAAGAGACCGGTTCACTGTGA;

[0030] The sequence of miR-128-3p is shown in SEQ ID NO: 5: TCACAGTGAACCGGTCTCTTT.

[0031] 1. Specific application of a chicken miR-128-3p sponge adeno-associated virus vector of the present invention in improving broiler muscle quality

[0032] Example

[0033] Example 1

[0034] This example is the preparation of miR-128-3p sponge adeno-associated virus vector, and the specific preparation steps are as follows:

[0035] Use pHBAAV-CMV-MCS-T2A-ZsGreen as the basic vector for vector enzyme digestion and recovery:

[0036] Add the reagents in the order listed in Table 1, pipette gently to mix, and place in a 37°C water bath to react for 1-2 hours;

[0037] Table 1 Vector restriction enzyme digestion system

[0038]

[0039]

[0040] After the enzyme digestion, agarose gel electrophoresis was performed to recover the target fragment. The designed primers for the target fragment are shown in SEQ ID NO: 6 and SEQ ID NO: 7 in Table 2. Then, PCR was performed to amplify the target fragment.

[0041] Table 2 Primer sequences of target fragments

[0042]

[0043] PCR amplification of target fragments: prepare the system as shown in Table 3 below, mix gently, place in a PCR instrument for reaction, and the PCR program is shown in Table 4 below;

[0044] Table 3 Fragment PCR amplification system

[0045]

[0046] Table 4 PCR program for amplifying target fragments

[0047]

[0048]

[0049] Ligation of target fragment and vector: Prepare the reaction system shown in Table 5 in an ice-water bath. If the liquid accidentally sticks to the tube wall, it can be sunk to the bottom of the tube by brief centrifugation. After the ligation reaction solution reacts at 50℃ for 30min, place it on ice for 5min and transform immediately.

[0050] Table 5 Reaction system of ice water bath

[0051]

[0052] The steps of conversion are as follows:

[0053] 1) After taking out the DH5α competent cells from the -80℃ refrigerator, they should be immediately placed on ice to thaw. The competent cell packaging process should be gentle to reduce mechanical damage to them;

[0054] 2) After the competent medium is thawed, aliquot it into 50 μL volumes per tube (20 μL for plasmid transformation). After aliquoting, add the ligation product (5 μL ligation product) in an amount not exceeding 1 / 10 of the competent medium volume and place it on ice for 20-30 min.

[0055] 3) Heat shock at 42℃ for 90s (this time must be very strict), and immediately put it on ice for 2-3min after heat shock;

[0056] In a clean bench, add 500 μL LB medium (note that it must be LB medium without antibiotics) and gently invert it upside down 3-5 times;

[0057] 5) Incubate at 37°C, 230 rpm with shaking for 45-60 min;

[0058] 6) Apply the bacterial solution to the solid plate of the corresponding resistance, spread it evenly, and then incubate the plate upside down at 37°C incubator for 12-16 hours;

[0059] Bacterial liquid PCR identification: Add the components listed in Table 6 in sequence, mix by pipetting, and then perform PCR amplification according to the procedure shown in Table 7.

[0060] Table 6 Bacterial liquid PCR identification system

[0061]

[0062]

[0063] Table 7 Bacterial liquid PCR identification procedure

[0064]

[0065] After sequencing and comparison, the miR-128-3p sponge expression vector pHBAAV-CMV-miR-128-3pSponge-T2A-ZsGreen (sequence as shown in SEQ ID NO: 2) was constructed, and the target fragment connected to the vector, i.e., the miR-128-3p sponge sequence, was shown in SEQ ID NO: 1. After successful sequencing and comparison, bacterial liquid amplification was performed, and then the plasmid, i.e., the miR-128-3p sponge expression vector, was extracted and purified, and the plasmid extraction was performed using a conventional kit on the market (the extraction was performed strictly in accordance with the kit instructions). After the extracted plasmid was verified to be qualified, it was used to transfect cells, requiring the concentration of the plasmid to be greater than 200 ng / ul, and 260 / 280 to be between 1.8-2.0.

[0066] The prepared plasmid pHBAAV-CMV-miR-128-3p Sponge-T2A-ZsGreen (miR-128-3p sponge expression vector) was co-transfected with pAAV-RC and pHelper plasmids into AAV-293 cells. After 6 hours of transfection, the complete medium containing 10% fetal bovine serum was replaced. After 72 hours, the AAV-293 cells rich in adeno-associated virus particles were collected. After repeated freezing and thawing of the cells for 3 times, the supernatant containing the virus particles was collected. The high-titer purified adeno-associated virus particles, namely the miR-128-3p sponge adeno-associated virus vector, were obtained by omnipotent nuclease treatment and column purification. Finally, the titer of adeno-associated virus bacteria, fungi, and mycoplasma was detected.

[0067] Example 2

[0068] This example is the application of chicken miR-128-3p sponge adeno-associated virus vector in improving broiler muscle quality. The specific preparation steps are as follows:

[0069] Twenty healthy 14-day-old AA broilers (10 roosters and 10 hens) with similar weight were selected. The experimental chickens were transferred to the experimental chicken house one week in advance to avoid stress caused by the new environment to the experimental chickens. The experimental chickens were fed according to the AA broiler feeding standards and divided into two groups, each with 5 roosters and 5 hens. The injection began when the experimental chickens were 21 days old. One group was injected with the qualified miR-128-3P sponge adeno-associated virus vector as the experimental group, and the other group was injected with the basic vector pHBAAV-CMV-MCS-T2A-ZsGreen as the control group. The experimental chickens were weighed on the day of injection, and the corresponding dose of miR-128-3p sponge adeno-associated virus vector (1ul / 4g) was injected into the pectoral muscle of the experimental chickens according to their weight. Half of the corresponding dose was injected into the left and right pectoral muscles respectively, presenting a "rice"-shaped uniform injection, 10ul was injected at each site, and the injection depth was about 2cm. When injecting at each site, a 1mL sterile syringe was slowly pushed. Before and after injection, the injection site on the chicken's chest was wiped and disinfected with alcohol cotton to prevent infection.

[0070] On the 21st day after the injection treatment, the experimental chickens were slaughtered, the intact left and right pectoral muscles were stripped and weighed, and the intact right pectoral muscle was stored in a -80°C refrigerator for subsequent crude fat and crude protein determination; part of the left pectoral muscle and leg muscle tissue was stored in a -80°C refrigerator for subsequent real-time fluorescence quantification, and part of the left pectoral muscle and leg muscle tissue was fixed in 4% paraformaldehyde for subsequent oil red staining.

[0071] Fluorescence quantitative detection: The expression levels of genes related to lipid anabolism, including CEBPA (adipose differentiation marker gene), FASM (adipose anabolism marker gene), PPARG (adipose differentiation marker gene), FABP (adipose differentiation marker gene), ACC (adipose anabolism marker gene), FDPS (a preadipocyte differentiation-related gene), and APOA1 (adipose differentiation marker gene), were detected. The interference efficiency of miR-128-3p was verified in pectoral muscle, leg muscle, and liver tissues. The quantitative process was a routine experimental operation, and the quantitative primers were synthesized in the Zhengzhou Synthesis Department of Qingke Biotechnology.

[0072] Total RNA was isolated from pectoral muscle, leg muscle, and liver tissue using TRIzol (Invitrogen Life Technologies, Shanghai, China) reagent according to the manufacturer's instructions. Total RNA was reverse transcribed using reverse transcriptase, and then its concentration, quality, and integrity were determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific). Gene expression data were normalized relative to reference genes using the ΔΔCT method, and 2^-ΔCT values ​​were statistically analyzed. All primers used in qRT-PCR, SEQ ID NO: 8-SEQ ID NO: 25, are shown in Table 8.

[0073] Table 8 qRT-PCR primer sequences

[0074]

[0075] Crude protein was determined by Kjeldahl method; crude fat was determined by Soxhlet extraction. 7g of breast muscle and leg muscle were air-dried in an oven at 105℃ for 4-5h. The air-dried samples were used to measure the crude protein and crude fat contents. Crude protein was determined by Kjeldahl method (GB / T 5009.5-2016) using Kjeldahl nitrogen analyzer (KT-2300, FOSS, Hillerod, Denmark). Crude fat content was determined by diethyl ether extraction-immersion method (Soxhlet extraction method) (GB / T14772-2008).

[0076] Oil red staining was entrusted to Zhengzhou Nuohao Biotechnology Co., Ltd. and was handled strictly in accordance with the company's procedures.

[0077] Experimental results:

[0078] (1) The interference efficiency of miR-128-3p and the expression of genes related to lipid metabolism in pectoral muscle Figure 1As shown, compared with the control group, miR-128-3p in the pectoral muscle of the experimental group (i.e., the "injection group" in the figure) was downregulated by 2.1 times, the expression of lipid metabolism-related genes in the experimental group was increased overall, and the expression of FDPS was significantly upregulated (* represents P < 0.05).

[0079] The experimental results show that the miR-128-3p sponge adeno-associated virus vector of the present invention can effectively interfere with the expression of miR-128-3p in pectoral muscle.

[0080] (2) The interference efficiency of miR-128-3p and the expression of genes related to lipid metabolism in leg muscles Figure 2 As shown, compared with the control group, there was no significant difference in miR-128-3p in the leg muscles of the experimental group and the control group. Compared with the control group, the expression of lipid-related genes in the experimental group was improved overall, and the expression of CEBPA, ACC, and FDPS was significantly upregulated (* represents P < 0.05).

[0081] The experimental results show that the miR-128-3p sponge adeno-associated virus vector of the present invention has a low effect on the expression of miR-128-3p in broiler leg muscles, but the expression level of lipid-related genes is increased.

[0082] (3) The interference efficiency of miR-128-3p and the expression of genes related to lipid metabolism in the liver Figure 3 As shown, compared with the control group, there was no significant difference in miR-128-3p in the liver between the experimental group and the control group, and there was basically no difference in the expression of lipid metabolism-related genes in the experimental group, except that ACC expression was significantly downregulated (* represents P < 0.05).

[0083] The experimental results show that the miR-128-3p sponge adeno-associated virus vector of the present invention has no effect on the changes in lipid content in broiler livers.

[0084] (4) The breast muscle weight of the test chicken is as follows Figure 4 As shown, compared with the control group, the weight of the pectoral muscle in the experimental group was increased, but the difference was not significant, indicating that the miR-128-3p sponge adeno-associated virus vector of the present invention also has a certain effect on the increase of pectoral muscle weight.

[0085] (5) The crude fat and crude protein content of the experimental chickens Figure 5 As shown, compared with the control group, the crude fat content in the pectoral muscle of the experimental group was significantly increased (* represents P < 0.05), and the crude protein in the pectoral muscle was also increased, but the difference was not significant; at the same time, the crude fat and crude protein in the leg muscles were tested, and it was found that the content of crude fat and crude protein did not change significantly, but both increased.

[0086] The experimental results show that the miR-128-3p sponge adeno-associated virus vector of the present invention can effectively increase the crude fat and crude protein content of broiler breast muscles and also has a certain effect on increasing the crude fat and crude protein content of leg muscles.

[0087] (6) Oil red staining of breast muscle tissue of experimental chickens Figure 6 As shown, compared with the control group, the experimental group had more accumulated lipid droplets in the pectoral muscle (the red color in the figure is lipid droplets), indicating that the miR-128-3p sponge adeno-associated virus vector of the present invention can effectively increase the fat content of the pectoral muscle, which corresponds to the above-mentioned pectoral muscle experimental results.

[0088] (7) Oil red staining of the leg muscle tissue of the experimental chicken Figure 7 As shown, compared with the control group, the experimental group had more accumulated fat droplets in the leg muscles (red in the figure is fat droplets), but there were still some areas where muscle fat droplet staining remained unchanged, indicating that the miR-128-3p sponge adeno-associated virus vector of the present invention can also increase the fat content of some leg muscles, which is consistent with the above-mentioned leg muscle experimental results.

[0089] Finally, it is noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A chicken miR-128-3p sponge adeno-associated virus vector for improving broiler muscle quality, characterized in that: The miR-128-3p sponge adeno-associated virus vector includes a miR-128-3p sponge, and the nucleotide sequence of the miR-128-3p sponge is shown in SEQ ID NO.

1.

2. The use of the chicken miR-128-3p sponge adeno-associated virus vector in improving broiler muscle quality according to claim 1, characterized in that: The improving of broiler muscle quality comprises increasing the content of crude fat and / or crude protein in broiler breast muscle.

3. The use of the chicken miR-128-3p sponge adeno-associated virus vector in improving broiler muscle quality according to claim 1, characterized in that: The improving of broiler muscle quality comprises increasing the content of crude fat and / or crude protein in broiler leg muscles.

4. The use of the chicken miR-128-3p sponge adeno-associated virus vector in improving broiler muscle quality according to claim 1, characterized in that: The miR-128-3p sponge adeno-associated virus vector is prepared by co-transfecting AAV-293 cells with the miR-128-3p sponge expression vector, pAAV-RC and pHelper plasmids.

5. The use of the chicken miR-128-3p sponge adeno-associated virus vector in improving broiler muscle quality according to claim 4, characterized in that: The construction method of the miR-128-3p sponge expression vector is as follows: the miR-128-3p sponge sequence is connected to the multiple cloning site of the basic vector pHBAAV-CMV-MCS-T2A-ZsGreen, and the sequence of the miR-128-3p sponge expression vector is shown in SEQ NO:

2.

6. The use of the chicken miR-128-3p sponge adeno-associated virus vector in improving broiler muscle quality according to claim 4, characterized in that: The pAAV-RC is a type 9 AAV encoding rep protein and cap protein genes.

7. Use of the chicken miR-128-3p sponge adeno-associated virus vector according to any one of claims 1 to 6 in improving broiler muscle quality, characterized in that: The broiler chicken is a white-feather broiler chicken.

Images