Method for inducing sugarcane to resist sugarcane smut

Abstract

The invention discloses a method for inducing sugarcane to resist sugarcane smut, and belongs to the technical field of sugarcane disease resistance. The method disclosed by the invention comprises the following steps: (1) obtaining sugarcane smut Pep1 gene knockout mutants PepMAT-1 and PepMAT-2; (2) culture of a sugarcane smut Pep1 gene knockout mutant: activating PepMAT-1 and PepMAT-2, and then inoculating the activated PepMAT-1 and PepMAT-2 to a YePS liquid culture medium for shake cultivation; and (3) inducing sugarcane to resist smut: after shake cultivation, mixing the PepMAT-1 and the PepMAT-2, and inoculating the mixture on sugarcane seedlings. The method can rapidly and efficiently induce sugarcane to resist sugarcane smut, and provides technical support for prevention and treatment of sugarcane smut.

Description

Technical Field

[0001] The invention relates to a sugarcane disease resistance technology, and in particular to a method for inducing sugarcane to resist sugarcane smut. Background Art

[0002] Sugarcane smut is the most threatening disease in my country's sugarcane areas. The average incidence of smut in the main sugarcane varieties GT42 and 05-136 ratoon sugarcane in my country's sugarcane areas has reached 50%, and in some fields it is as high as over 90%. Guangxi is one of my country's main sugarcane areas. At present, due to the single sugarcane variety in Guangxi, which is planted year after year, and the lack of disease-resistant varieties, continuous planting, and the accumulation of fungal sources over the years, sugarcane smut has become more and more serious year by year.

[0003] The selection and application of disease-resistant varieties is the most economical and effective measure to prevent and control sugarcane smut, but it takes a long time to develop a sugarcane variety, about 12 years. At present, sugarcane breeding, especially disease-resistant breeding, takes about 12-14 years to form a variety, from flowering spikes, hybrid seed production, to seedling planting, continuous propagation and screening, and then disease resistance testing and regional trials. Moreover, this process is cumbersome and takes a long time, which is not enough to resist sugarcane smut. Inducing crop resistance to diseases is also one of the important measures to prevent and control diseases. If sugarcane can be induced to resist smut, this fast and efficient method can solve the defects of disease-resistant breeding. Summary of the invention

[0004] The purpose of the present invention is to solve the above problems existing in the prior art and provide a method for inducing sugarcane to resist sugarcane smut, which can quickly and efficiently induce sugarcane to resist sugarcane smut and provide technical support for preventing and controlling sugarcane smut.

[0005] In order to achieve the above object, the technical solution of the present invention is as follows:

[0006] A method for inducing sugarcane to resist sugarcane smut, comprising the following steps:

[0007] (1) Obtaining the Pep1 gene knockout mutant of sugarcane whip smut fungus:

[0008] The Pep1 gene of the mating type strains MAT-1 and MAT-2 of Ustilago farfara was homologously recombined by protoplast transformation, and the Pep1 gene knockout mutants PepMAT-1 and PepMAT-2 of MAT-1 and MAT-2 were obtained.

[0009] (2) Cultivation of Pep1 gene knockout mutants of Ustilago canefolia: PepMAT-1 and PepMAT-2 were activated and then inoculated into YePS liquid culture medium for shaking culture;

[0010] (3) Inducing sugarcane resistance to smut: After incubation in a shaking table, PepMAT-1 and PepMAT-2 were mixed and inoculated on sugarcane seedlings.

[0011] Furthermore, in step (1), the method for obtaining the Pep1 gene sequence of the mating type strains MAT-1 and MAT-2 comprises the following steps: according to the Pep1 gene sequence in the whole genome of the sugarcane whip smut fungus, designing primers Pep1-F: ATGCGAACCACACTGACTCA, as shown in SEQ ID NO.2, Pep1-R:

[0012] TCACTTGCCAAACAAGTTGC, as shown in SEQ ID NO.3; the designed primers were used to perform homologous cloning on the two mating type strains MAT-1 and MAT-2 of Sugarcane Whip Ustilago farfara, and the full-length Pep1 genes of the two mating type strains MAT-1 and MAT-2 were obtained by RT-PCR, sequencing and whole genome alignment. The Pep1 gene sequences of the two mating type strains MAT-1 and MAT-2 were consistent with the Pep1 gene sequences in the whole genome of Sugarcane Whip Ustilago farfara.

[0013] Furthermore, in step (2), PepMAT-1 and PepMAT-2 were activated on YePSA culture medium plates from a -80°C freezer, and after 2 days, they were inoculated into YePS liquid culture medium for shaking culture.

[0014] Furthermore, in step (2), the shaking incubation conditions are: culturing in a shaking incubator at 28° C. and 200 rpm for 1-2 days.

[0015] Furthermore, in step (3), the sugarcane seedlings are sugarcane varieties GT42 or 05-136 susceptible to smut.

[0016] Furthermore, in step (3), PepMAT-1 and PepMAT-2 are mixed at a volume ratio of 3:1 and then inoculated on sugarcane seedlings.

[0017] Furthermore, in step (3), PepMAT-1 and PepMAT-2 are mixed and inoculated on sugarcane seedlings, and after 15-30 days, sugarcane seedlings resistant to sugarcane smut are obtained.

[0018] Furthermore, the sugarcane seedlings are sugarcane seedlings obtained 30 days after the sugarcane seed stems are planted.

[0019] The beneficial effects of the present invention are as follows:

[0020] The invention can quickly and efficiently induce sugarcane to resist sugarcane smut, solves the problem that the traditional disease-resistant breeding process is cumbersome and time-consuming, and provides technical support for the prevention and control of sugarcane smut. DETAILED DESCRIPTION

[0021] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments.

[0022] Example

[0023] A method for inducing sugarcane to resist sugarcane smut, comprising the following steps:

[0024] 1. Construction of the induced strain of sugarcane smut pathogen

[0025] 1. Cloning of the Pep1 gene from S. scitamineum

[0026] According to the Pep1 gene sequence in the whole genome of sugarcane whip smut fungus S. scitamineum, primers Pep1-F: ATGCGAACCACACTGACTCA, as shown in SEQ ID NO.2, and Pep1-R: TCACTTGCCAAACAAGTTGC, as shown in SEQ ID NO.3 were designed; homologous cloning was performed on two mating type strains MAT-1 and MAT-2 of sugarcane whip smut fungus S. scitamineum, and the full length of the Pep1 gene of the two mating type strains MAT-1 and MAT-2 was obtained by RT-PCR, sequencing and whole genome comparison. The Pep1 gene sequences of MAT-1 and MAT-2 are shown in SEQ ID NO.1, which are consistent with the Pep1 gene sequence in the whole genome of sugarcane whip smut fungus.

[0027] The relevant information about the two mating type strains MAT-1 and MAT-2 can be found in the literature: Transcriptome analysis of Sporisorium scitamineum reveals critical environmental signals for fungalsexual mating and filamentous growth; and The mating-type locus b of the sugarcane smut Sporisorium scitamineum is essential for mating, filamentous growth and pathogenicity.

[0028] 2. Obtaining and Detecting Mutants

[0029] The Pep1 gene of MAT-1 and MAT-2 was homologously recombined by the protoplast transformation method, which is a genetic transformation system of sugarcane whip smut fungus mediated by PEG (PEG-mediated by protoplasts), and two Pep1 gene knockout mutants PepMAT-1 and PepMAT-2 of different sexual mating types MAT-1 and MAT-2 were obtained; and the sexual mating and pathogenicity of the gene knockout mutants were detected to confirm that the gene is indeed related to sexual mating and pathogenicity. The specific steps are as follows:

[0030] (1) Isolation, purification and regeneration of protoplasts:

[0031] 1) Preparation of seed solution: Take out the mating type MAT-1 / MAT-2 strains of Sugarcane Whip Ustilago farfalle from a -80°C refrigerator and activate them on plate culture medium respectively, and culture them in a constant temperature incubator at 28°C for 2 days. Scrape a small amount of MAT-1 / MAT-2 strains from the plate respectively, and culture them in 5 ml YEPS liquid culture medium at 28°C, 200 rpm, in a shaker overnight for 30 hours;

[0032] 2) Transfer: Transfer the seed solution to a conical flask containing 50 ml YEPS liquid medium at a ratio of 1:100, shake at 28°C, 200 rpm, for 5.5 h to make the OD 600 =0.6~0.7, not exceeding 0.8;

[0033] 3) Collect bacteria: put 50 ml of bacterial solution into a 50 ml centrifuge tube, centrifuge at 3000 rpm at room temperature for 10 min, and discard the supernatant;

[0034] 4) Resuspend the cells in 10 ml SCS, wash off the remaining medium, and try to avoid lumps. Centrifuge at 1000 g for 10 min at room temperature and discard the supernatant.

[0035] 5) Resuspend the cells with 2 ml of 10 mg / ml Lysing enzyme (Sigma) solution (prepared in SCS and filtered), try to avoid lumps, and place in a 28°C incubator for 30 min, shaking every 10 min.

[0036] 6) Prepare slides for microscopic examination: Take 5 ml of enzymatic hydrolysis solution on a slide, cover it with a cover slip, and observe the enzymatic hydrolysis under a microscope. If 50% of the protoplasts in a field of view are protoplasts, the enzymatic hydrolysis can be stopped;

[0037] 7) Add 8 ml of SCS solution to the enzymatic bacterial solution, centrifuge at 500 g for 10 min at room temperature, and slowly discard the supernatant;

[0038] 8) Resuspend the cells in 10 ml SCS, elute the enzymatic solution, centrifuge at 500 g for 10 min at room temperature, and slowly discard the supernatant;

[0039] 9) Repeat step 8) once;

[0040] 10) Resuspend the cells in 10 ml STC, centrifuge at 500 g for 10 min at room temperature, and slowly discard the supernatant;

[0041] 11) Resuspend the cells in 1 ml of pre-cooled STC and place on ice until use.

[0042] (2) Obtaining Pep1 knockout DNA fragments

[0043] Using wild-type genomic DNA as template,

[0044] SsPEP1-LB-F(5'-gcgtggttcttggcagcaat-3') / SsPEP1-LB-R(5'-GTCGTGACTGGGAAAACCCTG

[0045] tcatccgggtcaggtttgcg-3') and

[0046] SsPEP1-RB-F(5'-GGTCATAGCTGTTTCCTGTGTGAtgcttgcgatgagcggtga-3') / SsPEP1-RB-R(5

[0047] The left and right homologous arm fragments LB and RB (about 1.5 kb) of the SsPEP1 gene were amplified using primers '-ggagtcaaagacgtgcggga-3'.

[0048] HPT-LB-F(5'-GTCGTGACTGGGAAAACCCTG-3') / HPT-LB-R(5'-GGTCAAGACCAATGC

[0049] GGAGC-3') and

[0050] HPT-RB-F(5'-GCAAGACCTGCCTGAAAACCG-3') / HPT-RB-R(5'-TCACACAGGAAACAGC

[0051] The left (right) homology arm DNA fragment and HPT-up (HPT-down) were used as templates and

[0052] SsPEP1-LB-F / HPT-LB-R (HPT-RB-F / SsPEP1-RB-R) were used as primers, and overlapping PCR was used to fuse the left homology arm DNA fragment and HPT-up (right homology arm DNA fragment and HPT-down).

[0053] Max Super-Fidelity DNA Polymerase (Novozyme, P505-d1) amplification, the reaction procedure is shown in Table 1 below:

[0054] Table 1

[0055]

[0056] (3) PEG-mediated transformation:

[0057] Selective regeneration plate: bottom layer is 10 ml YEPSS (Amp 100 μg / ml, Cef 300 μg / ml, Hyg 200 μg / ml), upper layer is 10 ml YePSS (without antibiotics)

[0058] 1) Pipette 50 ml of protoplasts into a new sterile 1.5 ml centrifuge tube, add 1 ml of sodium heparin and 1-5 mg (10 ml) of DNA fragment, mix well and place on ice for 10 min;

[0059] 2) Add 500 ml of 40% PEG3350 to the centrifuge tube, mix well and place on ice for 15 min;

[0060] 3) Transfer the mixed solution in the 1.5 ml centrifuge tube to 5 ml of YePS soft agar semi-solid medium (about 45°C), mix well, and spread it onto the selective regeneration plate.

[0061] 4) After the plates are dry, seal them and place them in a 28°C incubator for 5-8 days to allow transformants to grow.

[0062] (4) Resistance screening:

[0063] Use a sterile toothpick to pick up a small amount of transformants obtained by PEG-mediated protoplast transformation and put them into a clean and sterile 2 mL centrifuge tube, then add 0.5 mL of YePS liquid culture medium (containing 100 ug / mL Amp, 100 ug / mL Cef and 200 ug / mL Hyg B antibiotic), and culture at 28 ° C, 200 rpm for 2 days. Then, the transformants that can grow in the YePS liquid culture medium with resistance screening antibiotics are subjected to resistance screening, and finally the genomic DNA of the transformants is extracted for PCR detection of whether the target gene is knocked out.

[0064] PCR identification was performed using the primers in Table 2 and the reaction system in Table 3 below, with the transformant and wild-type genomic DNA as templates.

[0065] Table 2

[0066] PEP1-inside-F:actgccgacgatggtgacaa PEP1-inside-R:gcccgatttcaagctggtgc PEP1-outside-F:gaggccgtgcttcttgacga PEP1-outside-R:cgccgggtgaaatcggtagt

[0067] Table 3

[0068] sample volume Final concentration DNA template 1μL About 10-50ng 10× Buffer 2.5μL 2.5mmol / LdNTP 2μL 0.2mmol / L 5μmol / L upstream primer 1μL 0.2μmol / L 5μmol / L downstream primer 1μL 0.2μmol / L 5U / μl Taq enzyme 0.2μL(1U) 0.04U / μL <![CDATA[ddH 2 The]]> 17.3μL

[0069] PCR amplification reaction program: pre-denaturation at 95°C for 2 min, then denaturation at 94°C for 40 sec, annealing at 55°C for 40 sec, extension at 72°C for 1 min, for 30 cycles; and finally extension at 72°C for 10 min.

[0070] Results: The wild type could amplify the target gene (Pep1) fragment, while the mutant could not amplify the target gene fragment, indicating that the target gene was knocked out.

[0071] (5) Sexual mating and pathogenicity detection of mutants:

[0072] After knocking out the Pep1 gene, the mutants of MAT-1 and MAT-2: PepMAT-1 and Pep MAT-2 were inoculated into 0.5 mL of YePS liquid medium (containing 100 ug / mL Amp, 100 ug / mL Cef and 200 ug / mL Hyg B antibiotics), respectively, and cultured at 28°C and 200 rpm for 2 days. After the PepMAT-1 and Pep MAT-2 bacterial solutions were mixed in equal volumes, 1) 2 ul of the mixed bacterial solution was pipetted and inoculated onto YePSA solid medium, placed in a 28°C constant temperature incubator, and cultured for 2 days to detect whether white colonies grew, and the wild-type strain was used as a control. After 2 days, the wild-type grew white colonies, indicating that sexual mating was successful, while the mutants PepMAT-1 and Pep MAT-2 did not grow white colonies or grew faint white colonies on the culture medium, indicating the lack of sexual mating ability or weak sexual mating ability. Therefore, it is proved that the Pep1 gene is related to sexual mating. 2) 1 mL of the mixed solution was inoculated into the growth point of 30 cm high sugarcane seedlings using a 1 mL syringe. The inoculated sugarcane seedlings were potted in a greenhouse and the disease was checked after 60 days. After 60 days, the incidence of smut in the wild type was 80%, while the incidence of mutants PepMAT-1 and Pep MAT-2 was 0% after 150 days, indicating that the mutants lacked pathogenicity after the Pep1 gene was knocked out, thus confirming that the Pep1 gene is related to pathogenicity.

[0073] 2. Inoculation of sugarcane with the Pep1 mutant of S. scitamineum to induce disease resistance

[0074] (1) Cultivation of Pep1 gene knockout mutant of S. scitamineum

[0075] The Pep1 gene mutants of different mating types MAT-1 and MAT-2 of sugarcane whip fungus S. scitamineum, namely PepMAT-1 and Pep MAT-2, were activated on YePSA culture medium plates from a -80°C refrigerator. After 2 days, they were inoculated into YePS liquid culture medium and cultured in a shaker at 28°C and 200 rpm.

[0076] (2) Inducing sugarcane resistance to smut

[0077] After 2 days of shaking culture, the Pep1 gene mutants PepMAT-1 and PepMAT-2 of different sex mating types MAT-1 and MAT-2 were mixed at a volume ratio of 1:1 and inoculated on sugarcane seedlings of the smut-susceptible sugarcane variety GT42 (sugarcane seed stems potted for 30 days). After 30 days, the wild-type strains of sugarcane smut pathogen MAT-1+MAT-2 were inoculated again. A positive control (inoculated with wild-type strains of sugarcane smut pathogen MAT-1 and MAT-2 at a volume ratio of 1:1) was set up, and then the disease incidence (sugarcane smut incidence) of the inoculated sugarcane treatment and the control was observed, and the investigation was carried out until 4 months after inoculation.

[0078] 3. Results of inducing sugarcane resistance to sugarcane smut

[0079] The method of the present invention was used to first inoculate GT42 tissue culture seedlings (a highly susceptible smut variety) with different volume ratios of Pep1 deletion mutants PepMAT-1+Pep MAT-2 on August 16, 2022, and then inoculated with wild-type sugarcane smut pathogen strains MAT-1+MAT-2 on 0 days, 1 day, 3 days, 7 days, 15 days, and 30 days, with 10 plants treated each time; MAT-1+MAT-2 was also inoculated as a control; and the disease was observed for 120 days.

[0080] Table 4

[0081]

[0082]

[0083] From the data comparison in Table 4, it can be seen that 4 months after inoculation, the treatment induction effect was best when the volume ratio of PepMAT-1+Pep MAT-2 was 3:1 and the inoculation interval was 30 days. The incidence of sugarcane smut in the positive control reached 70%, the incidence of the negative control was 0%, and the incidence of the induced treatment was 0%. It can be seen that the induction treatment of the present invention significantly improves the ability of sugarcane to resist smut. At the same time, compared with the treatment of other ratios of PepMAT-1+Pep MAT-2, the volume ratio of PepMAT-1 to Pep MAT-2 was 3:1, and the effect was particularly significant.

[0084] Although the present invention has been disclosed as above with preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art may make some modifications and improvements without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention shall be based on the definition of the claims.

Claims

1. A method for inducing sugarcane resistance to sugarcane smut, characterized in that: The steps include: (1) Obtaining the Pep1 gene knockout mutant of sugarcane whip smut fungus: Homologous recombination was performed on the Pep1 gene of the mating type strains MAT-1 and MAT-2 of the sugarcane whip smut fungus by protoplast transformation to obtain Pep1 gene knockout mutants PepMAT-1 and PepMAT-2 of MAT-1 and MAT-2; the Pep1 gene sequences of the mating type strains MAT-1 and MAT-2 are shown in SEQ ID NO.1; (2) Cultivation of Pep1 gene knockout mutants of Ustilago canefolia: PepMAT-1 and PepMAT-2 were activated and then inoculated into YePS liquid culture medium for shaking culture; (3) Inducing sugarcane resistance to smut: After incubation in a shaking table, PepMAT-1 and PepMAT-2 were mixed and inoculated on sugarcane seedlings.

2. A method for inducing sugarcane resistance to sugarcane smut according to claim 1, characterized in that: In step (1), the method for obtaining the Pep1 gene sequence of the mating type strains MAT-1 and MAT-2 comprises the following steps: according to the Pep1 gene sequence in the whole genome of the sugarcane whip smut fungus, designing primers Pep1-F: ATGCGAACCACACTGACTCA, as shown in SEQ ID NO.2, and Pep1-R: TCACTTGCCAAACAAGTTGC, as shown in SEQ ID NO.3; using the designed primers to perform homologous cloning on the two mating type strains MAT-1 and MAT-2 of the sugarcane whip smut fungus, respectively, and obtaining the full length of the Pep1 gene of the two mating type strains MAT-1 and MAT-2 by RT-PCR, sequencing and whole genome alignment; the Pep1 gene sequences of the two mating type strains MAT-1 and MAT-2 are consistent with the Pep1 gene sequence in the whole genome of the sugarcane whip smut fungus.

3. The method for inducing sugarcane resistance to sugarcane smut according to claim 1, characterized in that: In step (2), PepMAT-1 and PepMAT-2 were activated on YePSA culture medium plates from a -80°C freezer, and after 2 days, they were inoculated into YePS liquid culture medium for shaking culture.

4. The method for inducing sugarcane resistance to sugarcane smut according to claim 1, characterized in that: In step (2), the shaking incubation conditions are: culturing in a shaking incubator at 28°C and 200 rpm for 1-2 days.

5. The method for inducing sugarcane resistance to sugarcane smut according to claim 1, characterized in that: In step (3), the sugarcane seedlings are sugarcane seedlings of the smut-susceptible sugarcane variety GT42 or 05-136.

6. The method for inducing sugarcane resistance to sugarcane smut according to claim 1, characterized in that: In step (3), PepMAT-1 and PepMAT-2 were mixed at a volume ratio of 3:1 and inoculated on sugarcane seedlings.

7. The method for inducing sugarcane resistance to sugarcane smut according to claim 1, characterized in that: In step (3), PepMAT-1 and PepMAT-2 are mixed and inoculated on sugarcane seedlings. After 15-30 days, sugarcane seedlings resistant to sugarcane smut are obtained.

Images