Method for producing sustainable aviation fuel main component by using photoenzyme decarboxylation reaction

Abstract

The invention belongs to the field of biological catalysis and green chemistry, and particularly relates to a method for producing a sustainable aviation fuel main component by utilizing a photoenzyme decarboxylation reaction, which comprises the following steps: S1, constructing a fatty acid photodecarboxylase mutant; screening the optimal chlorella; s2, extracting a chlorella fatty acid light decarboxylase gene from the screened optimal chlorella; s3, constructing engineering bacteria; s4, extracting active fatty acid light decarboxylase from the engineering bacteria; s5, immobilizing the active fatty acid light decarboxylase to obtain immobilized fatty acid light decarboxylase; s6, converting the long-chain fatty acid into a mixed product containing hydrocarbon by utilizing the immobilized fatty acid light decarboxylase; and S7, separating and purifying the hydrocarbon-containing mixed product to generate an alkane product serving as the aviation fuel mixed component. The technology provided by the invention has the advantages of mild process, high carbon conversion rate and low production cost, and the produced alkane product has high purity and meets the quality requirements on sustainable aviation fuel components in industrial application.

Description

Technical Field

[0001] The present invention belongs to the field of biocatalysis and green chemistry, and relates to the production of sustainable aviation fuel (SAF) and fine chemicals, and in particular to a method for producing the main component of sustainable aviation fuel by utilizing photoenzymatic decarboxylation reaction. Background Art

[0002] As the global demand for carbon emission reduction continues to increase, especially in the aviation industry, the development of carbon-neutral fuels has become key. Traditional aviation fuels have significant carbon emissions. In order to achieve the goal of reducing carbon emissions, sustainable aviation fuel (SAF) is considered to be the most promising alternative. The current main SAF production technologies, such as hydrotreated fatty acids and esters (HEFA), have a relatively mature process basis, but still have problems such as high production energy consumption and low selectivity, resulting in its cost being much higher than traditional aviation fuel. Fatty acid photodecarboxylase technology, as an emerging photoenzyme catalysis method, has been found to be able to decarboxylate long-chain fatty acids to produce alkane fuel molecules under mild conditions, thus providing another potential solution for the green production of SAF. However, the current photocatalytic efficiency of fatty acid photodecarboxylase is low, which limits its large-scale industrial application. There is an urgent need for a method that can convert long-chain fatty acids into carbon-neutral liquid fuels and hydrocarbons through photoenzyme decarboxylation reactions with high catalytic efficiency and large-scale industrial application to produce sustainable aviation fuels that meet the needs. Summary of the invention

[0003] In order to solve the problem of low photocatalytic efficiency of fatty acid photodecarboxylase, a method is proposed that can efficiently convert long-chain fatty acids into carbon-neutral liquid fuels and hydrocarbons through photoenzymatic decarboxylation reaction.

[0004] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions: The method for producing the main component of sustainable aviation fuel by photoenzymatic decarboxylation reaction comprises the following steps: S1: Construction of fatty acid photodecarboxylase mutants; screening of optimal Chlorella; S2: Extracting the Chlorella fatty acid photodecarboxylase gene from the best Chlorella selected; S3: Construction of engineered bacteria; S4: extracting active fatty acid photodecarboxylase from the engineered bacteria produced in step S3; S5: immobilizing the active fatty acid photodecarboxylase to obtain immobilized fatty acid photodecarboxylase; S6: Converting long-chain fatty acids into mixed products containing hydrocarbons using immobilized fatty acid photodecarboxylase; S7: Separating and purifying the mixed product containing hydrocarbons to generate alkane products as a mixed component of aviation fuel.

[0005] Preferably, in step S1, constructing the fatty acid photodecarboxylase mutant is specifically to design primers to amplify the Chlorella fatty acid photodecarboxylase gene using PCR, and the PCR amplification conditions are: Pre-denaturation at 98°C for 2 minutes; denaturation at 98°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1 minute, for a total of 30 cycles; terminal extension at 72°C for 5 minutes.

[0006] Preferably, in step S3, the process of constructing the engineered bacteria is: The Chlorella fatty acid photodecarboxylase gene and the expression plasmid containing the His tag were connected by ligation, and then the recombinant plasmid was transformed into Escherichia coli, and the T7 promoter was used to drive efficient expression; 0.5-1.0 mM isopropyl-β-D-thiogalactoside was used to induce protein expression; the culture medium used LB medium containing 50 μg / mL kanamycin, the initial culture temperature was 37°C, and when OD600 reached 0.6-0.8, the temperature was lowered to 16-20°C for inducing expression, the stirring speed was 200 rpm, and the induction time was 4-16 hours to promote correct folding and increase the activity of Chlorella fatty acid photodecarboxylase.

[0007] Preferably, in step S4, the process of extracting active fatty acid photodecarboxylase is: SS1: Ultrasonication is used to lyse engineered bacterial cells to release cell contents and form a cell suspension; SS2: centrifuging the lysed cell suspension to remove cell debris and precipitate to obtain a supernatant containing fatty acid photodecarboxylase; SS3: gradually add ammonium sulfate to the supernatant to reach 30-60% saturation, stir evenly, and let stand at 4°C for 1 hour to allow fatty acid photodecarboxylase to precipitate; SS4: centrifuge the fatty acid photodecarboxylase precipitate again, collect the fatty acid photodecarboxylase precipitate and dissolve it in phosphate buffer solution; SS5: Use Ni²⁺-NTA resin to bind the His tag of fatty acid photodecarboxylase, add the bound fatty acid photodecarboxylase solution to the pre-packed affinity column, and keep the operation at 4°C to ensure the activity of fatty acid photodecarboxylase; SS6: Elute the enzyme solution with a buffer and collect the eluate; SS7: DEAE-Sepharose is used as an anion exchange carrier to remove excess salt and buffer components; SS8: High-purity liquid active fatty acid photodecarboxylase was obtained by concentrating the eluate using an ultrafiltration membrane with a molecular weight cutoff of 30 kDa.

[0008] Preferably, in the process of extracting active fatty acid photodecarboxylase, the parameters of ultrasonic lysis in step SS1 are a frequency of 20 kHz, a power of 300-400 W, each treatment for 30 seconds, an interval of 30 seconds, and repeated treatment 5-10 times to avoid protein denaturation; A 50 mM phosphate buffer solution was used to maintain the pH at 7.5, and 1 mM protease inhibitor PMSF was added to protect fatty acid photodecarboxylase from degradation; In step SS2, the centrifugation speed is 12,000 rpm, the temperature is 4° C., and the time is 20 minutes; In step SS4, the centrifugation speed is 12,000 rpm, the temperature is 4°C, the time is 20 minutes, and the phosphate buffer solution is 50 mM; The buffer in step SS6 is a buffer containing 20-250 mM imidazole.

[0009] Preferably, the process of immobilizing active fatty acid photodecarboxylase in step S5 is as follows: SS1: Amination of the carrier; SS2: A cross-linking agent is applied to the surface of the aminated carrier, and then active fatty acid decarboxylase is added to allow the active fatty acid photodecarboxylase to bind to the carrier through a covalent bond to generate solidified fatty acid decarboxylase.

[0010] Preferably, in the process of immobilizing the active fatty acid photodecarboxylase, the carrier amination process in step SS1 is: immersing the carrier in dimethyl sulfoxide containing cyanuric acid chloride and stirring at room temperature for 2-4 hours to ensure the binding of the activator to the carrier; The support was washed with anhydrous DMSO to remove unreacted activator; The activated carrier is immersed in a 5-10% volume fraction ethylenediamine solution, the pH environment is maintained at 8-9, and the reaction is carried out at room temperature or 30°C with gentle stirring for 4-12 hours; After the reaction was completed, the gel support was thoroughly washed with distilled water to remove the unreacted ethylenediamine residue; Treat the surface of the carrier with Ninhydrin solution and observe whether a blue-purple reaction occurs, indicating the presence of amine groups; The carrier is polyacrylamide gel.

[0011] Preferably, the step S6 of converting long-chain fatty acids into a mixed product containing hydrocarbons using immobilized fatty acid photodecarboxylase is as follows; SS1: Dissolve long-chain fatty acids in a mixture of water and ethanol, use phosphate buffer to ensure a stable environment for enzyme activity; add immobilized fatty acid photodecarboxylase for conversion reaction; SS2: Use UV-Vis spectrometer or gas chromatography to monitor the reaction progress online and track the consumption of substrate long-chain fatty acids and the generation of products in real time; turn off the light source after the reaction is completed to terminate the photocatalytic activity of the enzyme.

[0012] SS3: centrifugal separation of the product into an organic phase and an aqueous phase; SS4: recovering the organic solvent of the organic phase by a rotary evaporator, and concentrating the hydrocarbons in the organic solvent into a crude product; SS5: Hydrocarbons are purified using silica gel column chromatography to produce high-purity alkane products.

[0013] Preferably, in step SS1 of converting long-chain fatty acids into a mixed product containing hydrocarbons using immobilized fatty acid photodecarboxylase, the volume ratio of water to ethanol is 50:50, and the concentration is 10-50 mM; Phosphate buffer was 50 mM, pH 7.0; The concentration of immobilized fatty acid photodecarboxylase was controlled at 0.5-2.0 mg / mL; In step SS 3, the product was separated by centrifugation at 4,000 rpm for 10 minutes.

[0014] Preferably, the reaction conditions in step SS1 of converting long-chain fatty acids into a mixed product containing hydrocarbons using immobilized fatty acid photodecarboxylase are: Use blue light with a wavelength of 450-480 nm as the excitation light source; The light intensity is controlled within the range of 500-1000 μmol / m²·s; The substrate solution containing long-chain fatty acids has a concentration of 10-50 mM; pH environmental conditions are 6-8; Keep the temperature between 20-30℃; The reaction time is 12-24 hours.

[0015] Beneficial effects of the present invention: Directed evolution genetic engineering technology was used to obtain a Chlorella fatty acid photodecarboxylase with higher light stability and a wider substrate spectrum. It was able to maintain high catalytic activity under high substrate concentration conditions, and active fatty acid photodecarboxylase was extracted from the engineered bacteria after PCR amplification. By immobilizing the active fatty acid photodecarboxylase, immobilized fatty acid photodecarboxylase was produced, which improved the enzyme's operational stability, reusability, and catalytic efficiency under industrial reaction conditions.

[0016] The technology of the present invention has the advantages of mild process, high carbon conversion rate and low production cost. The produced alkane products have high purity and meet the quality requirements for sustainable aviation fuel components in industrial applications. It is suitable for the conversion of various raw materials such as waste lipids and industrial by-product fatty acids. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 It is a process flow chart of the present invention. DETAILED DESCRIPTION

[0018] For ease of understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0019] The present invention uses fatty acid photodecarboxylase to convert long-chain fatty acids (such as C16-C18) into hydrocarbons under mild conditions to form components that can be used for sustainable aviation fuel. Directed evolution technology is used to obtain a Chlorella fatty acid photodecarboxylase mutant with higher light stability and a wider substrate spectrum, which can maintain high catalytic activity under high-concentration substrate conditions, and extract active fatty acid photodecarboxylase from the engineered bacteria after PCR amplification. The operational stability, reusability and catalytic efficiency of the active fatty acid photodecarboxylase under industrial reaction conditions are improved by fixation, and the activity of the immobilized fatty acid photodecarboxylase can still be maintained at more than 80% after multiple uses.

[0020] The gene sequence of the Chlorella fatty acid photodecarboxylase mutant of the present invention is as follows: ATGTGGCTGCTCCTGTATACAGGCGCGGTCCGTCGCGGAGGTGCGCTCTCGGCACGCGCCTCTGCGGTGG AGGACATCCGCAAGGTGCTGTCTGACAGCAGCAGCCCGGTGGCGGGGCAGAAGTACGACTACTACTGGT CGGCGGCGGCACCGCGGCCTGCGTGCTGGCCAATCGCCTGTCCGCCGACGGCTCCAAGCGTGTGCTGGTG CTGGAAGCCGGCCCCGACAACACCTCGCGCGACGTCCAAGATCCCCCGCGCCATCACCCGCCTCTTCCGCA GCCCCCTCGACTGGAACCTCTTCTCCGAGCTGCAGGAGCAGCTGGCGGAGCGCCAGATCTACATGGTGCG TGCCGCGGCGGCACGGCAAAGCAGTGGGAGGCCGCTGGGCTGGCCCTGTGCGCATTTCTCGCCTGCAGCT GTGGACTGGTGTGCATACCTTCCTTTCCGTGTCGCTTTGGTTCGGCTGCAGGCGGCGCGGCCGGCTGCTGG GCGGCAGCAGCGCCACCAATGCCACGCTGTACCACCGCGGCGGCGGGCGACTATGATGCCTGGGGCGT GGAGGGCTGGAGCTCGGAGGACGTGCTCAGCTGGTTTGTGCAGGCGGAGACCAACGCCGACTTTGGTGAG GCACCAGCAGTTTGCTACCTTTTCTTTTGGTGGAGAAGCAGCCGGCCTGTGGATGTGCACAAGTGTATA GCAGTGTGTAGCAGTTTGAGGCCATCAGCATCAGCGGTGCTGAGAATCCCGCAAGTCGGCAGTTGGATGC GTACGCGGTGCCCTGGACTCTGGCTAGGCGCTGAGCGCACCAGCGCTTCCTCGCCCGTCGCTCGCCTGC AGGCCCTGGCGCGTACCACGGCAGCGGCGGCCCTATGCGTGTCGAGAACCCACGCTACACACAACAAGCAG CTGCACACCGCCTTCTTCAAGGCCGCAGAGGAGGTGGGGCTTACCCCAAACAGCGATTTCAACGACTGGA GCCACGATCATGTGAGAACACTGCACGGGGGAAGCAGCTCCAGGCGAAAGGAGGAATCTGGAGCGTTGA GGAAACTACACGGCTTTGGAGTGTGCCACAAGGGTTGATTCCGTGCCTCACTCACCTTCTGCTGCCTGCC TCATCTATTCCCCTTCCCGTGGGGCGTGCAGGCTGGGTACGGTACCTTCCAGGTCATGCAGGACAAGGGC ACACGTGCCGACATGTACCGGCAGTACCTCAAGCCCGTGCTGGGCCGCAGAAACCTGCAGGTGATGCAAG CAGCCTGCCGCCTGTTGTCACTCCGCTCTGATGCAGAACTGTAGTTTGTTGCTGCTGCCGTTTGTGTCCA ACCATTCCCTGGCTTGTTGCTGGACCGAATTGTGGCTCGCTCCCCCGCTCGGTATGTGCAGGTGCTGACC GGCGCGGCCGTGACCAAGGTCAACATTGACCAGGCTGCAGGCAAGGCGCAGGCTCTGGGTGTGGAGTTCT CAACCGACGGGCCCACAGGTGGGTGGACAGGGCGCTGCTGGCTCGCTCTCCAGCCTGACATGGGCATCCT GCCAGCTGCGTGGGACTAGCTGTAGAAGGACAGTCGTTGCGGAGGACCGCTGTGATGGGATGGTGCTTTA ACCCCTGCCTCATGGCCGCGCAGGTGAGCGGCTGAGCGCTGAGCTGGCGCCAGGCGGCGAGGTGATCATG TGTGCCGGCGCCGTGCACACGCCCTTCCTGCTCAAGCACAGCGGCGTGGGGCCCTCGGCGGAGCTCAAGG AGTTTGGCATCCCGGTGGTTTCCAACCTGGCAGGTGCGGCAGGGTGCTTGTCGGTGGAAGCAGGACTGCT GGATAGCTGGTGTAGCAGGATAGCAGGGAACCTGGGAAGGCGCTGCCTCACCGCCCTCCTTTGCCTGTGT GCCTGCAGGTGTGGGTCAGAACCTGCAGGACCAGCCCGCCTGCCTGACCGCGGCGCCGGTCAAGGAAAAG TATGATGGCATCGCCATCAGCGGTGAGCGAAACTCGCTTTTGGGACAAGCGACGATGTGTGGAGCAGCGG AGCAGTGAAGCAGTGGAGCAGCGGAGCAGTGGAGCAGCGGACCAGCAAATCTAGTCTCCACCGTTGCTTT CAGTGATGTGACATCAAGGGTGCCATGTGACCATTGATGCCAACCCTTGCCCTGCACGGCGCCCCGCCGC TCTGCAGACCACATCTACAACGAGAAGGGCCAGATCCGCAAGCGCGCCATTGCCAGCTACCTGCTGGGCG GCCGCGGCGGCCTCACATCCACCGGATGCGACCGCGGCGCCTTTGTGCGCACGGCAGGTGCGCACTCGAC ACACGCATGCAAAGGCAGGTTGTCCACGCAGGTTGGCATGCCCTCCACACTGGTATGGCCTGTGGTCTCT GGTTGTTGCCAAACACGCTGGCCCTGCTCTTGCGTCCCTGCCCGCGGGGTGCAGGCCAGGCGCTGCCAGA TCTGCAGGTGCGCTTTGTGCCGGGCATGGCGCTGGACCCGGATGGCGTGTCCACGTATGTGCGCTTTGCC AAGTTCCAGGTGAGCCCGGCGTTGAAGGGCGGCCAAGAGCAGTCAGATGAGGAGCCACATTCAACCTTGA TGGCGTATGCTTCAGATCGAGCTGTACAATGTCTGCCTGCACGTGTGGGGTTGTATCATGTTCTGACAGT TGTTCTTGGCCGCGGTTGCTGCTGCCTGCAGTCCCAGGGGCTCAAGTGGCCCAGCGGCATCACCATGCAG CTGATCGCCTGCCGCCCGCAAAGCACGGGCAGCGTGGGCCTCAAGAGTGGTGAGCGCGCAGTGCTGGTTG GGCGGATACAGCAGGAGAACGTCGTTTGGACACGGTGTGTCCAGTCCAATGGCAGGGTATTAGCAGCCCA AATCGCAACTTGTCCGTTGATGCACTTGTCCCTGCAGCCGACCCCTTTGCGCCGCCCAAGCTGAGCCCCG GCTATCTGACGGACAAGGACGGCGCTGACCTGGCCACGCTCCGCAAGGGCATCCACTGGGCGCGCGACGT GGCGCGCAGCAGCGCGCTCAGCGAGTACCTGGATGGCGAGCTGTTCCCCGGCAGCGGAGGTGCGCCTGTG CTTCTGTATGAATCACAAAATGAAGCAGGTCACTTATGTATTGAAATTTGTGTGGCTGCGCTTGGAAGTC GTATATTGCTGTGGTCTGTCTGCGCAGTGGTGAGCGATGATCAGATTGATGAGTACATCCGCCGCAGCAT CCATAGCTCCAACGCCATCACAGGCACATGCAAGGTGGGCAGGCCCTGTCTGTTGCCGTGATGCATGATG CGTGCATTCCAGGCGGCACTGGAGAAGGACGGCAGCAGGAGGGTGTGCCTTGTGTTCAGCTGAAGCGATA GATGGTCACCCTAACTGTGCAGATGGGCAATGCCGGCGACAGCAGCAGCGTGGTGGACAACCAGCTGCGG GTGCACGGTGTGGAGGGCCTGCGGGTGGTGGATGCCTCGGTGGTGCCCAAGATCCCAGGTGTGTTTCCTT GATGTTGCCTGACCATTGCTACACAGTGGCATGCCCTGGTTGGTGGTCTGGGCTGCATGCCAGGGTTTGG CATGGCCATGCATCCCATTCCCGAGTTTGGGTGAGGCAATGGAGGCCTGTTCCTCTGTTGTGCAGGTGGCC AGACGGGCGCGCCAGTGGTGATGATTGCGGAGCGCGCCGCCGCGCTGTTGACTGGCAAGGCGACGATCGG GGCGAGCGCTGCGGCCCCGGCGACAGTGGCAGCATGA.

[0021] The present invention is further described in detail below in conjunction with specific embodiments: The method for producing the main component of sustainable aviation fuel by photoenzymatic decarboxylation reaction comprises the following steps: S1: Construction of fatty acid photodecarboxylase mutants; screening of optimal Chlorella; S2: Extracting the Chlorella fatty acid photodecarboxylase gene from the best Chlorella selected; S3: Construction of engineered bacteria; S4: extracting active fatty acid photodecarboxylase from the engineered bacteria produced in step S3; S5: immobilizing the active fatty acid photodecarboxylase to obtain immobilized fatty acid photodecarboxylase; S6: Converting long-chain fatty acids into mixed products containing hydrocarbons using immobilized fatty acid photodecarboxylase; S7: Separating and purifying the mixed product containing hydrocarbons to generate alkane products as a mixed component of aviation fuel.

[0022] In step S1, constructing the fatty acid photodecarboxylase mutant specifically involves designing primers to amplify the Chlorella fatty acid photodecarboxylase gene using PCR, and the PCR amplification conditions are: Pre-denaturation at 98°C for 2 minutes; denaturation at 98°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1 minute, for a total of 30 cycles; terminal extension at 72°C for 5 minutes.

[0023] In S3, the process of constructing the engineered bacteria is as follows: the Chlorella fatty acid photodecarboxylase gene and the expression plasmid containing the His tag are connected by ligation, and then the recombinant plasmid is transformed into Escherichia coli, and the T7 promoter is used to drive efficient expression; 0.5-1.0 mM isopropyl-β-D-thiogalactoside (IPTG) is used to induce protein expression; the culture medium uses LB medium containing 50 μg / mL kanamycin, the initial culture temperature is 37°C, and when OD600 reaches 0.6-0.8, the temperature is lowered to 16-20°C for inducing expression, the stirring speed is 200 rpm, and the induction time is 4-16 hours to promote correct folding and increase the activity of Chlorella fatty acid photodecarboxylase.

[0024] In step S4, the process of extracting active fatty acid photodecarboxylase is as follows: SS1: Ultrasonication is used to lyse engineered bacterial cells to release cell contents and form a cell suspension; SS2: centrifuging the lysed cell suspension to remove cell debris and precipitate to obtain a supernatant containing fatty acid photodecarboxylase; SS3: gradually add ammonium sulfate to the supernatant to reach 30-60% saturation, stir evenly, and let stand at 4°C for 1 hour to allow fatty acid photodecarboxylase to precipitate; SS4: centrifuge the fatty acid photodecarboxylase precipitate again, collect the fatty acid photodecarboxylase precipitate and dissolve it in phosphate buffer solution; SS5: Use Ni²⁺-NTA resin to bind the His tag of fatty acid photodecarboxylase, add the bound fatty acid photodecarboxylase solution to the pre-packed affinity column, and keep the operation at 4°C to ensure the activity of fatty acid photodecarboxylase; SS6: Elute the enzyme solution with a buffer and collect the eluate; SS7: DEAE-Sepharose is used as an anion exchange carrier to remove excess salt and buffer components; SS8: High-purity liquid active fatty acid photodecarboxylase was obtained by concentrating the eluate using an ultrafiltration membrane with a molecular weight cutoff of 30 kDa.

[0025] In the process of extracting active fatty acid photodecarboxylase, the parameters of ultrasonic lysis in step SS1 are a frequency of 20 kHz, a power of 300-400 W, each treatment for 30 seconds, an interval of 30 seconds, and repeated treatment 5-10 times to avoid protein denaturation; phosphate buffer (50 mM) is used to maintain the pH environment at 7.5, and 1 mM protease inhibitor PMSF is added to protect fatty acid photodecarboxylase from degradation; the centrifugation speed in step SS2 is 12,000 rpm, the temperature is 4°C, and the time is 20 minutes; the centrifugation speed in step SS4 is 12,000 rpm, the temperature is 4°C, the time is 20 minutes, and the phosphate buffer solution is 50 mM; the buffer in step SS6 is a 20-250 mM imidazole (gradient elution) buffer (50 mM phosphate buffer, pH 7.5).

[0026] The process of immobilizing active fatty acid photodecarboxylase in step S5 is as follows: SS1: Amination of the carrier; SS2: A cross-linking agent is applied to the surface of the aminated carrier, and then active fatty acid decarboxylase is added to allow the active fatty acid photodecarboxylase to bind to the carrier through a covalent bond to generate solidified fatty acid decarboxylase.

[0027] When the active fatty acid photodecarboxylase is immobilized, the carrier amination process in step SS1 is as follows: immersing the carrier in dimethyl sulfoxide containing cyanuric acid chloride, stirring at room temperature for 2-4 hours to ensure the binding of the activator to the carrier; washing the carrier with anhydrous DMSO to remove the unreacted activator; immersing the activated carrier in 5-10% (v / v) ethylenediamine solution, maintaining the pH environment at pH 8-9, and gently stirring the reaction at room temperature or 30°C for 4-12 hours; after the reaction is completed, thoroughly washing the gel carrier with distilled water to remove unreacted ethylenediamine residues; treating the surface of the carrier with Ninhydrin solution, and observing whether a blue-purple reaction is produced, indicating the presence of amine groups; the carrier is polyacrylamide gel.

[0028] Step S6 uses immobilized fatty acid photodecarboxylase to convert long-chain fatty acids into a mixed product containing hydrocarbons as follows; SS1: Dissolve long-chain fatty acids in a mixture of water and ethanol, use phosphate buffer to ensure a stable environment for enzyme activity; add immobilized fatty acid photodecarboxylase for conversion reaction; SS2: Use UV-Vis spectrometer or gas chromatography (GC) to monitor the reaction progress online and track the consumption of substrate long-chain fatty acids and the generation of products in real time; turn off the light source after the reaction is completed to terminate the photocatalytic activity of the enzyme.

[0029] SS3: centrifugal separation of the product into an organic phase and an aqueous phase; SS4: recovering the organic solvent of the organic phase by a rotary evaporator, and concentrating the hydrocarbons in the organic solvent into a crude product; SS5: Hydrocarbons are purified using silica gel column chromatography to produce high-purity alkane products.

[0030] In step SS1 of converting long-chain fatty acids into mixed products containing hydrocarbons using immobilized fatty acid photodecarboxylase, the ratio of water to ethanol is 50:50 v / v, and the concentration is 10-50 mM; the phosphate buffer is 50 mM, pH 7.0; the concentration of immobilized fatty acid photodecarboxylase is controlled at 0.5-2.0 mg / mL; in step SS 3, the products are separated by centrifugation at 4,000 rpm for 10 minutes.

[0031] The reaction conditions in step SS1 of converting long-chain fatty acids into mixed products containing hydrocarbons using immobilized fatty acid photodecarboxylase are: using blue light with a wavelength of 450-480 nm for the excitation light source; the light intensity is controlled within the range of 500-1000 μmol / m²·s; the concentration of the substrate solution containing long-chain fatty acids is 10-50 mM; the coenzyme NADH can be added; the pH environmental condition is 6-8; the temperature is maintained at 20-30°C; and the reaction time is 12-24 hours. As a preferred embodiment, the most effective reaction conditions in step SS1 are: the blue light is set to a wavelength of 450 nm for the excitation light source; the light intensity is controlled at 1000 μmol / m²·s; the concentration of the substrate solution containing long-chain fatty acids is 50 mM; no coenzyme NADH is added; the pH environmental condition is 8; the temperature is 30°C; and the reaction time is 12 hours.

[0032] The reactor design for the reaction of converting long-chain fatty acids into a mixed product containing hydrocarbons using immobilized fatty acid photodecarboxylase is as follows: A transparent quartz stirred photoreactor is used to ensure light penetration. The reactor jacket is equipped with a reflective surface and a light-diffusing plate to improve light utilization and reduce light energy loss. The light output is adjusted by a variable power supply, and the light intensity can be freely set. A temperature control device is installed in the reactor to set and maintain a constant temperature. Magnetic stirring is used to ensure that the substrate and enzyme are evenly distributed in the reactor to promote effective contact.

[0033] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A method for producing the main component of sustainable aviation fuel using a photoenzymatic decarboxylation reaction, characterized in that: The following steps are involved: S1: Construction of fatty acid photodecarboxylase mutants; screening of optimal Chlorella vulgaris; S2: Extracting the Chlorella fatty acid photodecarboxylase gene from the best Chlorella selected; S3: Construction of engineered bacteria; S4: extracting active fatty acid photodecarboxylase from the engineered bacteria produced in step S3; S5: immobilizing the active fatty acid photodecarboxylase to obtain immobilized fatty acid photodecarboxylase; S6: Conversion of long-chain fatty acids into mixed products containing hydrocarbons using immobilized fatty acid photodecarboxylase; S7: Separating and purifying the mixed product containing hydrocarbons to generate alkane products as a mixed component of aviation fuel.

2. The method for producing the main component of sustainable aviation fuel by photoenzymatic decarboxylation reaction according to claim 1, characterized in that: In the step S1, constructing the fatty acid photodecarboxylase mutant specifically involves designing primers to amplify the Chlorella fatty acid photodecarboxylase gene using PCR, and the PCR amplification conditions are: Pre-denaturation at 98°C for 2 minutes; denaturation at 98°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1 minute, for a total of 30 cycles; terminal extension at 72°C for 5 minutes.

3. The method for producing the main component of sustainable aviation fuel by photoenzymatic decarboxylation reaction according to claim 1, characterized in that: In step S3, the process of constructing the engineered bacteria is as follows: The Chlorella fatty acid photodecarboxylase gene and the expression plasmid containing the His tag were connected by ligation, and then the recombinant plasmid was transformed into Escherichia coli, and the T7 promoter was used to drive efficient expression; 0.5-1.0 mM isopropyl-β-D-thiogalactoside was used to induce protein expression; the culture medium used LB medium containing 50 μg / mL kanamycin, the initial culture temperature was 37°C, and when OD600 reached 0.6-0.8, the temperature was lowered to 16-20°C for inducing expression, the stirring speed was 200 rpm, and the induction time was 4-16 hours to promote correct folding and increase the activity of Chlorella fatty acid photodecarboxylase.

4. The method for producing the main component of sustainable aviation fuel by photoenzymatic decarboxylation reaction according to claim 3, characterized in that: In step S4, the process of extracting active fatty acid photodecarboxylase is as follows: SS1: Ultrasonication is used to lyse engineered bacterial cells to release cell contents and form a cell suspension; SS2: centrifuging the lysed cell suspension to remove cell debris and precipitate to obtain a supernatant containing fatty acid photodecarboxylase; SS3: gradually add ammonium sulfate to the supernatant to reach 30-60% saturation, stir evenly, and let stand at 4°C for 1 hour to allow fatty acid photodecarboxylase to precipitate; SS4: centrifuge the fatty acid photodecarboxylase precipitate again, collect the fatty acid photodecarboxylase precipitate and dissolve it in phosphate buffer solution; SS5: Use Ni²⁺-NTA resin to bind the His tag of fatty acid photodecarboxylase, add the bound fatty acid photodecarboxylase solution to the pre-packed affinity column, and keep the operation at 4°C to ensure the activity of fatty acid photodecarboxylase; SS6: Elute the enzyme solution with a buffer and collect the eluate; SS7: DEAE-Sepharose is used as an anion exchange carrier to remove excess salt and buffer components; SS8: High-purity liquid active fatty acid photodecarboxylase was obtained by concentrating the eluate using an ultrafiltration membrane with a molecular weight cutoff of 30 kDa.

5. The method for producing the main component of sustainable aviation fuel by photoenzymatic decarboxylation reaction according to claim 4, characterized in that: In the process of extracting active fatty acid photodecarboxylase, the parameters of ultrasonic lysis in step SS1 are a frequency of 20 kHz, a power of 300-400 W, each treatment for 30 seconds, an interval of 30 seconds, and repeated treatment 5-10 times to avoid protein denaturation; The pH environment was maintained at 7.5 using 50 mM phosphate buffer, and 1 mM protease inhibitor PMSF was added to protect fatty acid photodecarboxylase from degradation; In step SS2, the centrifugation speed is 12,000 rpm, the temperature is 4° C., and the time is 20 minutes; In step SS4, the centrifugation speed is 12,000 rpm, the temperature is 4° C., the time is 20 minutes, and the phosphate buffer solution is 50 mM; The buffer in step SS6 is a buffer containing 20-250 mM imidazole.

6. The method for producing the main component of sustainable aviation fuel by photoenzymatic decarboxylation reaction according to claim 1, characterized in that: The process of immobilizing active fatty acid photodecarboxylase in step S5 is as follows: SS1: Amination of the carrier; SS2: A cross-linking agent is applied to the surface of the aminated carrier, and then active fatty acid decarboxylase is added to allow the active fatty acid photodecarboxylase to bind to the carrier through a covalent bond to generate solidified fatty acid decarboxylase.

7. The method for producing the main component of sustainable aviation fuel by photoenzymatic decarboxylation reaction according to claim 6, characterized in that: In the process of immobilizing the active fatty acid photodecarboxylase, the carrier amination process in step SS1 is: immersing the carrier in dimethyl sulfoxide containing cyanuric acid chloride and stirring at room temperature for 2-4 hours to ensure the combination of the activator and the carrier; The support was washed with anhydrous DMSO to remove unreacted activator; The activated carrier is immersed in a 5-10% volume fraction ethylenediamine solution, the pH environment is maintained at 8-9, and the reaction is carried out at room temperature or 30°C with gentle stirring for 4-12 hours; After the reaction was completed, the gel support was thoroughly washed with distilled water to remove the unreacted ethylenediamine residue; Treat the surface of the carrier with Ninhydrin solution and observe whether a blue-purple reaction occurs, indicating the presence of amine groups; The carrier is polyacrylamide gel.

8. The method for producing the main component of sustainable aviation fuel by photoenzymatic decarboxylation reaction according to claim 1, characterized in that: The step S6 uses immobilized fatty acid photodecarboxylase to convert long-chain fatty acids into a mixed product containing hydrocarbons as follows; SS1: Dissolve long-chain fatty acids in a mixture of water and ethanol, use phosphate buffer to ensure a stable environment for enzyme activity; add immobilized fatty acid photodecarboxylase for conversion reaction; SS2: Use UV-Vis spectrometer or gas chromatography to monitor the reaction progress online, and track the consumption of substrate long-chain fatty acids and the generation of products in real time; turn off the light source after the reaction is completed to terminate the photocatalytic activity of the enzyme; SS3: centrifugal separation of the product into an organic phase and an aqueous phase; SS4: recovering the organic solvent of the organic phase by a rotary evaporator, and concentrating the hydrocarbons in the organic solvent into a crude product; SS5: Hydrocarbons are purified using silica gel column chromatography to produce high-purity alkane products.

9. The method for producing the main component of sustainable aviation fuel by photoenzymatic decarboxylation reaction according to claim 8, characterized in that: In step SS1 of converting long-chain fatty acids into a mixed product containing hydrocarbons using immobilized fatty acid photodecarboxylase, the volume ratio of water to ethanol is 50:50, and the concentration is 10-50 mM; Phosphate buffer was 50 mM, pH 7.0; The concentration of immobilized fatty acid photodecarboxylase was controlled at 0.5-2.0 mg / mL; In step SS 3, the product was separated by centrifugation at 4,000 rpm for 10 minutes.

10. The method for producing the main component of sustainable aviation fuel by photoenzymatic decarboxylation reaction according to claim 8, characterized in that: The reaction conditions in step SS1 of converting long-chain fatty acids into a mixed product containing hydrocarbons using immobilized fatty acid photodecarboxylase are: Use blue light with a wavelength of 450-480 nm as the excitation light source; The light intensity is controlled within the range of 500-1000 μmol / m²·s; The substrate solution containing long-chain fatty acids has a concentration of 10-50 mM; pH environmental conditions are 6-8; Keep the temperature between 20-30℃; The reaction time is 12-24 hours.

Images