CRISPR-Cas12a-based kit for rapidly detecting polynucleotide kinase

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to a kit for rapidly detecting polynucleotide kinase based on CRISPR-Cas12a (Clustered Regularly Interspaced Short Palindromic Repeats-CRISPR-Cas12a). According to the kit for rapidly detecting the polynucleotide kinase, DNA with the 5'terminal being hydroxyl is phosphorylated by utilizing the catalytic activity of the PNK, a nucleic acid signal is generated under the action of ligase, and then the nucleic acid signal is recognized by Cas12a to generate a fluorescence signal, so that the detection of the activity of the PNK is realized. The method can rapidly and sensitively detect PNK, can be used for quantitative analysis of PNK activity, and is expected to be applied to screening research of PNK inhibitors.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to a kit for rapid detection of polynucleotide kinase based on CRISPR-Cas12a. Background Art

[0002] The main technologies for detecting primitive cells in peripheral blood include blood cell analyzers, manual microscopic examinations, and flow cytometry. In clinical practice, abnormal cell populations are usually found through blood cell analyzers before microscopic examinations are performed. These methods have defects such as poor repeatability and reliance on expensive instruments and specialized personnel, which are not conducive to their implementation in primary hospitals. Flow cytometry technology combined with commercial antibody combinations and automated analysis software can achieve rapid detection of primitive cells in peripheral blood. However, due to the different primitive cell lines and the poor antigen specificity of most primitive cell lines, too many types of antibodies are required, and the analysis cost is too high. [1-4] Polynucleotide Kinase (PNK) is a DNA repair-related enzyme that can phosphorylate the 5′ hydroxyl group of damaged DNA, thereby allowing subsequent ligase-mediated DNA repair to proceed smoothly. Abnormal expression of PNK activity is associated with a variety of diseases, and it is also a potential target for cancer treatment. [5-6] Therefore, the establishment of a highly sensitive and selective T4 PNK detection method is of great significance in inhibitor screening, drug discovery, early clinical diagnosis, biochemical research, etc. Traditional methods for measuring PNK activity include radioisotope 32 P labeling, polyacrylamide gel electrophoresis and autoradiography [7-11] However, these methods have some disadvantages, such as radioactive hazards, complex operations, and long detection time, which greatly limit their widespread application. In recent years, researchers have developed many new PNK detection methods, including colorimetric

[10] , electrochemistry

[11] and nucleic acid amplification

[12] and new approaches based on nanomaterials

[13] etc. Colorimetry can simply visualize the detection of enzyme activity, but the detection limit of colorimetry is poor, which affects the detection sensitivity. Electrochemistry requires the DNA probe to be fixed on the electrode surface, which is complicated and time-consuming. In order to improve the detection sensitivity, isothermal amplification is integrated into the detection platform, such as rolling circle amplification (RCA)

[10] , exponential amplification reaction (EXPAR)

[14] and catalytic hairpin assembly (CHA)

[15] . However, adding additional amplification systems will inevitably increase nonspecific amplification, resulting in a certain high background, and there are still certain limitations. New methods based on nanomaterials are often more complicated, involving complex nanomaterial preparation and functionalization. Therefore, there is an urgent need to seek a simple, convenient, low-background, and sensitive PNK detection method.

[0003] The CRISPR / Cas12a system can specifically recognize double-stranded DNA and activate the endonuclease activity of the Cas protein, which can randomly cut nearby single-stranded DNA. The CRISPR / Cas12a system is developed for molecular diagnosis and has high sensitivity and specificity. Based on this, the present invention establishes a biosensor system based on CRISPR / Cas12a, provides a simple, rapid and sensitive PNK activity detection and inhibitor screening method, and can be applied to detect the PNK activity of peripheral blood cells at the same time, and the strength of its fluorescence signal can specifically distinguish peripheral blood primitive cells from non-primitive cells.

[0004] References:

[0005] [1] Guo Ping, Chen Liting, Song Weixing, et al. Clinical evaluation of the performance of rapid flow cytometry for peripheral blood primitive cell detection[J]. Laboratory Medicine, 2017, 32(05): 421-426.

[0006] [2] Qu Chenxue, Pu Chengwei, Shang Ke, et al. Establishment and validation of biological reference intervals for peripheral blood leukocytes by rapid flow cytometry classification and counting[J]. Chinese Medical Journal, 2015, 95(26): 2079-2083.

[0007] [3] Sun Xuejing, Xu Juan, Wan Suigui, et al. Analysis of peripheral blood immunophenotypes in patients with myelodysplastic syndrome by multicolor flow cytometry [J]. Labeled Immunoassay and Clinical, 2013, 20(02): 89-92.

[0008] [4] Xing Ying, Wang Jianzhong, Pu Chengwei, et al. Clinical evaluation of five-color flow cytometry for counting peripheral blood leukocytes[J]. Chinese Medical Journal, 2013, 93(30): 2392-2396.

[0009] [5]Whitehouse C J,Taylor R M,Thistlethwaite A,et al.XRCC1 StimulatesHuman Polynucleotide Kinase Activity at Damaged DNA Termini and AcceleratesDNA Single-Strand Break Repair[J].Cell,2001,104(1):107-117.

[0010] [6]Allinson S L.DNAend-processing enzyme polynucleotide kinase as apotential target in the treatment of cancer[J].Future Oncol,2010,6(6):1031-1042.

[0011] [7]Bernstein N K,Hammel M,Mani R S,et al.Mechanism of DNA substraterecognition by the mammalian DNA repair enzyme,Polynucleotide Kinase[J].Nucleic Acids Research,2009,37(18):6161-6173.

[0012] [8]Odell M,Shuman S.Footprinting of Chlorella Virus DNA Ligase Boundat a Nick in Duplex DNA*[J].Journal of Biological Chemistry,1999,274(20):14032-14039.

[0013] [9]Phillips D H,Arlt V M.(32)P-Postlabeling Analysis of DNAAdducts[J].Methods Mol Biol,2020,2102:291-302.

[0014]

[10] Jiang H-X,Kong D-M,Shen H-X.Amplified detection of DNAligase andpolynucleotide kinase / phosphatase on the basis of enrichment of catalytic G-quadruplex DNAzyme by rolling circle amplification[J].Biosensors andBioelectronics,2014,55:133-138.

[0015]

[11] Zhang G,Chai H,Tian M,et al.Zirconium–MetalloporphyrinFrameworks–Luminol Competitive Electrochemiluminescence for RatiometricDetection of Polynucleotide Kinase Activity[J].Analytical Chemistry,2020,92(10):7354-7362.

[0016]

[12] Wang D-X,Wang J,Du Y-C,et al.CRISPR / Cas12a-based dual amplifiedbiosensing system for sensitive and rapid detection of polynucleotide kinase / phosphatase[J].Biosensors and Bioelectronics,2020,168:

[0017]

[13] Chai Y,Cheng X,Xu G,et al.Ananoplatform based on metal–organicframeworks and coupled exonuclease reaction for the fluorimetricdetermination of T4 polynucleotide kinase activity and inhibition[J].Microchimica Acta,2020,187(4):243.

[0018]

[14] Zhang YP, Cui YX, Li XY, et al. Amodified exponential amplification reaction (EXPAR) with an improved signal-to-noise ratio for ultrasensitive detection of polynucleotide kinase [J]. Chem Commun (Camb), 2019, 55 (53): 7611-7614.

[0019]

[15] Cui W, Fan Summary of the invention

[0020] The first aspect of the present invention aims to provide a reagent for detecting polynucleotide kinase.

[0021] The second aspect of the present invention is to provide a kit for detecting polynucleotide kinase.

[0022] The purpose of the third aspect of the present invention is to provide the use of the reagent described in the first aspect of the present invention and the kit described in the second aspect of the present invention.

[0023] The fourth aspect of the present invention aims to provide a method for detecting polynucleotide kinase activity.

[0024] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is:

[0025] The first aspect of the present invention provides a reagent for detecting polynucleotide kinase, the reagent comprising oligonucleotide 1 and oligonucleotide 2; the sequence of oligonucleotide 1 is shown in SEQ ID NO: 1; the sequence of oligonucleotide 2 is shown in any one of SEQ ID NOs: 2 to 10.

[0026] Preferably, the sequence of the oligonucleotide 2 is shown in any one of SEQ ID NOs: 5, 6, and 9.

[0027] More preferably, the sequence of the oligonucleotide 2 is as shown in SEQ ID NO:5.

[0028] In some embodiments of the present invention, the reagent further comprises a buffer.

[0029] Preferably, the buffer comprises at least one of Tris-HCl, PBS and HBSS.

[0030] The second aspect of the present invention provides a kit for detecting polynucleotide kinase, comprising the reagent described in the first aspect of the present invention and a CRISPR-Cas system.

[0031] Preferably, the CRISPR-Cas system comprises a ssDNA fluorescent probe, a Cas protein, and crRNA.

[0032] Preferably, the sequence of the crRNA is as shown in SEQ ID NO: 11.

[0033] Preferably, the two ends of the ssDNA fluorescent probe have a fluorescent group and a quenching group respectively.

[0034] Preferably, the fluorescent group is selected from any one of FAM, CY5, HTX, ROX, VIC, TAMRA and HEX.

[0035] Preferably, the quenching group is selected from any one of BHQ1, BHQ2 and BHQ3.

[0036] Preferably, the sequence of the fluorescent probe is TTATT.

[0037] Preferably, the Cas protein is selected from at least one of Mb4Cas12a, FnCas12a, LbCas12a or dLbCas12a.

[0038] Preferably, the kit further comprises a reaction buffer, wherein the reaction buffer comprises a phosphorylation reaction buffer and a CRISPR-Cas reaction buffer.

[0039] In some embodiments of the present invention, the kit further comprises a positive control and a negative control.

[0040] The third aspect of the present invention provides the use of the reagent described in the first aspect of the present invention and the kit described in the second aspect of the present invention in any one of 1) to 3):

[0041] 1) Preparing products for detecting polynucleotide kinase activity;

[0042] 2) preparing products for screening polynucleotide kinase activators;

[0043] 3) Prepare products for screening polynucleotide kinase inhibitors.

[0044] The fourth aspect of the present invention provides a method for detecting polynucleotide kinase activity, comprising the steps of using the kit described in the second aspect of the present invention.

[0045] Preferably, the method is used for non-disease treatment, diagnosis purposes.

[0046] Preferably, the method comprises the following steps:

[0047] 1) Phosphorylation reaction: mixing the sample with the reagent described in the first aspect of the present invention, and reacting;

[0048] 2) Cas12a reaction: mixing the phosphorylation reaction product with the CRISPR-Cas system of claim 3 for reaction;

[0049] 3) Detection signal.

[0050] Preferably, the reagents in step 1) are pretreated, and the pretreatment includes a complementary annealing step in a buffer.

[0051] Preferably, the reaction time in step 2) is 15 to 45 minutes, and the reaction temperature is 25 to 42°C.

[0052] Preferably, the reaction time in step 3) is 15 to 45 minutes, and the reaction temperature is 25 to 42°C.

[0053] Preferably, the sample comprises blood; further, the blood comprises at least one of whole blood, plasma and serum.

[0054] The present invention provides a reagent for detecting PNK and a kit thereof, and develops a method for detecting PNK activity based on the reagent and the kit, which has the following advantages:

[0055] 1. The detection method of the present invention is simple to operate, and rapid detection of PNK can be achieved within 1 hour (30 min phosphorylation reaction, 30 min Cas12a reaction).

[0056] 2. The present invention combines CRISPR / Cas12a technology and uses fluorescence as the detection signal. It can be combined with real-time fluorescence quantitative PCR instrument, fluorescence spectrophotometer, fluorescence microplate reader and other equipment to realize the measurement, and can also perform visual detection under the irradiation of excitation light of a specific wavelength.

[0057] 3. The present invention has high sensitivity in detecting PNK and can realize quantitative detection. Its detection limit can reach 0.005U / mL and its linear range is 0.005-2.5U / mL.

[0058] 4. The present invention has good specificity in detecting T4 PNK, is not easily affected by other protein interfering substances, and has strong anti-interference and selectivity.

[0059] 5. The present invention can be used to study the screening of inhibitors of T4 PNK activity, and provides a new method for screening inhibitors of T4 PNK.

[0060] 6. The present invention realizes the determination of PNK activity in peripheral blood leukocytes and has the ability to detect actual samples, indicating that this method has application potential in the early diagnosis of diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0062] Figure 1 It is the detection principle diagram of the present invention.

[0063] Figure 2 The validation diagram of the macromolecular double-stranded DNA scaffold, where (A) agarose gel electrophoresis validates the production of the macromolecular double-stranded DNA scaffold, lanes 1 and 2 are AP1 and AP2, and lanes 3-11 are long double-stranded DNA products at different cleavage positions (-2, -4, -6, -8, -10, -12, -14, -16, -18). (BD) Atomic force microscopy scanning of the macromolecular double-stranded DNA scaffold.

[0064] Figure 3 Schematic diagram of the design position of the reaction substrate incision of the present invention. The black represents crRNA, the red represents the target, AP2-2 represents the incision position generated by pairing with crRNA is the second base, AP2-8 represents the incision formed by the target and crRNA is at the eighth base, and AP2-18 represents the incision formed by the target and crRNA is at the eighteenth base. .

[0065] Figure 4 It is a fluorescence intensity diagram of different incision positions of Cas12a substrate.

[0066] Figure 5 Is the sensitivity result of the PNK activity detection method; (A) is the fluorescence intensity of PNK detection at different concentrations, where the concentrations of the target are 0, 0.005U / mL, 0.025U / mL, 0.05U / mL, 0.1U / mL, 0.25U / mL, 0.5U / mL, 1U / mL, and 2.5U / mL; (B) is the linear range of T4 PNK detection by the CRISPR / Cas12a-based PNK activity detection method, 0.005-2.5U / mL.

[0067] Figure 6The specific results of the PNK activity detection method; (A) is the fluorescence intensity of the same concentration of PNK and PNK-like protease detection, including PNK, PNK heat-inactivated at 90°C for 5 min, DEPC water, FEN1, BbVCI, UDG, Tte UvrD, a mixture without PNK, and a mixture containing PNK; (B) is a physical picture of the specificity verification of the PNK activity detection method based on CRISPR / Cas12a for detecting T4PNK.

[0068] Figure 7 This is a test of the PNK activity detection method in screening PNK inhibitors. This is the inhibitory effect of Na2HPO4 on T4 PNK activity. The concentration of T4 PNK is 1U / mL.

[0069] Figure 8 Detection and analysis of PNK activity in peripheral blood leukocytes; (A) Fluorescence curves of 0-60 min for groups of cell lysate, cell lysate treated with inhibitors, heat-inactivated lysate and blank control; (B) Fluorescence intensity of fluorescence signals generated by 30 min for groups of cell lysate, cell lysate treated with inhibitors, heat-inactivated lysate and blank control; (C) Box plot comparing blood PNK activity of leukemia patients (n=37) and non-leukemia patients (n=39); Statistical analysis method using two independent samples t' test, **** indicates P<0.0001; (D) Box plot comparing blood PNK activity in different groups of leukemia and non-leukemia, the leukemia group is marked as young (n=37), and the non-leukemia groups include nuclear left shift (n=14), atypical lymphocytes (n=13), and normal (n=12); Kruskal-Wallis one-way analysis of variance and post hoc Dunn's multiple comparison test were used for statistical analysis, **** indicates P<0.0001, ns indicates P>0.05. DETAILED DESCRIPTION

[0070] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0071] The sources of materials used in the present invention are as follows:

[0072] T4 PNK (purchased from New England Biotechnology Co., Ltd.), rCutSmart Buffer (purchased from New England Biotechnology Co., Ltd.), LbCas12a protein (purchased from New England Biotechnology Co., Ltd.), T4 PNK buffer (purchased from New England Biotechnology Co., Ltd.), T4 DNA Ligase (purchased from Sangon Biotechnology Co., Ltd.), T4 DNA Ligasebuffer (purchased from Sangon Biotechnology Co., Ltd.), Na2HPO4 (purchased from Sangon Biotechnology Co., Ltd.), DEPC water (purchased from Sangon Biotechnology Co., Ltd.), polyethylene glycol 8000 (purchased from Maclean Biotech), red blood cell lysis buffer (purchased from Becton Dickinson Medical Technologies Co., Ltd.), PBS (purchased from Sangon Biotechnology Co., Ltd.), and nuclear protein extraction kit (purchased from Sangon Biotechnology Co., Ltd.).

[0073] The principle of the present invention is: the present invention designs a pair of 40-base oligonucleotides (AP1 and AP2), oligonucleotides AP1 and AP2 have 20 bases of complementary pairing, and when added to a buffer system containing certain salt ions, they will self-assemble to form a long double-stranded DNA with many cuts. Figure 1 As shown, in the absence of PNK, AP1 and AP2 cannot be repaired to form double-stranded DNA containing a nick. Due to the intolerance of the Cas12a system to double-stranded DNA substrates containing a nick, the Cas12a system will not recognize the substrate and cannot activate Cas12a to produce a fluorescent signal. On the contrary, when the target PNK is present, the 5' end of the nick of the double-stranded DNA can be phosphorylated, and then the DNA ligase in the system repairs the nick to form a double-stranded DNA that can be recognized by the Cas12a system, activating the ssDNA repoter probe shown in the Cas12a cutting system to produce a fluorescent signal, thereby realizing the detection of PNK.

[0074] Example 1 Screening of the best substrate for Cas12a

[0075] 1. Sequence design

[0076] In this example, oligonucleotides AP1, AP2, crRNA, and single-stranded DNA fluorescent reporter probes were designed, all of which were synthesized by Sangon Biotechnology Co., Ltd. The sequences used from 5' end to 3' end are as follows.

[0077] AP1: ATCATATGGTTTCCAACCCACTTATGGTGTTGGTTACCAA (SEQ ID NO: 1).

[0078] AP2-2: TGGAAACCATATGATTTGGTAACCAACACCATAAGTGGGT (SEQ ID NO: 2).

[0079] AP2-4: GTTGGAAACCATATGATTTGGTAACCAACACCATAAGTGG (SEQ ID NO: 3).

[0080] AP2-6: GGGTTGGAAACCATATGATTTGGTAACCAACACCATAAGT (SEQ ID NO: 4).

[0081] AP2-8: GTGGGTTGGAAACCATATGATTTGGTAACCAACACCATAA (SEQ ID NO: 5).

[0082] AP2-10: AAGTGGGTTGGAAACCATATGATTTGGTAACCAACACCAT (SEQ ID NO: 6).

[0083] AP2-12: ATAAGTGGGTTGGAAACCATATGATTTGGTAACCAACACC (SEQ ID NO: 7).

[0084] AP2-14: CCATAAGTGGGTTGGAAACCATATGATTTGGTAACCAACA (SEQ ID NO: 8).

[0085] AP2-16: CACCATAAGTGGGTTGGAAACCATATGATTTGGTAACCAA (SEQ ID NO: 9).

[0086] AP2-18: AACACCATAAGTGGGTTGGAAACCATATGATTTGGTAACC (SEQ ID NO: 10).

[0087] crRNA: UAAUUUCUACUAAGUGUAGAUCAACCCACUUAUGGUGUUGG (SEQ ID NO: 11).

[0088] ssDNA repoter: FAM-TTATT-BHQ1.

[0089] 2. Experimental procedures

[0090] 1) Preparation of different double-stranded DNA substrates

[0091] 1 μL 100 μM oligonucleotide AP2 (-2, -4, -6, -8, -10, -12, -14, -16, -18) of different sequences and 1 μL 100 μM AP1 were added to 98 μL buffer solution containing certain salt ions, including 70 mM Tris-HCl, 10 mM MgCl2, and 5 mM DTT. The mixture of AP1 and AP2 was then incubated at 95°C for 5 minutes, cooled to 37°C for 30 minutes, and finally stored in a 4°C refrigerator for later use.

[0092] 2) Construction of macromolecular double-stranded DNA scaffold:

[0093] AFM imaging: ① Sample dilution: Prepare dilution buffer (10mM HEPES, 25mM KCl pH = 7.5, adjusted with KOH), dilute the DNA sample to 20nM with dilution buffer, use the prepared deposition buffer (10mM HEPES, 10mM MgCl2, 25mM KCl pH = 7.5) 19μL plus 1μL 20nM DNA sample for later use. ② Dissociate mica: Use transparent glue (Scotch) to dissociate mica, and use double-sided tape (Scotch) to stick 10mm diameter mica (Ted Pella, 50) on a metal sheet (Ted Pella, 16218) ③ NiCl2 treatment of mica: 20uL 100 mM NiCl2 (Sigma 654507) is dropped on the mica for 1 minute, then rinsed with 50mL RO water, and then use filter paper to touch the center of the water drop on the mica and flatten it to dry. Put it in a culture dish during the drying process to avoid dust. ④ DNA deposition: After drying, immediately deposit 20 μL of 1 nM DNA sample on mica. After 2 seconds, gently rinse the surface with 1 mL of deposition buffer, tilt the surface about 10°, and then gently rinse with 8 mL of deposition buffer. ⑤ Rinse the mica with imaging buffer: Finally, rinse with 2 mL of imaging buffer [10 mM HEPES (pH 7.5), 10 mM NiCl2 + 2.5 mM KCl]. ⑥ AFM scanning: The prepared samples were scanned and observed by a commercial AFM instrument (Cypher ES, Asylum Research) in tapping mode.

[0094] 3) Background signal detection of Cas12a reaction

[0095] Separate detection of background signals of 9 AP2s: 2 μL of each of the above AP2s was added to the Cas12a system, which included 2 μL 1 μM crRNA, 1 μL 1 μM Cas12a, 2 μL 10×rCutsmart buffer, 1 μL 10uMssDNA repoter, and 12 μL DEPC water, with a total reaction system of 20 μL. Fluorescence intensity was detected using a fluorescence quantitative PCR instrument, the reaction temperature was 37°C, and the fluorescence value was monitored every 1 minute for 60 minutes.

[0096] Detection of background signals after 9 kinds of AP2 were mixed with AP1: 2μL of the above different AP2s were taken, mixed with 2μL AP1 and added to the Cas12a system, which included 2μL 1μM crRNA, 1μL 1μM Cas12a, 2μL 10×rCutsmart buffer, 1μL 10uM ssDNA repoter, 12μL DEPC water, and the reaction system was 20μL in total. Fluorescence intensity was detected using a fluorescence quantitative PCR instrument, the reaction temperature was 37°C, and the fluorescence value was monitored every 1 minute for 60 minutes.

[0097] 3. Experimental results

[0098] Figure 2 Schematic diagram of the incision position of different AP2s, where black represents crRNA and red represents Cas12a substrate. The number after AP2 represents the incision position formed when the substrate binds to crRNA, and AP2-2 to AP2-18 represent the incision positions formed when different substrates bind to crRNA. The same is true for the meaning of different numbers in double-stranded DNA substrates.

[0099] Figure 3 The validation diagram of the macromolecular double-stranded DNA scaffold, where A is the agarose gel electrophoresis analysis diagram of the product, and it can be seen that there is a macromolecular DNA of about 5000bp in lanes 3-11, indicating that the macromolecular double-stranded DNA scaffold has been successfully prepared. BD is an atomic force microscope scan of the product, and C is a partial magnification of B. Flocculent nanowires can be seen in C, and long nanowires can also be clearly seen in the magnification of C D, which further indicates that the macromolecular double-stranded DNA scaffold has been successfully prepared.

[0100] Figure 4 is the fluorescence intensity of different incision positions of Cas12a substrate. Among AP-2 to AP-18, AP-8 has the lowest background signal, followed by AP-10, AP-12, AP-14, and AP-16, and AP-2, AP-4, AP-6, and AP-18 have higher background signals.

[0101] Subsequent technical solutions all adopted the Cas12a double-stranded (AP1, AP-8) DNA substrate with a cut at the 8th base for further testing.

[0102] Example 2 Sensitivity Test

[0103] 1. Experimental steps

[0104] 1) Pre-preparation of double-stranded DNA substrate: 1 μL of 100 μM oligonucleotides AP1 and AP2-8 were added to 98 μL of a buffer solution containing certain salt ions, the buffer solution containing 70 mM Tris-HCl, 10 mM MgCl2, and 5 mM DTT. The mixture of AP1 and AP2-8 was then incubated at 95°C for 5 minutes, cooled to 37°C for 30 minutes, and finally stored in a 4°C refrigerator for later use.

[0105] 2) PNK phosphorylation reaction: The phosphorylation reaction system includes 0.5 μL PNK of different concentrations, 2 μL 10× DNA Ligase buffer, 1.5 μL 1 μM double-stranded DNA substrate, 4 μL 5Μ / μL T4 DNA Ligase, 2.5 μL 40% PEG8000, and 9.5 μL DEPC water. The reaction was carried out at 37°C for 30 min.

[0106] 3) Cas12a reaction: All the above phosphorylation reaction products were added to 10 μL Cas12a system, which included 1.5 μL 1 μM crRNA, 1.5 μL 1 μM Cas12a, 3 μL 10×rCutsmart buffer, 2 μL 10 μMssDNA repoter, and 2 μL DEPC water. Fluorescence intensity was detected using a fluorescence quantitative PCR instrument, the reaction temperature was 37 ° C, and the fluorescence value was monitored every 1 minute for 60 minutes.

[0107] 2. Experimental results

[0108] like Figure 5 As shown, A shows the sensitivity results of the detection method for determining T4 PNK, where the X and Y axes represent different concentrations and fluorescence intensities, respectively, and the concentrations of the target are 0, 0.001U / mL, 0.005U / mL, 0.025U / mL, 0.05U / mL, 0.1U / mL, 0.25U / mL, 0.5U / mL, 1U / mL, and 2.5U / mL. As the target concentration increases, the fluorescence intensity gradually increases, and the minimum detection limit of this method is 0.005U / mL. Figure 5B in the figure indicates that 8 gradient concentrations of 0.005U / mL, 0.025U / mL, 0.05U / mL, 0.1U / mL, 0.25U / mL, 0.5U / mL, 1U / mL, and 2.5U / mL were used to make a regression equation with concentration as the independent variable X and the fluorescence intensity at 30 minutes as the dependent variable Y. The correlation coefficient is 0.9934, indicating that the method has a good linear relationship in the range of 0.005-2.5U / mL.

[0109] Example 3 Specificity Test

[0110] Referring to Example 2, with other experimental conditions unchanged, a protease similar to PNK at the same concentration was used as a target for specificity verification, and the following targets were added respectively: PNK, PNK heat-inactivated at 90°C for 5 min, DEPC water, FEN1, BbVCI, UDG, Tte UvrD, a mixture without PNK, and a mixture containing PNK.

[0111] The results are as follows Figure 6 As shown, the X and Y axes represent different concentrations and fluorescence intensities, respectively. By comparing the fluorescence intensities of different groups, it can be found that the fluorescence signal of the PNK group is significantly higher than that of the PNK, FEN1, BbVCI, UDG, Tte UvrD and NC groups heat-inactivated at 90°C for 5 minutes, indicating that the detection method of the present invention has good specificity. When a mixture of PNK analogs (including FEN1, BbVCI, UDG, Tte UvrD) is added, the fluorescence intensity of the positive group is similar to that of the PNK group, indicating that the detection method is not interfered by other components and has strong anti-interference.

[0112] Example 4 Screening test of PNK inhibitors

[0113] In the inhibition test of T4 PNK, Na2HPO4 was used as a model inhibitor. The same experimental method as the PNK assay was used, except that different concentrations of Na2HPO4 (2.5, 5, 7.5, 10, 15, 20, 25 mM) were added to the PNK reaction and the concentration of T4 PNK was fixed at 1 U / mL.

[0114] The inhibition test was carried out with T4 PNK at a concentration of 1 U / mL. Different concentrations of Na2HPO4 were added to the reaction system. The fluorescence intensity of the system was measured after 30 minutes of reaction. The relative activity (RA) was calculated as follows: RA = (Fi-F0) / (Ft-F0), where Fi is the fluorescence intensity of the positive sample with different concentrations of inhibitors added, F0 is the fluorescence intensity of the negative sample without adding the target, and Ft is the fluorescence intensity of the positive sample without adding the inhibitor.

[0115] The results are as follows Figure 7 As shown in Figure 2, as the concentration of Na2HPO4 increases, the fluorescence intensity of the reaction system decreases and the inhibition efficiency gradually increases. When the concentration of Na2HPO4 is about 10.30 mM, the relative activity of T4 PNK drops to 50%, and the IC 50 The value is 10.30, which is similar to that reported in the literature (Zhang YP, Cui YX, Li XY, et al. A modified exponential amplification reaction (EXPAR) with an improved signal-to-noise ratio for ultrasensitive detection of polynucleotide kinase [J]. Chem Commun (Camb), 2019, 55(53): 7611-7614.), which verifies that this method can be applied to inhibitor activity screening.

[0116] Example 5 PNK detection test in peripheral blood leukocyte lysate

[0117] 1. Experimental steps

[0118] 1) Preparation of peripheral blood leukocytes: Leukocytes were obtained by lysing red blood cells using red blood cell lysis buffer (BD Biosciences, Shanghai, China, 555899). Prepare fresh blood samples and centrifuge them at 500g for 5 minutes. Discard the supernatant after centrifugation. Then, add 9 times the volume of red blood cell lysis buffer, blow gently to evenly distribute, and lyse for 5-10 minutes. Centrifuge at 500g for 5 minutes, keep the precipitate, and wash with PBS. Finally, count about 5×10 cells using a cell counting plate. 5 Cells to spare.

[0119] 2) Nuclear protein extraction: Cell lysate was prepared using a nuclear protein extraction kit (Sangon Biotech, Shanghai, China, C500009). The extraction procedure was consistent with the instructions for the protein extraction kit. Note that the phosphatase inhibitor recommended in the instructions was not added, and the rest remained the same. The lysate was stored at -20°C or used immediately.

[0120] 3) Lysate PNK activity assay: Similar to the T4 PNK activity assay, the target is to add peripheral blood leukocyte lysate instead of T4 PNK standard.

[0121] ①Preparation of double-stranded DNA substrate: 1 μL of 100 μM oligonucleotides AP1 and AP2-8 were added to 98 μL of a buffer solution containing certain salt ions, including 70 mM Tris-HCl, 10 mM MgCl2, and 5 mM DTT. The mixture of AP1 and AP2-8 was then incubated at 95°C for 5 minutes, cooled to 37°C for 30 minutes, and finally stored in a 4°C refrigerator for later use.

[0122] ②PNK phosphorylation reaction: The phosphorylation reaction system includes 5μL peripheral blood leukocyte lysate, 2μL 10×DNA Ligase buffer, 1.5μL 1μM double-stranded DNA substrate, 2μL 5U / μL T4 DNA Ligase, 2.5μL 40% PEG8000, and 7μL DEPC water. Reaction at 37℃ for 30min.

[0123] ③Cas12a reaction: All the above phosphorylation reaction products were added to 10μL Cas12a system, which included 1.5μL 1μM crRNA, 1.5μL 1μM Cas12a, 3μL 10×rCutsmart buffer, 2μL 10μMssDNA repoter, and 2μL DEPC water. Fluorescence intensity was detected using a fluorescence quantitative PCR instrument, the reaction temperature was 37°C, and the fluorescence value was monitored every 1 minute for 60 minutes.

[0124] 2. Experimental results

[0125] In order to prove that the detection technology proposed in the present invention has the ability to detect actual samples, the PNK activity in peripheral blood leukocytes was detected and analyzed. Figure 8 As shown, compared with the blank control (lysis buffer), the peripheral blood leukocyte lysate produced a significant signal, while the signal caused by the lysate treated with the inhibitor Na2HPO4 was greatly reduced, indicating that the high signal generated by the peripheral blood leukocyte lysate was due to the activity of PNK rather than other components. This result shows that the present invention has great application potential in the diagnosis, treatment evaluation and clinical biomedicine of PNK-related diseases.

Claims

1. A reagent for detecting polynucleotide kinase, characterized in that: The reagents include oligonucleotide 1 and oligonucleotide 2; The sequence of the oligonucleotide 1 is shown in SEQ ID NO: 1; The sequence of the oligonucleotide 2 is shown in any one of SEQ ID NOs: 2-10.

2. The reagent according to claim 1, characterized in that: The sequence of the oligonucleotide 2 is shown in any one of SEQ ID NOs: 5, 6, and 9.

3. A kit comprising the reagent according to claim 1 and a CRISPR-Cas system; The CRISPR-Cas system includes a ssDNA fluorescent probe, a Cas protein, and crRNA.

4. The kit according to claim 3, characterized in that: The sequence of the crRNA is shown in SEQ ID NO:

11.

5. The kit according to claim 4, characterized in that: The Cas protein is selected from at least one of Mb4Cas12a, FnCas12a, LbCas12a or dLbCas12a.

6. The kit according to claim 2, characterized in that: The kit also includes a reaction buffer.

7. Use of the reagent according to any one of claims 1 or 2 and / or the kit according to any one of claims 3 to 6 in any one of 1) to 3): 1) Preparing products for detecting polynucleotide kinase activity; 2) preparing products for screening polynucleotide kinase activators; 3) Prepare products for screening polynucleotide kinase inhibitors.

8. A method for detecting polynucleotide kinase activity, characterized in that: The method comprises the steps of using the kit according to any one of claims 3 to 6; The method is used for non-disease treatment and diagnosis purposes.

9. The method according to claim 8, characterized in that The following steps are included 1) Phosphorylation reaction: mixing a sample with the reagent according to any one of claims 1 or 2, and reacting; 2) Cas12a reaction: mixing the phosphorylation reaction product with the CRISPR-Cas system of claim 3 for reaction; 3) Detection signal.

10. The method according to claim 9, characterized in that: The reaction time is 15 to 45 minutes, and the reaction temperature is 25 to 42°C.

Images