SMN1 and SMN2 mutation detection system and detection method for non-disease diagnosis purpose

Abstract

The invention relates to an SMN1 and SMN2 mutation detection system and a detection method for a non-disease diagnosis purpose. The system provided by the invention comprises a targeted enrichment module used for carrying out hybridization and targeted enrichment on a target gene by adopting a target region capture probe, and the target region capture range is as follows: SMN1: GRCh38 / hg38, chr5: 70925086-70953015; the SMN1: GRCh38 / hg38, chr5: 70049524-70087847, the single-molecule real-time sequencing library construction module is used for constructing a single-molecule real-time sequencing library, the single-molecule real-time sequencing analysis module is used for performing single-molecule real-time sequencing to obtain sequencing data of a target area, and the sequencing data of the target area is disassembled and analyzed to obtain variation types of the SMN1 and the SMN2; according to the invention, the detection result is accurate, and mutation of SMN1 and SMN2 can be distinguished.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a SMN1 and SMN2 mutation detection system and a detection method for non-disease diagnosis purposes. Background Art

[0002] Spinal muscular atrophy (OMIM#253300) is a severe autosomal recessive neuromuscular disease characterized by progressive symmetrical limb and trunk muscle weakness due to progressive degeneration and loss of motor neurons. Spinal muscular atrophy (SMA) is the second most lethal autosomal recessive disease after cystic fibrosis.

[0003] The genetic basis of SMA involves biallelic pathogenic variants, including copy number loss and intragenic variants in the survival motor neuron 1 (SMN1) gene, in which copy number of the survival motor neuron 2 (SMN2) gene alters disease severity. SMN1 and SMN2 are highly homologous genes of 28 kb, each located in 2 repeated 500 kb DNA segments on chromosome 5, a region that is prone to rearrangements and deletions. The two SMNs have identical promoters that differ by only 5 base pairs, which are used to distinguish SMN1 from SMN2. The coding sequence of SMN2 differs from that of SMN1 by only one nucleotide (840C>T), which does not change the amino acid but has an important role in splicing.

[0004] Gene conversion is a mechanism by which SMN2 copies are increased when SMN1 is lost in SMA. Gene conversion events result in the generation of mosaic SMN genes, where some parts are SMN1 and other parts of the gene are SMN2. Most gene conversion events occur at the canonical c.840C>T nucleotide difference in exon 7. However, there are at least 15 other paralogous structural variants (PSVs) between SMN1 and SMN2. Gene conversion events within exon 8 (SMN2c.1155G>A) and introns 6 (SMN2c.835-44G>A) and 7 (SMN2c.888+100A>G and SMN2c.888+215A>G) have been observed in both SMA and control populations. Some hybrid SMN2 genes produce more SMN protein than expected, and SMA patients carrying these hybrid genes have milder clinical phenotypes than expected. A single SMN2 gene produces less functional protein than a single SMN1 gene. Therefore, SMA occurs because the SMN2 gene cannot fully compensate for the absence of functional SMN when SMN1 is mutated. However, when the number of SMN2 gene copies is increased, the small amount of full-length transcripts produced by SMN2 are able to produce a milder type II or type III phenotype. Therefore, SMA is caused by low levels of SMN protein rather than a complete lack of this protein. Therefore, the SMA phenotype may not only be affected by the number of SMN2 genes, but also the variation in the SMN2 sequence can affect the severity of the disease.

[0005] In the normal allele, the chromosome with one copy of the SMN1 gene is called "1 copy" or "1" allele. The chromosome with two copies of the SMN1 gene is called "2 copy" or "2" allele. The resulting deletion of the allele (or conversion of SMN1 to SMN2) is the most common form of the disease and is referred to as the "0 copy" or "0" allele. The disease allele with a subtle intragenic point mutation in the SMN1 gene is referred to as 1d. The 0, 1, 2, and 1d alleles are also referred to in the literature as the a, b, c, and d alleles, respectively.

[0006] Currently, the most commonly used methods for molecular detection of SMA are MLPA, qPCR, and Sanger sequencing. However, MLPA and qPCR can only detect large fragment deletions or copy number variations. At the same time, MLPA and qPCR cannot identify SMN1 (2+0) silent carriers. Therefore, in general, MLPA and qPCR are combined with Sanger sequencing to detect point mutations in SMN1. However, the high homology between SMN1 and SMN2 will interfere with the specificity of PCR amplification primers and sequencing primers during Sanger sequencing. On the other hand, these methods cannot distinguish between the deletion of SMN1 and whether SMN1 undergoes homologous recombination with SMN2.

[0007] Next-generation sequencing (NGS) requires the construction of NGS sequencing libraries for SMN1 and SMN2 respectively in order to specifically detect point mutations in the SMN1 gene or SMN2. It is not compatible with other gene tests and the process is relatively cumbersome. At the same time, due to the short sequencing and the high homology between SMN1 and SMN2, when two or more mutations exist at the same gene site, it is impossible to distinguish between cis or trans mutations, and whether the mutation has a chain effect.

[0008] At present, the incomplete coverage of SMA pathogenic genes, the difficulty in detecting the copy number of SMN1 and SMN2, and the inability to determine whether the mutations are linked can lead to problems of missed detection and misdiagnosis in clinical practice.

[0009] Therefore, it is very necessary to find a new method to achieve high specificity, accuracy and rapidity to simultaneously detect multiple mutations of two SMA-related pathogenic genes in multiple samples. Summary of the invention

[0010] In view of the above-mentioned deficiencies in the prior art, the present invention aims to provide a SMN1 and SMN2 mutation detection system and a detection method for non-disease diagnosis purposes, so as to detect the complex variation types of the SMN1 gene and whether the mutations of the SMN1 and SMN2 genes are linked.

[0011] In order to solve the above problems, the present invention adopts the following technical solutions:

[0012] In one aspect, the present invention provides a SMN1 and SMN2 mutation detection system, comprising an acquisition module, a Y-shaped pre-library preparation module, a targeted enrichment module, a single-molecule real-time sequencing library construction module, and a single-molecule real-time sequencing analysis module;

[0013] The collection module is used to collect peripheral blood of the subject to be tested and to extract, shear and screen high molecular weight DNA;

[0014] The Y-shaped pre-library preparation module is used to perform end repair and 3'A-tailing reaction on the extracted and sheared high molecular weight DNA, perform Y-shaped adapter connection and fragment screening, and then use a long-fragment amplification enzyme to perform long-fragment PCR amplification to obtain a Y-shaped pre-library;

[0015] The targeted enrichment module is used to hybridize, target enrich and long-fragment PCR amplify the Y-shaped pre-library with a biotin-labeled capture probe to obtain a capture library; the target region capture range of the biotin-labeled capture probe is: SMN1: GRCh38 / hg38, chr5: 70925086-70953015; SMN2: GRCh38 / hg38, chr5: 70049524-70087847; the nucleotide sequence of the biotin-labeled capture probe is SEQ ID No: 1-SEQ ID No: 208;

[0016] The single-molecule real-time sequencing library construction module is used to perform DNA damage repair, end repair, purification, sequencing adapter connection and digestion according to the captured library to obtain a single-molecule real-time sequencing library;

[0017] The single-molecule real-time sequencing analysis module is used to perform single-molecule real-time sequencing with a single-molecule real-time sequencing library, obtain sequencing data of a target region, decompose the sequencing data of the target region, and analyze the variation types of SMN1 and SMN2.

[0018] As an implementation method, the capture probe labeled with biotin is hybridized with the Y-shaped pre-library, targeted enrichment and long-fragment PCR amplification are performed to obtain a capture library comprising:

[0019] The biotin-labeled capture probe and Y-shaped pre-library were vacuum concentrated to a dry powder state and resuspended;

[0020] The resuspended product is subjected to denaturation of the Y-shaped pre-library and probe;

[0021] Add 20 μl of hybridization buffer preheated at 65°C for at least 5 min to the denatured prelibrary and probe mixture, and perform hybridization reaction at 70°C and 85°C on the heated lid for 16-18 h;

[0022] The hybridization product was eluted using streptavidin magnetic beads;

[0023] The eluted product was amplified by long-fragment PCR using a long-fragment specific amplification enzyme; the reagents for long-fragment PCR amplification included 48 μL of eluted product, 100 μL, 25 mM 10X LA PCR Buffer II (Mg 2+Plus), 40 μL dNTP Mixture, 6 μL adapter universal primer, 4 μL TaKaRa LATaq HS and 2 μL water; the PCR program for the long-fragment PCR amplification is 94°C, 2 min; 98°C, 10 s, 58.8°C, 30 s, 68°C, 15 min, repeated 12 times; 68°C, 10 min; 4°C hold;

[0024] The product after long-fragment PCR amplification is purified using magnetic beads to obtain a capture library.

[0025] As an embodiment, the DNA damage repair reagent includes 5 μl 10× DNA damage repair buffer, 0.5 μl 10× NAD + , 5 μl 10 mM ATP, 2 μl DNA damage repair enzyme mixture, 1 μg captured product DNA, and make up to 50 μl with water.

[0026] As an embodiment, the reagents for sequencing adapter ligation include 30 μl of captured product DNA after end repair purification, 1 μl of PacBio platform sequencing adapter, 4 μl of 10× ligation buffer, 2 μl of 1 mM ATP and 1 μl of DNA ligase, and are filled to 40 μl with water.

[0027] As an implementable embodiment, the single molecule real-time sequencing analysis module is used for:

[0028] 1) Use Lima software to split the original PacBio sequencing data by different index sequences, and remove the index sequences during the splitting process to obtain high-quality sample data;

[0029] 2) Use the Minimap2 tool to align the sample data with the reference genome and generate MD tags by enabling the -MD parameter during the alignment process;

[0030] 3) Use the Paraphase tool to perform haplotype analysis on the SMN1 / 2 gene in the samples;

[0031] 4) Use the DeepVariant tool to detect single nucleotide variations in the SMN1 / 2 gene region and identify variation points; combine with the cuteSV tool to identify structural variations and capture insertion and deletion changes in the SMN1 / 2 gene;

[0032] 5) Combine annovar and VEP tools to annotate the detected SNVs in detail, including variant type, hgvs, genotype changes, relevant population frequency, and disease-based phenotypic information; judge the pathogenicity of the variant by combining the ACMG standard, and provide relevant inheritance patterns and disease characteristics.

[0033] In another aspect, the present invention provides a method for detecting SMN1 and SMN2 mutations for non-disease diagnosis purposes, comprising:

[0034] Collect peripheral blood from the subjects and perform high molecular weight DNA extraction, shearing and fragment screening;

[0035] The extracted and sheared high molecular weight DNA is subjected to end repair and 3'A-tailing reaction, and Y-shaped adapter ligation and fragment screening are performed, and then long-fragment PCR amplification is performed using a long-fragment amplification enzyme to obtain a Y-shaped pre-library;

[0036] According to the Y-shaped pre-library, a biotin-labeled capture probe is used to hybridize with the Y-shaped pre-library, targeted enrichment and long-fragment PCR amplification to obtain a capture library; the target region capture range of the biotin-labeled capture probe is: SMN1: GRCh38 / hg38, chr5: 70925086-70953015; SMN2: GRCh38 / hg38, chr5: 70049524-70087847; the nucleotide sequence of the biotin-labeled capture probe is SEQ ID No: 1-SEQ ID No: 208;

[0037] Based on the captured library, DNA damage repair, end repair, purification, sequencing adapter ligation and digestion are performed to obtain a single-molecule real-time sequencing library;

[0038] Single-molecule real-time sequencing was performed using a single-molecule real-time sequencing library to obtain sequencing data of the target region. The sequencing data of the target region was decomposed and analyzed to obtain the variation types of SMN1 and SMN2.

[0039] As an implementable method, the single molecule real-time sequencing is performed on the single molecule real-time sequencing library to obtain the sequencing data of the target region, and the sequencing data of the target region is disassembled to analyze the variation types of SMN1 and SMN2, including:

[0040] 1) Use Lima software to split the original PacBio sequencing data by different index sequences, and remove the index sequences during the splitting process to obtain high-quality sample data;

[0041] 2) Use the Minimap2 tool to align the sample data with the reference genome and generate MD tags by enabling the -MD parameter during the alignment process;

[0042] 3) Use the Paraphase tool to perform haplotype analysis on the SMN1 / 2 gene in the samples;

[0043] 4) Use the DeepVariant tool to detect single nucleotide variations in the SMN1 / 2 gene region and identify variation points; combine with the cuteSV tool to identify structural variations and capture insertion and deletion changes in the SMN1 / 2 gene;

[0044] 5) Combine annovar and VEP tools to annotate the detected SNVs in detail, including variant type, hgvs, genotype changes, relevant population frequency, and disease-based phenotypic information; judge the pathogenicity of the variant by combining the ACMG standard, and provide relevant inheritance patterns and disease characteristics.

[0045] The beneficial effects of the present invention are: the present invention optimizes the interruption conditions and the magnetic bead screening conditions to increase the length of the inserted fragment, can accurately distinguish the mutations of SMN1 and SMN2, and can accurately detect complex structural variations such as large fragment deletions and copy numbers, and can detect SMN1 (2+0) silent carriers, point mutations, mutations on exon 1, and can detect whether the two mutations of SMN1 and SMN2 genes are linked, as well as unknown mutations that have not been reported so far. The accuracy is high, and the dumbbell-shaped library of PacBio can be interpreted multiple times during sequencing. The base accuracy of the sequencing results after correction is greater than 99%, and the sequencing errors of PacBio are random. The base accuracy is greater than 99.9% after the sequencing depth correction, and the gene mutations within the primer detection range can be accurately interpreted. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 This is a quality inspection diagram of the fragment length distribution of the captured library of the present invention; wherein Migration time represents the migration time, LM20 represents a band with a size of 20 bp in the quality inspection marker, and LM1000 represents a band with a size of 1000 bp in the quality inspection marker.

[0047] Figure 2 This is a diagram of the PacBio sequencing results of the SMN1 and SMN2 genotypes and copy numbers of the present invention.

[0048] Figure 3 This is a comparison diagram of the interruption effects of different interruption conditions of the present invention.

[0049] Figure 4 This is a comparison chart of the screening effects of different screening conditions of the present invention. DETAILED DESCRIPTION

[0050] The present invention is further described in detail below in conjunction with specific embodiments.

[0051] It should be noted that these embodiments are only used to illustrate the present invention rather than to limit the present invention. Simple improvements to the method based on the concept of the present invention all fall within the scope of protection claimed by the present invention.

[0052] Example 1 Construction of SMN1 and SMN2 mutation detection process

[0053] 1. Collect 10 mL of peripheral blood from the patient using an EDTA anticoagulant tube.

[0054] 2. Extraction of genomic DNA.

[0055] The peripheral blood of the subjects to be tested was extracted using a special high molecular weight DNA extraction kit to obtain high molecular weight gDNA, and the concentration was measured and the integrity of the genomic DNA was detected by agarose gel electrophoresis.

[0056] The specific method is as follows:

[0057] (1) Take 1 ml of blood sample, add 100 μl of Proteinase K solution and 2 ml of Lysis Buffer GHD, and mix by inversion.

[0058] (2) The samples were lysed at 56°C and 1500 rpm in a constant temperature oscillating metal bath for 20 min and then placed at room temperature for 5 min.

[0059] (3) Add 2 μl RNase A (100 mg / ml), invert to mix, and let stand at room temperature for 5 min.

[0060] (4) Add 2 ml of binding enhancer BP2 and 50 μl of magnetic bead suspension BE (100 mg / ml) and shake to mix for 10 min.

[0061] (5) Place the centrifuge tube on a magnetic rack and allow it to adsorb for 5 minutes. After the magnetic beads are completely adsorbed, discard the supernatant.

[0062] (6) Place the centrifuge tube on the magnetic rack, add 2.5 ml of buffer GDWP and 500 μl of binding enhancer BP2, cover the centrifuge tube, invert and mix for 2 min, let it stand on the magnetic rack, and carefully discard the supernatant.

[0063] (7) Place the centrifuge tube on a magnetic rack, add 2.5 ml of buffer GAZP and 500 μl of binding enhancer BP2, cover the centrifuge tube, invert and mix for 2 min, place on a magnetic rack, and carefully discard the supernatant.

[0064] (8) Place the centrifuge tube on the magnetic rack, add 3 ml of rinse buffer PWVP, cover the centrifuge tube, invert and mix for 2 min, let it stand on the magnetic rack, and discard the supernatant.

[0065] (9) Place the centrifuge tube on the magnetic rack, add 3 ml of rinse solution PWD, cover the centrifuge tube, invert and mix for 2 min, let it stand on the magnetic rack, and discard the supernatant.

[0066] (10) Use a pipette to remove as much liquid as possible and leave to dry at room temperature with the lid open for 5 to 10 minutes.

[0067] (11) Remove the centrifuge tube from the magnetic stand and add 100 μl-300 μl of elution buffer TB preheated at 65°C. Pipette 3-5 times to fully resuspend the magnetic beads and incubate at 65°C for 3-5 min.

[0068] (12) Place the centrifuge tube on a magnetic rack and let it stand for 2 to 5 min. After the magnetic beads are completely adsorbed, transfer the supernatant to a new centrifuge tube and store it at -20°C.

[0069] (13) Determine the concentration and detect the integrity of genomic DNA by agarose gel electrophoresis.

[0070] 3. Fragmentation of high molecular weight gDNA

[0071] (1) Take 5 μg of high molecular weight gDNA from the subject and dilute it to 150 μL with ddH2O.

[0072] (2) Place the diluted sample into the top of the g-TUBE (Covaris, 520079) device and close the lid tightly.

[0073] (3) Place the g-TUBE containing the sample into a centrifuge and set the disruption conditions to three gradients: 6000 rpm, 2 min; 5000 rpm, 2 min; 4000 rpm, 2 min; use Eppendorf 5424 as the centrifuge.

[0074] (4) Flip the g-TUBE device over and centrifuge under the same conditions. If there is still residual sample at the top, centrifuge the sample at a higher speed for 5 seconds. Repeat the high-speed centrifugation until all the sample is in the bottom chamber of the g-TUBE.

[0075] (5) Transfer the sample to a new 1.5 mL low-absorbency centrifuge tube for later use.

[0076] 4. Screening of fragmented DNA

[0077] (1) AmpureXP beads (Beckman, A63881) were diluted with 1 mM Tris-HCl pH 8 at 1×, 2×, 3×, 4× and other ratios.

[0078] (2) Mix the fragmented DNA to be screened with the diluted fragment screening magnetic beads in a ratio of 1:1, 1:2, 1:3, 1:4, etc.

[0079] (3) Briefly centrifuge the tube to concentrate the magnetic bead / DNA mixture at the bottom of the tube. Place the tube on a magnetic rack for 5-10 minutes or until the magnetic beads gather on the side of the tube and the supernatant becomes clear. Slowly remove the clear supernatant to avoid disturbing the magnetic beads.

[0080] (4) Wash the magnetic beads twice with fresh 80% ethanol. After 30 seconds, remove the 80% ethanol with a pipette.

[0081] (5) Eluting the cleaned magnetic beads to obtain fragmented DNA after fragment screening.

[0082] 5. Use the S3 cartridge for large fragment detection (Bioptic, c105106) to perform Qsep100 quality inspection on the fragmented DNA after fragment screening. The proportion of fragments below 5 kbp should be less than 10%, otherwise it will be regarded as unqualified fragmented DNA.

[0083] 6. Preparation of pre-library

[0084] (1) Use a long fragment library construction kit to construct a long fragment Y-shaped pre-library. Dilute the purified fragmented DNA that has passed the quality inspection to 50 μL, and prepare the end repair and 3'A-tailing reactions according to Table 1:

[0085] Table 1 Preparation of end repair and 3'A-tailing reaction reagents

[0086]

[0087] Set up the PCR program according to Table 2 to perform end repair and 3'A-tailing reactions.

[0088] Table 2 End repair and 3'A-tailing reaction PCR program

[0089]

[0090] (2) Adapter ligation: Add the following components in order according to Table 3 to the end repair and 3'A-tailing reaction products.

[0091] Table 3 Connector connection reagents

[0092]

[0093] Adapter sequence

[0094] A.ACACTCTTTCCCTACACGACGCTCTTCCGATC*T

[0095] BP-GATCGGAAGAGCACACGTCT

[0096] P: Phosphorylation*Phosphorylation

[0097] Vortex to mix, centrifuge briefly to ensure that all the solution is at the bottom of the tube, and immediately incubate at 20°C for 1 h in a PCR instrument with the heated lid set to 85°C.

[0098] (3) Fragment screening of adapter ligation products

[0099] ① Dilute AmpureXP beads (Beckman, A63881) in 1 mM Tris-HCl pH 8 at 1×, 2×, 3×, 4× and other ratios.

[0100] ② Mix the adapter ligation product to be screened with the diluted fragment screening magnetic beads in a ratio of 1:1, 1:2, 1:3, 1:4, etc.

[0101] ③ Centrifuge the centrifuge tube momentarily to concentrate the magnetic beads / DNA mixture at the bottom of the tube. Place the centrifuge tube on a magnetic rack for 5-10 minutes or until the magnetic beads gather on the side of the centrifuge tube and the supernatant becomes clear. Slowly remove the clear supernatant to avoid disturbing the magnetic beads.

[0102] ④ Wash the magnetic beads twice with fresh 80% ethanol. After 30 seconds, aspirate the 80% ethanol with a pipette.

[0103] ⑤ Elute the cleaned magnetic beads to obtain the adapter connection product after fragment screening.

[0104] (3) The ligation product was subjected to long-fragment PCR amplification using a dedicated enzyme for long-fragment amplification, and the reaction system was configured according to Table 4; the dedicated enzyme for long-fragment amplification was Takara LATaq DNA Polymerase Hot-Start Version (Takara, RR042A).

[0105] Table 4 Long fragment PCR amplification reagents

[0106]

[0107] Index primer sequence

[0108] Sequence 1:

[0109] CAAGCAGAAGACGGCATACGAGATNNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

[0110] Sequence 2:

[0111] AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNAACACTCTTTCCCTACACGAGCTCTTCCGATCT.

[0112] N is any base of A, T, C or G.

[0113] Different tags can be single nucleotide sequences of lengths such as 8nt, 10nt, or 12nt.

[0114] Carry out PCR reaction according to Table 5.

[0115] Table 5 Long fragment PCR amplification program

[0116]

[0117]

[0118] (4) Fragment screening was performed on the Y-shaped pre-library PCR products, aiming to control short fragments below 5 kb to less than 10%.

[0119] ① Dilute AmpureXP beads (Beckman, A63881) in 1 mM Tris-HCl pH 8 at 1×, 2×, 3×, 4× and other ratios.

[0120] ② Mix the Y-shaped pre-library PCR product to be screened with the diluted fragment screening magnetic beads in a ratio of 1:1, 1:2, 1:3, 1:4, etc.

[0121] ③ Centrifuge momentarily to concentrate the magnetic beads / DNA mixture at the bottom of the tube. Place the centrifuge tube on the magnetic rack for 5-10 minutes or until the magnetic beads gather on the side of the centrifuge tube and the supernatant becomes clear. Slowly remove the clear supernatant to avoid disturbing the magnetic beads.

[0122] ④ Wash the magnetic beads twice with fresh 80% ethanol. After 30 seconds, aspirate the 80% ethanol with a pipette.

[0123] ⑤ Elute the cleaned magnetic beads to obtain the Y-shaped pre-library PCR product after fragment screening.

[0124] ⑥ Use the S3 card holder for large fragment detection (Bioptic, c105106) to perform Qsep100 quality inspection on the Y-shaped pre-library PCR product after fragment screening. The proportion of fragments below 5kbp should be less than 10%, otherwise it will be regarded as an unqualified Y-shaped pre-library PCR product.

[0125] 7. Hybridization of the Y-shaped pre-library with the biotin-labeled double-stranded DNA probe

[0126] The components of the capture kit used in this example refer to patent ZL202011284834.1

[0127] (1) In this embodiment, the GRCh38 / hg38 gene sequence is used as the reference genome sequence, the target capture region is selected as the target gene and its upstream and downstream regions, and continuous probes are designed in this region. The coding region and non-coding region of the target gene are required to be fully covered, among which SMN1: GRCh38 / hg38, chr5: 70925086-70953015; SMN2: GRCh38 / hg38, chr5: 70049524-70087847 are the target region targeted capture regions, and the capture probes used to enrich the target gene and the flanking regions are biotin-labeled double-stranded DNA probes. The probe sequences are shown in Table 6.

[0128] Table 6 Probe sequence list

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

[0139] (2) The hybridization reaction can be performed as a single hybrid or a multi-hybrid. For a multi-hybrid, multiple Y-shaped pre-libraries need to be mixed at equal molecular weights according to the following formula: fmol = (concentration * 10 6 ) / [650*length(bp)].

[0140] (3) Vacuum concentrate a single library or a mixed library of equal molecular weight to a dry powder state, and resuspend the library according to the components in Table 7.

[0141] Table 7 Library resuspension reagents

[0142]

[0143] (4) Denature the resuspended library and probe according to the PCR program in Table 8.

[0144] Table 8 Denaturation PCR program table

[0145]

[0146] (5) Add 20 μl of hybridization buffer preheated at 65°C for at least 5 min to the denatured pre-library and probe mixture, incubate at 70°C with a heated lid at 85°C, and allow the hybridization reaction to proceed for 16-18 hours.

[0147] 8. Targeted Enrichment

[0148] (1) Preheat the streptavidin magnetic beads at 65°C for at least 10 min, then transfer the hybridization products directly from the 65°C condition to the 65°C streptavidin magnetic beads. Be sure not to cool the hybridization product temperature to room temperature, otherwise it will cause serious off-target effects.

[0149] (2) After the hybridization product is bound to the streptavidin magnetic beads, the hybridization product and the streptavidin magnetic beads are rinsed and eluted.

[0150] (3) The eluted product was captured and then PCR was performed using a long fragment specific amplification enzyme. The amplification system is shown in Table 9.

[0151] Table 9 Capture library amplification system

[0152]

[0153]

[0154] Universal primer sequences:

[0155] F: AATGATACGGCGACCACCGAGATCTACAC;

[0156] R:ATCTCGTATGCCGTCTTCTGCTTG.

[0157] Amplify according to the amplification program in Table 10.

[0158] Table 10 Capture library amplification program

[0159]

[0160] (4) Purify the PCR product using 0.8* purification magnetic beads to obtain a capture library.

[0161] (5) The captured library was tested for concentration and fragment length distribution by Qubit and Qsep100. The length of the captured library should be 6k-10k. Figure 1 .

[0162] 9. PacBio third-generation library construction (kit from PacBio, PN: 103-381-200)

[0163] (1) DNA damage repair

[0164] Configure the DNA damage repair system according to Table 11.

[0165] Table 11 Damage repair system

[0166]

[0167] The prepared reaction solution was shaken and mixed. The reaction conditions were: 37°C, 20 min; maintained at 4°C.

[0168] (2) End repair and purification

[0169] Configure the end repair and purification reaction system according to Table 12.

[0170] Table 12 End repair and purification reaction system

[0171]

[0172] The prepared reaction solution was shaken and mixed. The reaction conditions were: 25°C, 5 min; maintained at 4°C.

[0173] (3) Connector connection

[0174] Configure the adapter ligation reaction system according to Table 13.

[0175] Table 13 Linker connection reaction system

[0176]

[0177] The prepared reaction solution was shaken and mixed. The reaction conditions were: 25°C, 24h; 65°C, 10min; maintained at 4°C.

[0178] (4) Digestion of failed DNA and adapter sequences

[0179] The reaction system was configured according to Table 14.

[0180] Table 14 Digestion reaction system

[0181]

[0182] The prepared reaction solution was shaken and mixed. The reaction conditions were: 37°C, 1h; maintained at 4°C.

[0183] 10. Sequencing and result analysis

[0184] The prepared library was sequenced using a third-generation single-molecule sequencer (PacBio Revio), so that the average sequencing depth of the target region reached more than 50×. Figure 2 .

[0185] The obtained data is split and analyzed. The specific analysis method is as follows:

[0186] 1) Sample data preparation and splitting:

[0187] Lima software is used to accurately split the original PacBio sequencing data through different index sequences (Index), and the index sequence is removed during the splitting process to obtain high-quality sample data (clean data). This process effectively eliminates errors that may be introduced during library construction, ensures the accuracy and reliability of the data, and provides clear and clean data input for subsequent analysis.

[0188] 2) Alignment of data to reference genome:

[0189] Use the Minimap2 tool to align the processed clean data with the reference genome (such as hg38). By enabling the -MD parameter during the alignment process, MD tags are generated to provide more accurate alignment information for subsequent variant detection, ensuring high accuracy of variant analysis and data consistency.

[0190] 3) SMN1 / 2 haplotype analysis:

[0191] The Paraphase tool is used to perform haplotype analysis on the SMN1 / 2 gene in the sample. By carefully distinguishing different haplotypes, the genetic transmission patterns of various genotypes can be deeply analyzed, laying the foundation for subsequent recombination and mutation detection, ensuring the comprehensiveness and accuracy of the analysis.

[0192] 4) SNV and SV variation detection:

[0193] The DeepVariant tool is used to detect single nucleotide variations (SNVs) in the SMN1 / 2 gene region and identify variant points. At the same time, the cuteSV tool is used to identify structural variations (SVs) and capture structural changes such as insertions and deletions in the SMN1 / 2 gene. By integrating these two variant detection tools, all-round support is provided for variant analysis.

[0194] 5) Variant annotation and clinical disease association analysis:

[0195] Combine annovar with VEP tools to annotate the detected SNVs in detail, including variant types (such as nucleotide changes, amino acid changes, etc.), hgvs, genotype changes, relevant population frequencies (such as 1000Genomes, gnomAD database), and disease-based phenotypic information. Combine ACMG standards to determine the pathogenicity of variants and provide relevant inheritance patterns and disease characteristics.

[0196] According to the above construction process, a SMN1 and SMN2 mutation detection system was constructed, including an acquisition module, a Y-shaped pre-library preparation module, a targeted enrichment module, a single-molecule real-time sequencing library construction module, and a single-molecule real-time sequencing analysis module;

[0197] The collection module is used to collect peripheral blood from the subject and perform high molecular weight DNA extraction, shearing and fragment screening;

[0198] The Y-shaped pre-library preparation module is used to perform end repair and 3'A-tailing reaction on the extracted and sheared high molecular weight DNA, and perform Y-shaped adapter ligation and fragment screening, and then use long-fragment amplification enzyme to perform long-fragment PCR amplification to obtain a Y-shaped pre-library;

[0199] The targeted enrichment module is used to hybridize, target enrich and long-fragment PCR amplify the Y-shaped pre-library with a biotin-labeled capture probe to obtain a capture library; the target region capture range of the biotin-labeled capture probe is: SMN1: GRCh38 / hg38, chr5: 70925086-70953015; SMN2: GRCh38 / hg38, chr5: 70049524-70087847;

[0200] The single-molecule real-time sequencing library construction module is used to perform DNA damage repair, end repair, purification, sequencing adapter connection and digestion based on the captured library to obtain a single-molecule real-time sequencing library;

[0201] The single-molecule real-time sequencing analysis module is used to perform single-molecule real-time sequencing with a single-molecule real-time sequencing library, obtain sequencing data of the target region, decompose the sequencing data of the target region, and analyze the variation types of SMN1 and SMN2.

[0202] Example 2

[0203] The SMN1 and SMN2 detection systems in Example 1 were used for experimental operation, and different experimental conditions were tested to obtain the optimal conditions, and then the relevant positive samples were tested using the optimal conditions.

[0204] In the present invention, the test results on the shearing conditions of genomic high molecular weight DNA show that the optimal shearing conditions for the present invention are: using a long fragment shearing tube g-TUBE (Covaris, 520079), an Eppendorf 5424 centrifuge, and the shearing conditions are 4000 rpm and 2 min. Figure 3 Compare the interruption effects under different interruption conditions.

[0205] In the present invention, the test results on the fragment screening conditions show that: the optimal condition for the fragmentation of the present invention is: the optimal magnetic bead screening ratio for the required fragment length of the present invention is that the ratio of the fragmented DNA and the diluted fragment screening magnetic beads is 1:3 for mixed screening. Figure 4 Compare the screening effects of different screening conditions.

[0206] 10 positive test samples were tested according to the HBA and HBB mutation detection systems in Example 1. The results showed that the present invention can intuitively and correctly detect the mutation types of positive samples, as shown in Table 15. For samples that are vaguely judged by traditional methods (qPCR, MLPA and Sanger sequencing) (samples 3, 5, 8, and 9), the mutation type can also be clearly determined, and the breakpoint position can be accurately seen. At the same time, samples with inconsistent results were verified by PCR or PCR-Sanger sequencing, and the results were consistent with the method of the present invention.

[0207] Table 15 Test sample test results

[0208]

[0209] In summary, the present invention can detect complex mutation types such as point mutations, large fragment deletions, multi-copy mutations, and recombination on SMN1 and SMN2, and the present invention can clearly detect the exact location where the mutation occurs, and can accurately identify cis- and trans-mutations without the need for family verification and negative sample controls.

[0210] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described with reference to the preferred embodiments of the present invention, it should be understood by those skilled in the art that various changes may be made in form and details without departing from the spirit and scope of the present invention as defined in the appended claims.

Claims

1. A SMN1 and SMN2 mutation detection system, characterized in that: It includes acquisition module, Y-shaped pre-library preparation module, targeted enrichment module, single-molecule real-time sequencing library construction module and single-molecule real-time sequencing analysis module; The collection module is used to collect peripheral blood of the subject to be tested and to extract, shear and screen high molecular weight DNA; The Y-shaped pre-library preparation module is used to perform end repair and 3'A-tailing reaction on the extracted and sheared high molecular weight DNA, perform Y-shaped adapter connection and fragment screening, and then use a long-fragment amplification enzyme to perform long-fragment PCR amplification to obtain a Y-shaped pre-library; The targeted enrichment module is used to hybridize, target enrich and long-fragment PCR amplify the Y-shaped pre-library with a biotin-labeled capture probe to obtain a capture library; the target region capture range of the biotin-labeled capture probe is: SMN1: GRCh38 / hg38, chr5: 70925086-70953015; SMN2: GRCh38 / hg38, chr5: 70049524-70087847; the nucleotide sequence of the biotin-labeled capture probe is SEQ ID No: 1-SEQ ID No: 208; The single-molecule real-time sequencing library construction module is used to perform DNA damage repair, end repair, purification, sequencing adapter connection and digestion according to the captured library to obtain a single-molecule real-time sequencing library; The single-molecule real-time sequencing analysis module is used to perform single-molecule real-time sequencing with a single-molecule real-time sequencing library, obtain sequencing data of a target region, decompose the sequencing data of the target region, and analyze the variation types of SMN1 and SMN2.

2. The SMN1 and SMN2 mutation detection system according to claim 1, characterized in that: The shear length of the high molecular weight DNA is 11-20 kbp, and the shearing condition is 4000 rpm, 2 min; The fragment screening adopts magnetic bead screening, and the ratio of screening material to fragment screening magnetic beads is 1:

3.

3. The SMN1 and SMN2 mutation detection system according to claim 1, characterized in that: The reaction reagents for the end repair and 3'A-tailing reaction include 7μl Rapid Max End Prep Buffer, 3μl End Prep Enzymes and 50μl high molecular weight gDNA fragment; the PCR program for the end repair and 3'A-tailing reaction is: 20°C, 30min, 65°C, 30min, and 4°C.

4. The SMN1 and SMN2 mutation detection system according to claim 1, characterized in that: The reagents for Y-shaped adapter ligation include 60 μl of end repair and 3'A-tailing reaction products, 30 μl of ligase buffer, 10 μl of ligase, 5 μl of water and 5 μl of adapter; the reagents for long-fragment PCR amplification include 46 μl of Y-shaped adapter ligation and fragment screening products, 100 μL, 25 mM 10X LAPCR Buffer II (Mg 2+ Plus), 40 μL dNTP Mixture, 10 μL universal primers with different labels and 4 μL TaKaRa LATaq HS; the PCR program for the long-fragment PCR amplification was 94° C., 2 min; 98° C., 10 s, 58.8° C., 30 s, 68° C., 15 min, repeated 6 times; 68° C., 10 min; and maintained at 4° C.

5. The SMN1 and SMN2 mutation detection system according to claim 1, characterized in that: The capture library obtained by hybridizing the biotin-labeled capture probe with the Y-shaped pre-library, performing targeted enrichment and long-fragment PCR amplification includes: The biotin-labeled capture probe and Y-shaped pre-library were vacuum concentrated to a dry powder state and resuspended; The resuspended product is subjected to denaturation of the Y-shaped pre-library and probe; Add 20 μl of hybridization buffer preheated at 65°C for at least 5 min to the denatured prelibrary and probe mixture, and perform hybridization reaction at 70°C and 85°C on the heated lid for 16-18 h; The hybridization product was eluted using streptavidin magnetic beads; The eluted product was amplified by long-fragment PCR using a long-fragment specific amplification enzyme; the reagents for long-fragment PCR amplification included 48 μL of eluted product, 100 μL, 25 mM 10X LAPCR Buffer II (Mg 2+ Plus), 40 μL dNTP Mixture, 6 μL adapter universal primer, 4 μL TaKaRa LATaq HS and 2 μL water; the PCR program for the long-fragment PCR amplification is 94°C, 2 min; 98°C, 10 s, 58.8°C, 30 s, 68°C, 15 min, repeated 12 times; 68°C, 10 min; 4°C hold; The product after long-fragment PCR amplification is purified using magnetic beads to obtain a capture library.

6. The SMN1 and SMN2 mutation detection system according to claim 1, characterized in that: The DNA damage repair reagent includes 5 μl 10× DNA damage repair buffer, 0.5 μl 10× NAD + , 5μl 10mM ATP, 2μl DNA damage repair enzyme mixture, 1μg captured product DNA, and make up to 50μl with water.

7. The SMN1 and SMN2 mutation detection system according to claim 1, characterized in that: The reagents for sequencing adapter ligation include 30 μl of captured product DNA after end repair purification, 1 μl of PacBio platform sequencing adapter, 4 μl of 10× ligation buffer, 2 μl of 1 mM ATP and 1 μl of DNA ligase, and the mixture is filled to 40 μl with water.

8. The SMN1 and SMN2 mutation detection system according to claim 1, characterized in that: The single molecule real-time sequencing analysis module is used for: 1) Use Lima software to split the original PacBio sequencing data by different index sequences, and remove the index sequences during the splitting process to obtain high-quality sample data 2) Use the Minimap2 tool to align the sample data with the reference genome and generate MD tags by enabling the -MD parameter during the alignment process; 3) Use the Paraphase tool to perform haplotype analysis on the SMN1 / 2 gene in the samples; 4) Use the DeepVariant tool to detect single nucleotide variations in the SMN1 / 2 gene region and identify variation points; combine with the cuteSV tool to identify structural variations and capture insertion and deletion changes in the SMN1 / 2 gene; 5) Combine annovar and VEP tools to annotate the detected SNVs, including variant type, hgvs, genotype changes, relevant population frequency, and disease-based phenotypic information; judge the pathogenicity of the variant by combining the ACMG standard, and provide relevant inheritance patterns and disease characteristics.

9. A method for detecting SMN1 and SMN2 mutations for non-disease diagnosis purposes, characterized in that: include: Collect peripheral blood from the subjects and perform high molecular weight DNA extraction, shearing and fragment screening; The extracted and sheared high molecular weight DNA is subjected to end repair and 3'A-tailing reaction, and Y-shaped adapter ligation and fragment screening are performed, and then long-fragment PCR amplification is performed using a long-fragment amplification enzyme to obtain a Y-shaped pre-library; According to the Y-shaped pre-library, a biotin-labeled capture probe is used to hybridize with the Y-shaped pre-library, targeted enrichment and long-fragment PCR amplification to obtain a capture library; the target region capture range of the biotin-labeled capture probe is: SMN1: GRCh38 / hg38, chr5: 70925086-70953015; SMN2: GRCh38 / hg38, chr5: 70049524-70087847; the nucleotide sequence of the biotin-labeled capture probe is SEQ ID No: 1-SEQ ID No: 208; Based on the captured library, DNA damage repair, end repair, purification, sequencing adapter ligation and digestion are performed to obtain a single-molecule real-time sequencing library; Single-molecule real-time sequencing was performed using a single-molecule real-time sequencing library to obtain sequencing data of the target region. The sequencing data of the target region was decomposed and analyzed to obtain the variation types of SMN1 and SMN2.

10. The method for detecting SMN1 and SMN2 mutations for non-disease diagnosis purposes according to claim 9, characterized in that: The single molecule real-time sequencing library is used to perform single molecule real-time sequencing to obtain sequencing data of the target region, and the sequencing data of the target region is disassembled to analyze the variation types of SMN1 and SMN2, including: 1) Use Lima software to split the original PacBio sequencing data by different index sequences, and remove the index sequences during the splitting process to obtain high-quality sample data; 2) Use the Minimap2 tool to align the sample data with the reference genome and generate MD tags by enabling the -MD parameter during the alignment process; 3) Use the Paraphase tool to perform haplotype analysis on the SMN1 / 2 gene in the samples; 4) Use the DeepVariant tool to detect single nucleotide variations in the SMN1 / 2 gene region and identify variation points; combine with the cuteSV tool to identify structural variations and capture insertion and deletion changes in the SMN1 / 2 gene; 5) Combine annovar and VEP tools to annotate the detected SNVs in detail, including variant type, hgvs, genotype changes, relevant population frequency, and disease-based phenotypic information; judge the pathogenicity of the variant by combining the ACMG standard, and provide relevant inheritance patterns and disease characteristics.

Images