Application of LncRNA EFRL in preparation of product for diagnosing homocysteine induced atherosclerosis, kit and medicine

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of LncRNA EFRL in preparation of a product for diagnosing homocysteine induced atherosclerosis, a kit and a medicine. The nucleotide sequence of the LncRNA EFRL is as shown in SEQ ID NO. 1 (sequence identifier number 1). UCSC, CPC, CPAT, GO and KEGG are used for analyzing new LncRNA, it is clear that the LncRNAEFRL is high in conservative property and does not have the protein encoding capacity, and it is clear that the LncRNAEFRL can affect atherosclerosis through the intercellular effect of macrophages.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to application of LncRNAEFRL in preparing products for diagnosing homocysteine-induced atherosclerosis, a kit and a medicine. Background Art

[0002] Atherosclerosis (As) is generally considered to be a chronic inflammatory disease. The lesions start from the intima, followed by lipid and complex carbohydrate accumulation, fibrosis and calcification, accompanied by gradual degeneration of the middle layer of the artery. Secondary lesions include intraplaque hemorrhage, plaque rupture and local thrombosis. Under normal circumstances, macrophage efferocytosis plays a very important role. Professional phagocytes can effectively remove apoptotic cells to prevent increased inflammation and plaque instability. When efferocytosis is impaired, apoptotic cells cannot be removed in time and accumulate, leading to secondary necrosis. Necrotic cells, inflammatory mediators and cytotoxic substances accumulate under the intima, triggering a stronger inflammatory response, promoting the expansion of the necrotic core in the plaque, and the vicious cycle exacerbates the instability of atherosclerotic plaques and increases the risk of cardiovascular events.

[0003] Homocysteine ​​(Hcy) is a sulfur-containing amino acid and an important intermediate product produced in the metabolism of methionine and cysteine. Hcy has been identified as an independent risk factor and predictor of atherosclerosis. Studies have shown that elevated plasma Hcy levels can lead to larger atherosclerotic plaque formation and more inflammatory cytokine secretion by changing macrophage function and reducing the number of macrophages. However, the mechanism by which Hcy levels regulate macrophage efferocytosis and participate in As occurrence remains unclear.

[0004] Long non-coding RNA (LncRNA) is a type of RNA with a length greater than 200 nt and regulatory functions. LncRNA can participate in genome organization, cell structure and gene expression through a variety of interactions. These interactions include chromatin structure, transcriptional regulation, splicing, protein translation and localization. The existing technical applications of LncRNA in atherosclerosis are mainly concentrated in the fields of diagnosis and treatment. For example, LncRNA ASD can affect the progression of atherosclerosis by regulating the function of vascular endothelial cells. Its expression in peripheral blood mononuclear cells of patients with coronary atherosclerosis is significantly increased, and it can be used as a potential diagnostic marker; LncRNA MALAT1 can regulate the proliferation, migration and apoptosis of endothelial cells. Monitoring its level in the blood can assess the risk of atherosclerosis or the progression of the disease. However, its application in As research also faces many practical problems. The expression level of LncRNA in cells is relatively low and the sequence structure is relatively complex, which makes its detection and quantification quite difficult. Therefore, the above situation will lead to difficulties in the early diagnosis of homocysteine-induced atherosclerosis and the lack of specificity and sensitivity of markers. Based on this situation, finding new biomarkers with high specificity and sensitivity will help in the early diagnosis of homocysteine-induced atherosclerosis. Summary of the invention

[0005] In order to solve the problems of difficulty in early diagnosis of homocysteine-induced atherosclerosis and lack of specificity and sensitivity of markers in the prior art, the present invention provides the use of LncRNAEFRL in the preparation of products for diagnosing homocysteine-induced atherosclerosis, a kit and a drug.

[0006] To achieve the above purpose, the present invention adopts the following technical solution.

[0007] The present invention provides application of LncRNA EFRL in preparing a product for diagnosing homocysteine-induced atherosclerosis.

[0008] Among them, the nucleotide sequence of the LncRNA EFRL is shown in SEQ ID NO.1: GAGACCACAAAATGGCTGCCGGCGGCTTCGTCACGTGACCCCTTTGTGCCTTTCGGGCCCCCGAACTCCGCGGGACCCAGGTCGGGCAGATCCTCACAGCGGAAGACCGGCAGCGGCTTCGAGGCGTCCAGCGCCCGCGCCCGAAACGACAGTTTACTCATCTCAGGCGCAGCAGATACCTCTCCGCTCTGGGGAAACGGCCCCGGCCAGCGGGATCATGGAGAACCGGAGTTTCGGTCTCCACTCGCCTGCCGCTGCCGGGGACTTGGGGGCGGAGCGCAAAGCCCGCCGTCCGGGCCCTGACACCAGCCGGGAGGGTGGGAGGCTGTGCCGCTCCGCGCCTCGCTCACTCGCTCTCTTCAATACGCCATGGCCAACATGGCGGACATTAAAACTCCACTGTGCGCTCTTCAGCCAACCCCAGCCATTCCCCACACTGCATCGCGCAGCGACGCGGGCACGCGCGGGGGGAGCGCGGGCTCGAGCGGGCGCCGGCGCGGCGCGGCATGGAGCGCGCGTCCCGCCAACCCCCGGCCCGCCGGCCGCCGGCCTCGCCCGCCCGCTCCGCCCGGCCGCCTCGCTTCCCGCCCTGCGCGGTGCTCAAGCGAGGGAGCGACGAGCTCGGCGCCCGCGCGGGCCCTGGGAAGGCCGGCGCGTAGAGCGGCTGGGA. The LncRNA EFRL is simply referred to as EFRL.

[0009] The present invention focuses on the key biomolecule LncRNA EFRL. Studies have shown that in homocysteine-induced atherosclerosis, the expression level of LncRNA EFRL will change specifically and significantly. Through advanced molecular biology techniques, we can detect the content of LncRNA EFRL in biological samples (such as blood, tissue fluid, etc.). Based on this, the present invention provides LncRNA EFRL for preparing products for diagnosing homocysteine-induced atherosclerosis, and using real-time fluorescence quantitative PCR technology, LncRNA EFRL in the sample can be accurately quantified in a short time. Compared with traditional detection methods, this detection method based on LncRNA EFRL has higher sensitivity and specificity, which solves the problem of difficulty in early diagnosis of homocysteine-induced atherosclerosis in the prior art, lack of specificity and sensitivity of markers. In addition, the technology is easy to operate, does not require complex sample pretreatment, greatly shortens the detection time, and helps to improve the early diagnosis level of homocysteine-induced atherosclerosis.

[0010] Preferably, the product includes a kit or a drug for detecting the expression of the LncRNA EFLR and the expression of the downstream target gene SPAST, thereby achieving early, highly sensitive, and highly specific diagnosis of Hcy-induced As.

[0011] The present invention also provides a kit for diagnosing homocysteine-induced atherosclerosis using the LncRNA EFRL as a marker, the kit comprising a specific primer pair for detecting the expression amount of the LncRNA EFLR; the upstream and downstream base sequences of the specific primer pair for detecting the expression amount of the LncRNA EFRL are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0012] Preferably, locked nucleotides LNA GapmeRs are also included.

[0013] Preferably, a transfection-assisting agent is also included.

[0014] The transfection aid reagent is Lipofectamine 2000.

[0015] Preferably, a universal primer pair for quantification of an internal reference gene is also included.

[0016] The internal reference gene is the GAPDH gene.

[0017] Preferably, the upstream and downstream base sequences of the universal primer pair for quantification of the internal reference gene are shown as SEQ ID NO.4 and SEQ ID NO.5, respectively.

[0018] Preferably, the drug regulates the expression of the downstream target gene SPAST in the early diagnosis or detection of homocysteine-induced atherosclerosis.

[0019] The present invention also provides a drug for treating homocysteine-induced atherosclerosis, the drug comprising any one or more of the following:

[0020] The LncRNAEFRL.

[0021] A recombinant vector containing the coding gene of the LncRNAEFRL.

[0022] A recombinant virus containing the coding gene of the LncRNAEFRL.

[0023] A recombinant viral vector containing the coding gene of the LncRNAEFRL.

[0024] The nucleotide sequence of the LncRNAEFRL is shown in SEQ ID NO.1.

[0025] Preferably, the drug further comprises a pharmaceutically acceptable carrier.

[0026] The carrier includes any one or more of chitosan, cholesterol, liposome and nanoparticle.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] 1. The present invention provides the application of LncRNAEFRL in the preparation of products for diagnosing homocysteine-induced atherosclerosis, providing a new method that is more accurate and sensitive and can effectively screen homocysteine-induced atherosclerosis in the early stage. Compared with traditional detection methods, this detection method based on LncRNAEFRL has higher sensitivity and specificity. It can accurately capture the abnormality of LncRNAEFRL in the early stage of the disease, thereby achieving early diagnosis. In addition, the technology is easy to operate, does not require complex sample pretreatment, greatly shortens the detection time, meets the clinical demand for timely detection, and provides doctors with a more timely and accurate diagnostic basis, helping to improve the early diagnosis level of homocysteine-induced atherosclerosis.

[0029] 2. The present invention uses UCSC, CPC, and CPAT to analyze a new LncRNA MSTRG 88917.16, and it is clear that it is highly conservative and does not have the ability to encode proteins, and it is named LncRNA EFRL (Efferocytosis Relatived LncRNA). Combining UCSC, CPAT, CPC, GO and KEGG analysis and cultured cell results, the cell expression localization of LncRNA EFRL is analyzed, and it is clear that it can affect the occurrence of atherosclerosis through macrophage efferocytosis, providing an important intervention target for further improving the mechanism of action, clinical diagnosis and precision treatment of atherosclerosis.

[0030] 3. The present invention focuses on the key biological molecule LncRNAEFRL. Studies have found that in homocysteine-induced atherosclerosis, the expression level of LncRNAEFRL will undergo specific and significant changes. Through advanced molecular biology techniques, we can detect the content of LncRNAEFRL in biological samples (such as blood, tissue fluid, etc.). Specifically, we have developed a set of efficient detection kits and drugs. The kit contains specific primers and probes for LncRNAEFRL, and uses real-time fluorescence quantitative PCR technology to accurately quantify LncRNAEFRL in samples in a short time. Compared with traditional detection methods, this detection method based on LncRNA EFRL has higher sensitivity and specificity. It can accurately capture the abnormality of LncRNAEFRL in the early stage of the disease, thereby achieving early diagnosis. In addition, the technology is easy to operate, does not require complex sample pretreatment, greatly shortens the detection time, and helps to improve the early diagnosis level of homocysteine-induced atherosclerosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 In order to investigate the expression of MSTRG 88917.16 in Hcy-intervention macrophages in the present invention, high-throughput sequencing analysis was performed on Hcy-intervention macrophages, and a new highly expressed LncRNA was found, which was numbered as MSTRG 88917.16, and its expression level was verified by qRT-PCR.

[0032] Figure 2The present invention provides an analysis of the conservation and protein coding ability of MSTRG.88917.16, wherein Figure A is the full-length base sequence of the MSTRG.88917.16 transcript, Figure B is the open reading frame in the MSTRG.88917.16 sequence, Figure C is the location of MSTRG.88917.16 on human chromosomes and its conservation among different higher mammals, Figure D is an analysis of the protein coding ability of MSTRG.88917.16 by the transcript protein coding ability prediction software (CPAT), and Figure E is an analysis of the protein coding ability of MSTRG.88917.16 by the transcript protein coding potential prediction tool (CPC).

[0033] Figure 3 This is the GO and KEGG enrichment analysis MSTRG.88917.16 in the present invention; wherein, Figure 3 A in the figure is the GO functional annotation and enrichment analysis bar chart. Figure 3 B in the figure is a scatter plot of KEGG pathway enrichment analysis.

[0034] Figure 4 The present invention localizes EFRL in macrophages; wherein, Figure 4 A in the figure shows the distribution of EFRL in macrophages detected by RNA-FISH. Figure 4 B in the figure is a nuclear-cytoplasmic separation experiment to detect the expression level of EFRL in the cytoplasm and nucleus.

[0035] Figure 5 This is the interference efficiency of transfected LNA GapmeRs in macrophages detected by qRT-PCR in the present invention.

[0036] Figure 6 The apoptosis rate of Jurkat cells was detected by flow cytometry in the present invention; Figure 6 A in the figure is the apoptosis level of Jurkat cells in each group detected by flow cytometry, and the three figures from left to right are the apoptosis rates of Jurkat cells irradiated for 0 min, 15 min and 30 min, respectively. Figure 6 B in the figure is a statistical chart of cell apoptosis rate.

[0037] Figure 7 The effect of knocking down EFRL on macrophage efferocytosis in the present invention; wherein, Figure 7 A in the figure is an in vitro cell burial experiment detected under a fluorescence microscope. Figure 7 B in the figure is an experiment of detecting in vitro burial effect using laser confocal microscopy; Figure 7 C in the figure is ELISA to detect the content of inflammatory factor IL-1β; Figure 7 D in the figure is ELISA to detect the content of inflammatory factor IL-18.

[0038] Figure 8It is the expression level of SPAST, the target gene of EFRL in the present invention, in macrophages intervened by Hcy.

[0039] Fig. 9 This is the effect of knocking down EFRL on the expression of the downstream target gene SPAST in the present invention. DETAILED DESCRIPTION

[0040] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0041] Example 1

[0042] 1. Macrophage Experimental Grouping and Culture

[0043] 1. Experimental Grouping

[0044] To study the effect of homocysteine ​​(Hcy) intervention on macrophage efferocytosis: control group (Control) and Hcy intervention group (Hcy).

[0045] Among them, the treatment method of the control group (Control group) was as follows: after the cells were in the logarithmic growth phase and the density reached 70% (V / V), they were randomly divided into groups and no intervention was performed; the treatment method of the Hcy intervention group (Hcy) was as follows: after the cells were in the logarithmic growth phase and the density reached 70% (V / V), they were randomly divided into groups and intervened with 100 μmol / L Hcy working solution for 24 hours.

[0046] The effect of EFRL interference on macrophage efferocytosis was studied: normal control group (Control group), interference control group (LNA-NC group), EFRL interference group 1 (LNA-EFRL-1 group) and EFRL interference group 2 (LNA-EFRL-2 group). The cells in the logarithmic growth phase were digested and counted, resuspended in DMEM medium (7% serum concentration) and inoculated in equal amounts in 6-well plates. Transfection was performed when the cell density reached 70% (V / V). The treatment method for the normal control group (Control) was as follows: adding DMEM high-glucose medium; the treatment method for the interference control group (LNA-NC) was as follows: adding LNA-NC transfection reagent mixture; the treatment method for the EFRL interference group 1 (LNA-EFRL-1) was as follows: adding LNA-EFRL-1 transfection reagent mixture; the treatment method for the EFRL interference group 2 (LNA-EFRL-2) was as follows: adding LNA-EFRL-2 transfection reagent mixture; the cells were returned to the incubator for continued culture, and the mixture was discarded after 4 hours, and the cells were resuspended in DMEM medium (10% serum concentration) for continued culture for 24 hours.

[0047] Two locked nucleotides (LNA GapmeRs) were designed based on the EFRL sequence to construct an EFRL knockdown model (Shanghai Biosynthetics), denoted as LNA-EFRL, and transferred into macrophage cells to achieve knockdown of the target gene.

[0048] 2. Cell culture

[0049] (1) The cell culture medium is a complete culture medium, specifically: DMEM high-glucose culture medium containing 10% fetal bovine serum and 1% penicillin-streptomycin, or RPMI-1640 culture medium containing 10% fetal bovine serum and 1% penicillin-streptomycin.

[0050] (2) Normoxia culture: 37°C, 5% CO 2 in a cell culture incubator;

[0051] (3) After 24 hours, the cells were collected for subsequent experiments.

[0052] 3. Cell cryopreservation

[0053] The cell culture flask was taken out from the incubator, and macrophages in the logarithmic growth phase were selected. The waste liquid in the culture flask was aspirated and discarded on the clean bench. After gently blowing and washing twice, 1 mL of trypsin was added to digest the cells. After digestion was complete, the trypsin was discarded, and DMEM high-glucose medium was added to blow and mix the adherent cells. The cells were transferred to a 15 mL centrifuge tube and centrifuged at 1000 rpm for 5 min. The supernatant was discarded, and the freezing solution was added. The cells were mixed by blowing and then divided into 1.8 mL cryopreservation tubes, and the cell name, freezing time and operator were marked. The cells were transferred to a liquid nitrogen tank for retention in the order of gradient freezing at 4°C for 30 min, -20°C for 2 h, and -80°C overnight.

[0054] The freezing solution is prepared by using a volume ratio of DMSO to fetal bovine serum of 1:9.

[0055] Overnight refers to a time ≥12h.

[0056] 4. Locked Nucleotide Transfection

[0057] Macrophages in the logarithmic growth phase were digested and counted, resuspended in DMEM medium containing 7% fetal bovine serum by volume, and inoculated in equal amounts in 6-well plates. When the cell density reached 70% (V / V), transfection was performed. According to the instructions for the transfection reagent, the required transfection locked nucleotide volume was calculated to prepare the LNA GapmeRs working solution, and the transfer agent lipo2000 was added to the DMEM high-glucose medium according to the ratio, and the mixture was allowed to stand at room temperature for 5 minutes. The LNA GapmeRs working solution was added to the mixture according to the ratio, and the mixture was allowed to stand at room temperature for 20 minutes. The LNA GapmeRs transfection reagent mixture was added to the cell culture bottle and returned to the incubator for continued culture. After 4 hours, the culture medium was discarded, and the culture was continued for 24 hours after resuspending in DMEM medium containing 10% fetal bovine serum by volume. Macrophage RNA was extracted and the transfection efficiency was verified by PCR.

[0058] Among them, the name of the transfection reagent is LNA GapmeRs, which was purchased from Shanghai Biotechnology.

[0059] 2. Real-time fluorescence quantitative polymerase chain reaction, abbreviated as qRT-PCR

[0060] 1. Extraction of total RNA from cells

[0061] (1) Preparation: According to the instructions of the TIANGEN RNA preparation kit, place the items required for RNA extraction in an ultraviolet-irradiated clean bench.

[0062] (2) Sample lysis: The macrophages transfected with ERFL locked nucleotide prepared in advance were placed in an EP tube containing 1 mL of RZ lysis buffer. The cells were gently pipetted and mixed, and then placed at room temperature for 5 min to allow for complete lysis.

[0063] (3) Place the tube in a pre-cooled centrifuge and centrifuge at 12,000 rpm / min for 5 min. Remove the tube and move it to the workbench. Transfer the supernatant to a new enzyme-free EP tube prepared in advance.

[0064] (4) Add 200 μL of chloroform to the sample, vortex vigorously for 30 seconds, and then let it stand on the workbench for 3 minutes. After centrifugation at 4°C for 10 minutes, the sample can be seen to be divided into three layers: organic layer, middle layer and aqueous phase. RNA is mainly concentrated in the aqueous phase. Pipette 450 μL of the colorless aqueous phase and transfer it to a new EP tube.

[0065] (5) Add 225 μL of anhydrous ethanol to the EP tube and mix by inverting. Transfer the mixed liquid to the marked adsorption column and centrifuge at 4°C, 12,000 rpm / min for 30 seconds.

[0066] (6) Discard the liquid in the collection tube and add 500 μL of deproteinized eluent RD to the adsorption column. Centrifuge at 12,000 rpm at 4°C for 30 seconds.

[0067] (7) Discard the liquid in the collection tube and add 500 μL of rinse solution RW to the adsorption column. Place on the workbench for 2 min and then centrifuge at 4°C and 12,000 rpm / min for 30 sec. Repeat this step twice.

[0068] (8) After discarding the waste liquid, centrifuge at 12000 rpm / min at 4°C for 2 min. After the centrifugation, aspirate the remaining liquid.

[0069] (9) In a clean bench, let the adsorption column stand for 10 min to fully dry, then move it to a marked RNase-free EP tube and add 40 μL RNase-free ddH 2 O, let stand at room temperature for 2 min, centrifuge at 4°C 12000 rpm / min for 30 sec to collect RNA, use a spectrophotometer to detect RNA concentration, and store in a -80°C refrigerator for long-term storage.

[0070] 2. Reverse transcription

[0071] (1) After preparing the RNA, place the RNA that has been extracted and stored at -80°C on ice. After thawing, remeasure the RNA concentration and configure the reverse transcription system for each sample, as shown in Table 1.

[0072] Table 1 Reverse transcription system

[0073] Reagents Usage 5×PrimeScriptBuffer 4μL PrimeScriptRTEnzymeMixI 1μL 50 μM OligodTPrimer 1μL 100 μM Random 6mers 1μL Total RNA 1 μg <![CDATA[RNaseFreeddH 2 The]]> up to 20 μL

[0074] (2) Vortex the prepared reverse transcription system to mix well, remove bubbles, and perform reverse transcription according to the conditions in Table 2:

[0075] Table 2 Reverse transcription conditions

[0076] Reaction temperature Reaction time 37℃ 15min 85℃ 5sec 4℃ ∞

[0077] (3) After the RNA is reverse transcribed into cDNA, the sample is collected and stored in a -20°C refrigerator.

[0078] 3. PCR reaction

[0079] (1) Prepare the reagents required for the PCR reaction according to the table below. Place the eight-row array on a pre-cooled constant temperature module to prepare the reaction solution. See Table 3 for details.

[0080] Table 3 Reaction system

[0081] Reagents Usage 2×SYBR Green PCR Master Mix 10μL 10 μM Forward Primer 1μL 10μM Reverse Primer 1μL cDNA 2μL <![CDATA[ddH 2 The]]> up to 20 μL Total 20μL

[0082] (2) Add the reaction solution to each of the eight tubes in a row, gently shake to mix until there are no bubbles, and then perform PCR amplification. The procedure is shown in Table 4.

[0083] Table 4 Amplification procedures

[0084] Cycle steps Reaction conditions Pre-denaturation 95℃,30sec transsexual 95℃,5sec Annealing and extension 58.9℃,34sec

[0085] (3) Adopt 2 -ΔΔCt The relative expression of target genes was calculated by this method.

[0086] 4. In situ hybridization assay to detect the localization of LncRNAEFRL in macrophages

[0087] (1) Observe the macrophages that are growing well under the microscope and follow the instructions for FISH testing.

[0088] (2) Fix the macrophages with 4% (mass-to-volume ratio, meaning 4 g of paraformaldehyde per 100 ml of solution) paraformaldehyde for 10 min.

[0089] (3) Treat with proteinase K, glycine and acetylation reagent in sequence.

[0090] (4) Prehybridization at 37°C for 30 min.

[0091] (5) Hybridization with Cy3-labeled EFRL and incubation overnight, and cell nuclei were stained with DAPI. Incubation overnight means that the time is ≥ 12 hours.

[0092] (6) Seal the slides and observe the results under a fluorescence microscope.

[0093] 5. Nuclear-cytoplasmic separation method to clarify the location of EFRL

[0094] (1) Collect macrophages according to grouping, wash once with pre-cooled PBS, centrifuge at 1000 g for 5 min at 4°C, discard the supernatant, and place on ice.

[0095] (2) Add pre-chilled 500 μL CER I and 27.5 μL CER II, vortex for 15 seconds, incubate on ice for 10 minutes, and centrifuge at 12,000 g at 4°C for 5 minutes.

[0096] (3) Transfer the supernatant (cytoplasmic extract) after centrifugation to a clean pre-chilled tube.

[0097] (4) Add 250 μL of pre-cooled NER to the precipitate, vortex for 15 s, and place on ice for 10 min. Repeat 4 times and centrifuge at 12,000 g for 10 min at 4°C.

[0098] (5) Transfer the supernatant (nuclear extract) to a clean pre-chilled tube.

[0099] (6) Perform qRT-PCR on the RNA of these two parts.

[0100] 6. Detection of Jurkat cell apoptosis by flow cytometry

[0101] (1) Jurkat cells were irradiated under 254 nm UV light for 0 min, 15 min, and 30 min according to the grouping.

[0102] (2) Incubate under normal cell culture conditions for 3 h.

[0103] (3) Jurkat cells were stained using the Annexin V-FITC / PI apoptosis detection kit and resuspended in PBS. The concentration of each component in PBS was 1.06 mM KH 2 PO 4 、154.0mM NaCl、5.60mM Na 2 HPO 4 , pH 7.4, purchased from Wuhan Saiweier.

[0104] (4) Flow cytometry was used to detect the apoptosis of Jurkat cells.

[0105] 7. Detection of macrophage efferocytosis by fluorescence microscopy

[0106] (1) Jurkat cells were exposed to 254 nm ultraviolet light for 15 min.

[0107] (2) 1×10 7 Resuspend in Diluent C at a concentration of 10 cells / mL.

[0108] (3) Add PKH26 fluorescent dye for labeling.

[0109] (4) Apoptotic Jurkat cells were co-cultured with Hcy-treated macrophages at a ratio of 1:1 for 45 min.

[0110] (5) PBS was used to wash away apoptotic cells that were not phagocytosed by macrophages.

[0111] (6) Fixation with 4% (mass-to-volume ratio, meaning 4 g of paraformaldehyde per 100 ml of solution) paraformaldehyde for 20 min.

[0112] (7) Seal the slides and observe the results under a fluorescence microscope.

[0113] 8. Laser confocal microscopy to measure macrophage efferocytosis

[0114] (1) Macrophages were plated on a laser confocal microplate at a cell density of 70% (the percentage of the number of cells in the culture dish that can accommodate the cells).

[0115] (2) Induce Jurkat cells into apoptotic cells and add PKH26 fluorescent dye to label them, and wash the unlabeled apoptotic cells with PBS.

[0116] (3) The PKH26-labeled apoptotic cells were co-cultured with macrophages at a ratio of 1:1, and the apoptotic cells that were not phagocytosed were removed by washing with PBS.

[0117] (4) Incubate in 4% (mass-to-volume ratio, meaning 4 g of paraformaldehyde per 100 ml of solution) paraformaldehyde in the dark, incubate with primary antibody F4 / 80 (1:500) at 4°C overnight, incubate with fluorescent secondary antibody FITC (1:1000) at room temperature for 2 h the next day, and stain the nuclei with DAPI for 5 min. Overnight means time ≥ 12 h.

[0118] (5) Seal the slides and observe the results under a laser confocal microscope.

[0119] 9. ELISA assay to detect IL-1β and IL-18

[0120] (1) Sample processing: The cell culture supernatants of the Control group, Hcy group, Hcy+LNA-NC group, and Hcy+LNA-EFRL group were collected according to the groups.

[0121] (2) Preparation of standard gradient working solution: Add 1 mL of diluent to the standard and mix gently. Prepare 100 pg / mL, 50 pg / mL, 25 pg / mL, 12.5 pg / mL, 6.25 pg / mL, 3.13 pg / mL, and 0 pg / mL working solutions, i.e., standard solutions, according to the doubling dilution method. The diluent is PBS.

[0122] (3) Sample addition: Add the prepared standard solution and the cell culture supernatant of each group to a 96-well ELISA plate in sequence, 100 μL / well. Set up a blank well and add 100 μL of universal diluent. Cover the plate with a sealing film and mix gently. Incubate at 37°C for 60 min. Standard. The universal diluent is PBS.

[0123] (4) Biotinylated antibody: After removing the ELISA plate, aspirate the liquid and add 100 μL of the pre-prepared biotinylated antibody working solution to each well. Cover the plate with a sealing film and gently mix. Incubate at 37°C for 60 min.

[0124] (5) Washing: After taking out the ELISA plate, remove the liquid and add 300 μL of the previously prepared washing solution to each well. After standing for 1 min, remove the washing solution and pat the ELISA plate dry on absorbent paper. Repeat the washing process three times.

[0125] (6) Add enzyme conjugate working solution: After the ELISA plate is dried, add 100 μL of the pre-prepared enzyme conjugate working solution to each well, cover with a sealing film, and incubate at 37°C for 30 min.

[0126] (7) Adding substrate: After washing the plate, add 90 μL of substrate to each well, cover with sealing film and incubate at 37°C for 15 min.

[0127] (8) Add stop solution: Take out the ELISA plate, add 50 μL of stop solution to each well, measure the OD value of each well at a wavelength of 450 nm on an ELISA reader, and calculate the sample concentration.

[0128] 10. Statistical methods

[0129] SPSS 25.0 software was used for statistical analysis, and GraphPad Prism 8.3 software was used for graphics. Indicates; independent sample t test was used to compare the data between two groups; one-way ANOVA was used to compare the data among multiple groups. P<0.05 indicates that the difference is statistically significant.

[0130] 2. Results

[0131] 1. Expression of MSTRG 88917.16 in Hcy-treated macrophages

[0132] High-throughput sequencing analysis of Hcy-intervention macrophages revealed a new highly expressed LncRNA, numbered MSTRG 88917.16, and its nucleotide sequence is shown in SEQ ID NO.1:

[0133] GAGACCACAAAATGGCTGCCGGCGGCTTCGTCACGTGACCCCTTTGTGCCTTTCGGGCCCCCGAACTCCGCGGGACCCAGGTCGGGCAGATCCTCACAGCGGAAGACCGGCAGCGGCTTCGAGGCGTCCAGCGCCCGCGCCCGAAACGACAGTTTACTCATCTCAGGCGCAGCAGATACCTCTCCGCTCTGGGGAAACGGCCCCGGCCAGCGGGATCATGGAGAACCGGAGTTTCGGTCTCCACTCGCCTGCCGCTGCCGGGGACTTGGGGGCGGAGCGCAAAGCCCGCCGTCCGGGCCCTGACACCAGCCGGGAGGGTGGGAGGCTGTGCCGCTCCGCGCCTCGCTCACTCGCTCTCTTCAATACGCCATGGCCAACATGGCGGACATTAAAACTCCACTGTGCGCTCTTCAGCCAACCCCAGCCATTCCCCACACTGCATCGCGCAGCGACGCGGGCACGCCCGGGGGGAGCGCGGGCTCGAGCGGGCGCCGGCGCGGCGCGGCATGGAGCCCGCGTCCCGCCAACCCCCGGCCCGCCGGCCGCCGGCCTCGCCCGCCCGCTCCGCCCGGCCGCCTCGCTTCCCGCCCTGCGCGGTGCTCAAGCGAGGGAGCGACGAGCTCGGCGCCCGCGCGGGCCCTGGGAAGGCCGGCGCGTAGAGCGGCTGGGA。

[0134] The above LncRNA is LncRNAEFRL, simply abbreviated as EFRL.

[0135] The sense strand primer of LncRNAEFRL is shown as SEQ ID NO.2:

[0136] 5′-TCCTTGTTCGGGGTTTGAGG-3′,

[0137] The antisense strand primer of LncRNAEFRL is shown as SEQ ID NO.3:

[0138] 5′-ACAGCACCCTGACTACAAGC-3.

[0139] The sense strand of the internal reference primer sequence of GADPH is shown as SEQ ID NO.4

[0140] 5′-ACCCAGAAGACTGTGGAGG-3′

[0141] The antisense strand of the GADPH internal reference primer sequence is shown in SEQ ID NO.5:

[0142] 5′-TTCTAGACGGCAGGTCAGGT-3′.

[0143] The expression level of MSTRG 88917.16 in macrophages was verified by qRT-PCR. Figure 1 shown.

[0144] Figure 1 The results showed that compared with the Control group, the expression level of MSTRG 88917.16 in the Hcy intervention group was increased.

[0145] The above results showed that MSTRG 88917.16 was highly expressed in Hcy-intervened macrophages.

[0146] 2. UCSC, CPAT and CPC analysis MSTRG.88917.16

[0147] The conservation of MSTRG.88917.16 in different species was analyzed using UCSC Genome Browser. The sequence analysis showed that MSTRG.88917.16 was located on chromosome 18 (q, A1) and was highly conserved among different species. It was known that LncRNA HOTAIR did not have the ability to encode proteins. GAPDH was a protein-encoding gene. The coding potential tools CPAT and CPC were used to analyze the protein-encoding ability of MSTRG.88917.16. The analysis showed that MSTRG.88917.16 did not have the ability to encode proteins. There is evidence that LncRNA can encode micropeptides through open reading frames (ORFs). Therefore, we queried the UniProtKB and Swiss-Port databases to evaluate the ORF of MSTRG.88917.16. The analysis results are as follows: Figure 2 shown.

[0148] Figure 2 The results showed that the five ORFs of MSTRG.88917.16 were all less than 200 bp, and no similar proteins were found in the database, indicating that it did not have the ability to encode proteins.

[0149] 3. GO and KEGG analysis MSTRG.88917.16

[0150] To analyze the biological function and potential mechanism of MSTRG.88917.16 in atherosclerosis, GO and KEGG were used to perform biological function enrichment analysis on the target genes of MSTRG.88917.16. Figure 3 shown.

[0151] Figure 3 The results showed that the target genes of MSTRG.88917.16 were mainly involved in sodium ion transport, endoplasmic reticulum membrane components, and protein transmembrane transport in macrophages, indicating that the target genes of MSTRG.88917.16 were involved in the metabolic process of certain biological macromolecules; the KEGG analysis results showed that the main enrichment pathways of the target genes of MSTRG.88917.16 were glycine and serine metabolism, GnRH, Apelin signaling pathways, etc., and were significantly enriched in endocytosis, indicating that MSTRG.88917.16 may be involved in the Hcy-induced macrophage phagocytosis process. Combined with the subsequent experimental results, MSTRG.88917.16 was named EFRL (EfferocytosisRelatived LncRNA, endocytosis-related LncRNA).

[0152] 4. RNA-FISH and nuclear-cytoplasmic separation experiments to detect the localization of EFRL in macrophages

[0153] RNA-FISH experiments were used to detect that EFRL was mainly distributed in the nucleus of macrophages; nuclear-cytoplasmic separation combined with qRT-PCR was used to detect the expression of EFRL in the cytoplasm and nucleus. Figure 4 shown.

[0154] Figure 4 The results showed that EFRL was concentrated in the nucleus of macrophages.

[0155] 5. Construction of EFRL knockdown model

[0156] Two locked nucleotides (LNA GapmeRs) were designed based on the EFRL sequence, and a normal control group (Control), an interference control group (LNA-NC group), an EFRL interference group 1 (LNA-EFRL-1 group), and an EFRL interference group 2 (LNA-EFRL-2 group) were set up. The interference efficiency was verified by qRT-PCR. The results are shown in Figure 5 shown.

[0157] Figure 5The results showed that compared with the Control group, there was no difference in expression in the LNA-NC group; compared with the LNA-NC group, the expression levels of the LNA-EFRL-1 group and the LNA-EFRL-2 group were reduced, among which the expression level of the LNA-EFRL-2 group decreased most significantly (P < 0.01), indicating that the EFRL knockdown model was successfully constructed and LNA-EFRL-2 was used for subsequent experiments.

[0158] 6. Flow cytometry to detect apoptosis rate of Jurkat cells

[0159] To explore the effect of EFRL on macrophage efferocytosis, we first determined the time of inducing apoptosis in Jurkat cells. The results of flow cytometry were as follows: Figure 6 shown.

[0160] Figure 6 The results showed that compared with the control group (0 min), the cell apoptosis rate in the apoptosis induced group (15 min, 30 min) was increased (P < 0.01); there was no statistically significant difference between the 15 min and 30 min groups, so the subsequent experiments chose to irradiate for 15 min to induce apoptosis of Jurkat cells.

[0161] 7. Effect of EFRL knockdown on macrophage efferocytosis

[0162] Jurkat cells were irradiated with ultraviolet light to induce apoptosis and labeled with PKH26. Hcy-intervention macrophages were co-cultured with apoptotic Jurkat cells to conduct an in vitro macrophage burial experiment. Fluorescence microscopy showed that compared with the Hcy+LNA-NC group, the number of free apoptotic cells in the Hcy+LNA-EFRL group decreased, the number of phagocytosed apoptotic cells increased, and the burial effect was enhanced; PKH26-labeled apoptotic Jurkat cells were co-cultured with F4 / 80-labeled macrophages, and the in vitro burial effect was detected using a laser confocal microscope. The results showed that compared with the Hcy+LNA-NC group, the number of apoptotic cells phagocytosed by macrophages in the Hcy+LNA-EFRL group increased, indicating that downregulating EFRL can alleviate the inhibition of Hcy on macrophage burial; the content of inflammatory factors in each group was detected by ELISA, and the results are as follows Figure 7 shown.

[0163] Figure 7 The results showed that compared with the Control group, the levels of inflammatory factors IL-1β and IL-18 in the Hcy intervention group were increased; compared with the Hcy+LNA-NC group, the levels of inflammatory factors IL-1β and IL-18 in the Hcy+LNA-EFRL group were decreased.

[0164] These results indicate that knockdown of EFRL promotes macrophage efferocytosis and inhibits inflammatory response.

[0165] 8. SPAST expression level in Hcy-treated macrophages

[0166] To explore how EFRL plays a role in macrophage efferocytosis, sequencing results revealed that SPAST is a target gene of EFRL. qRT-PCR was used to detect Hcy-intervention macrophages. The results showed that compared with the Control group, the expression level of SPAST in the Hcy group was increased. Figure 8 shown.

[0167] 9. Effect of knockdown of EFRL on the expression of downstream target gene SPAST

[0168] qRT-PCR was used to detect the expression level of SPAST in macrophages after transfection with EFRL GapmeRs. Fig. 9 shown.

[0169] Fig. 9 The results showed that compared with the Control group and the Hcy+LNA-NC group, the expression level of SPAST in the Hcy+LNA-EFRL group was decreased, suggesting that EFRL may play a role in Hcy-mediated macrophage efferocytosis by regulating the downstream target gene SPAST.

[0170] In summary, the above experimental results show that knocking down EFRL promotes macrophage occlusion, which may be through regulating the expression of the downstream target gene SPAST.

[0171] The present invention focuses on the key biological molecule LncRNA EFRL. Studies have found that in homocysteine-induced atherosclerosis, the expression level of LncRNA EFRL will undergo specific and significant changes. Through advanced molecular biology techniques, we can detect the content of LncRNA EFRL in biological samples (such as blood, tissue fluid, etc.). Based on this, the present invention provides LncRNA EFRL for preparing a product for diagnosing homocysteine-induced atherosclerosis, and using real-time fluorescence quantitative PCR technology, LncRNA EFRL in the sample can be accurately quantified in a short time. Compared with traditional detection methods, this detection method based on LncRNA EFRL has higher sensitivity and specificity, which solves the problems of difficulty in early diagnosis of homocysteine-induced atherosclerosis in the prior art, lack of specificity and sensitivity of markers.

[0172] It should be noted that when the present invention involves a numerical range, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0173] Although preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they understand the basic inventive concepts, and all such changes and modifications fall within the scope of the present invention.

Claims

1. LncRNAEFRL is used in the preparation of a product for diagnosing and / or treating homocysteine-induced atherosclerosis, characterized in that: The nucleotide sequence of the LncRNAEFRL is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The product includes a kit or a medicament.

3. The use according to claim 2, characterized in that: The drug is used for regulating the expression of the downstream target gene SPAST in the early diagnosis or detection of homocysteine-induced atherosclerosis.

4. A drug for treating homocysteine-induced atherosclerosis, characterized in that: The drugs include any one or more of the following: The LncRNAEFRL according to claim 1; A recombinant vector containing the coding gene of the LncRNAEFRL; A recombinant virus containing the coding gene of the LncRNAEFRL; A recombinant viral vector containing the coding gene of the LncRNAEFRL; The nucleotide sequence of the LncRNAEFRL is shown in SEQ ID NO.

1.

5. The drug according to claim 4, characterized in that The drug also includes a pharmaceutically acceptable carrier; The carrier includes any one or more of chitosan, cholesterol, liposome and nanoparticle.

6. A kit for diagnosing homocysteine-induced atherosclerosis using LncRNAEFRL as a marker, characterized in that: The kit comprises a specific primer pair for detecting the expression amount of the LncRNA EFRL according to claim 1; the upstream and downstream base sequences of the specific primer pair for detecting the expression amount of the LncRNA EFRL are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

7. The kit according to claim 6, characterized in that Also included are locked nucleotide LNA GapmeRs.

8. The kit according to claim 6, characterized in that Also included are transfection aids; The transfection aid reagent is Lipofectamine 2000.

9. The kit according to claim 6, characterized in that Universal primer pairs for quantification of internal reference genes are also included; The internal reference gene is the GAPDH gene.

10. The kit according to claim 9, characterized in that The upstream and downstream base sequences of the universal primer pair for quantification of the internal reference gene are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

Images