Mealybug insect detection method

Abstract

The invention relates to a mealybug insect detection method. The detection method comprises the following step: detecting mealybug insects by adopting one or more of 1-1 group, 2-1 group and 3-3 group of primer groups. The detection method provided by the invention can be used for carrying out single or multiple detection on papaya mealybug, ocean mealybug gluteus and south ocean mealybug gluteus, and has the advantages of accuracy, rapidness, good specificity, high sensitivity, absolute quantification and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of quarantine, and in particular relates to a method for detecting mealybug insects. Background Art

[0002] There are many species of mealybugs, including 266 genera and about 2,000 species, according to Scale Net. These pests have the characteristics of fast reproduction, strong adaptability, and piercing and sucking damage by nymphs and adults. They mainly parasitize on fruit stalks and pedicles, easily evade customs inspections, and enter the country through trade. They are the quarantine pests that my country focuses on for inbound fruit products.

[0003] Papaya mealybug Paracoccus marginatus Williams and Granara de Willink, also known as papaya mealybug, belongs to the Hemiptera order, Sternorrhyncha family, Pseudococcidae, and is an important agricultural and forestry pest. The insect is native to Mexico, Belize, Guatemala, Costa Rica and other countries in Central America. It spread to the Caribbean in the 1990s and had a huge impact on the local papaya industry. At present, it has also been found in Taiwan and Guangzhou, my country, and special vigilance and prevention of its spread and outbreak are needed.

[0004] The ocean mealybug Planococcus minor is one of the pests listed in the List of Quarantine Pests for Plants Entering the People's Republic of China. It is currently distributed in China, India, Thailand, the Philippines, Bangladesh, Fiji, Malaysia, Australia, Samoa, Papua New Guinea, Tonga, tropical Africa, etc. There are more than 250 host plants, mainly guava, citrus, mangosteen, cherry, banana, grape, mango, durian, coffee, cocoa, soybean, corn, potato, ornamental flowers and plants, etc.

[0005] The South Sea mealybug (Planococcus lilacinus Cockerell) belongs to the genus Planococcus, Pseudococcidae, Trabutininae, Hemiptera, also known as purple mealybug, purple mealybug, South Sea thorn mealybug, coffee mealybug, cocoa mealybug and oriental cocoa mealybug, etc. It was first discovered in Thailand, Cambodia and the Philippines, and has now spread to more than 30 countries on all continents around the world. The insect has a wide range of hosts, including more than 100 kinds of fruits and garden plants in 35 families, including pitaya, cocoa, durian, banana, American kapok and small-leaved fig.

[0006] The morphological characteristics of the above three mealybugs are similar to those of their related species, especially when they occur in the larval state, which makes it more difficult to identify them accurately, effectively, quickly and absolutely quantitatively. Summary of the invention

[0007] In view of the problems existing in the prior art, the present invention provides a method for detecting mealybugs. The detection method provided by the present invention can perform single or multiple detection on papaya mealybugs, oceanic mealybugs, and southern mealybugs, and has the advantages of accuracy, rapidity, good specificity, high sensitivity, absolute quantification, etc.

[0008] The technical solution of the present invention to solve the above technical problems is as follows:

[0009] The present invention provides a primer set for detecting mealybug insects, including one or more of the following: 1-1 group, 2-1 group, and 3-3 group;

[0010] Group 1-1: upstream primer is GGACATCCTGAAGTTTAC; downstream primer is GCTCAAACAATAAATCCTAAA; probe is CCAGGATTTGGTGCAATATCACAA;

[0011] Group 2-1: the upstream primer is ACTGGAATTATTTTATCAAATTC; the downstream primer is CTCCCTATAGATAATACATAATGAA; the probe is CATGATACATATTTCGTTGTAGCTCAT;

[0012] Group 3-3: the upstream primer is ACAGGTATTATTTTATCTAATTCA; the downstream primer is ACTCCTATAGATAAAACATAATG; the probe is ACATGATACTTATTTTGTTGTAGCAC.

[0013] The specific digital PCR primers and probes designed by the present invention have the advantages of good stability, good specificity, accuracy, rapidity, high sensitivity, and absolute quantification, and can be used for port laboratory detection of insects that are difficult to morphologically identify and may be carried by imported fruits and seeds, and the accurate identification time can be shortened to 1-1.5 hours. Single or multiple detection can be performed on papaya mealybugs, oceanic mealybugs, and southern mealybugs, and has the advantages of accuracy, rapidity, good specificity, high sensitivity, and absolute quantification.

[0014] Furthermore, the probes in group 1-1 are labeled with a FAM group and a BHQ1 group.

[0015] Furthermore, the probes in group 2-1 are labeled with a HEX group and a BHQ1 group.

[0016] Furthermore, the probes in group 3-3 are labeled with a Cy5 group and a BHQ2 group.

[0017] The probes having the above groups can be used for qPCR or ddPCR detection.

[0018] The invention provides a kit for detecting mealybug insects, and the kit comprises the primer set.

[0019] Furthermore, the kit also includes one or more of an enzyme for amplification, sodium fluorescein, a negative control, and a positive control.

[0020] The kit provided by the present invention can perform single or multiplex detection on P. papaya, P. oceanicae, and P. australis, and has the advantages of accuracy, rapidity, good specificity, high sensitivity, absolute quantification, and the like.

[0021] The invention provides a method for detecting mealybugs, comprising the following steps: using one or several primer groups among the above-mentioned 1-1 group, 2-1 group and 3-3 group to detect mealybugs.

[0022] Furthermore, ddPCR was used to detect mealybug insects.

[0023] ddPCR can be called droplet digital PCR, which can achieve absolute quantitative detection of nucleic acid molecules.

[0024] Furthermore, the reaction procedure included: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 10 s, annealing at 58°C for 30 s, and 45 cycles.

[0025] The invention provides a method for detecting mealybug insects, comprising the following steps: using the above-mentioned kit to detect mealybug insects.

[0026] Furthermore, ddPCR was used to detect mealybug insects.

[0027] Furthermore, the reaction procedure included: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 10 s, annealing at 58°C for 30 s, and 45 cycles.

[0028] The detection method provided by the present invention is a multiplex digital PCR detection technology for important microscopic insects, which can be used to detect papaya mealybug, oceanic mealybug, and south-sea mealybug, and has the advantages of accuracy, rapidity, good specificity, high sensitivity, and absolute quantification. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is a map for sequence comparison analysis after sequencing.

[0030] Figure 2Design software parameter settings for primers and probes.

[0031] Figure 3 Bioinformatic validation of primer and probe specificity was performed.

[0032] Figure 4 It is a one-dimensional graph of the specific detection of papaya mealybug single digital PCR; wherein, label 1 is papaya mealybug (sequence number 1 in Table 1), label 2 is papaya mealybug (sequence number 2 in Table 1), label 3 is Nanyang hip-line mealybug (sequence number 7 in Table 1), label 4 is Nanyang hip-line mealybug (sequence number 8 in Table 1), label 5 is ocean hip-line mealybug (sequence number 4 in Table 1), label 6 is ocean hip-line mealybug (sequence number 5 in Table 1), label 7 is new pineapple gray mealybug (sequence number 10 in Table 1), and label 8 is new pineapple gray mealybug (sequence number 11 in Table 1).

[0033] Figure 5 It is a one-dimensional graph of the single-plex digital PCR specific detection of the oceanic mealybug; wherein, label 1 is the oceanic mealybug (sequence number 5 in Table 1), label 2 is the oceanic mealybug (sequence number 6 in Table 1), label 3 is the South China mealybug (sequence number 7 in Table 1), label 4 is the South China mealybug (sequence number 9 in Table 1), label 5 is the papaya mealybug (sequence number 1 in Table 1), label 6 is the papaya mealybug (sequence number 2 in Table 1), label 7 is the new pineapple gray mealybug (sequence number 10 in Table 1), and label 8 is the new pineapple gray mealybug (sequence number 12 in Table 1).

[0034] Figure 6 It is a one-dimensional graph of the single-plex digital PCR specific detection of the Nanyang hip mealybug; among them, label 1 is the Nanyang hip mealybug (sequence number 8 in Table 1), label 2 is the Nanyang hip mealybug (sequence number 9 in Table 1), label 3 is the ocean hip mealybug (sequence number 5 in Table 1), label 4 is the ocean hip mealybug (sequence number 6 in Table 1), label 5 is the papaya mealybug (sequence number 2 in Table 1), label 6 is the papaya mealybug (sequence number 3 in Table 1), label 7 is the new pineapple gray mealybug (sequence number 11 in Table 1), and label 8 is the new pineapple gray mealybug (sequence number 12 in Table 1).

[0035] Figures 7 to 10 In the figure, the detection channels for P. papaya, P. oceanicae and P. australis are FAM (blue), HEX (green) and Cy5 (red), respectively.

[0036] Figure 7 Optimizing one-dimensional primers and probes for multiplex ddPCR Figure 1 Dimensional chart; among them, 1 and 2: 20μmol / L, 3 and 4: 15μmol / L, 5 and 6: 10μmol / L, 7 and 8: 5μmol / L.

[0037] Figure 8It is a one-dimensional graph of multiple ddPCR specific detection; wherein, label 1 and label 2 are the mixture of genomic DNA of three mealybugs, in which the sum of the DNA concentrations of papaya mealybug (sequence number 1 in Table 1), South China hip pattern mealybug (sequence number 7 in Table 1) and ocean hip pattern mealybug (sequence number 4 in Table 1) is 10 ng / μL, and the mass ratio of papaya mealybug DNA, South China hip pattern mealybug DNA and ocean hip pattern mealybug DNA is 1:1:1; label 3 is the new pineapple gray mealybug (Table 1 The number 10 in Table 1) is genomic DNA (10 ng / μL); the number 4 is genomic DNA (10 ng / μL) of Jackbell's mealybug (sequence number 13 in Table 1); the number 5 is genomic DNA (10 ng / μL) of Hibiscus syringae (sequence number 14 in Table 1); the number 6 is genomic DNA (10 ng / μL) of Conysella koningii (sequence number 15 in Table 1); the number 7 is genomic DNA (10 ng / μL) of Glandularia sphaerocephala (sequence number 16 in Table 1); the number 8 is dd H2O.

[0038] Fig. 9 This is a one-dimensional graph of multiplex ddPCR sensitivity detection; among them, 1 and 2: 10.0 ng / μL, 3 and 4: 1.0 ng / μL, 5 and 6: 0.1 ng / μL, 7 and 8: 10 pg / μL, 9 and 10: 1.0 pg / μL, 11 and 12: 0.1 pg / μL.

[0039] Fig.10 Multiplex qPCR sensitivity amplification curve; from left to right, 1-2: 10.0 ng / μL, 3-4: 1.0 ng / μL, 5-6: 0.1 ng / μL, 7-8: 10 pg / μL, 9-10: 1.0 pg / μL.

[0040] Fig.11 is the linear correlation of multiple ddPCR detection; among them, A is the papaya mealybug, B is the oceanic mealybug, and C is the southwestern mealybug. DETAILED DESCRIPTION

[0041] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0042] Unless otherwise specified, the experimental methods used in the present invention are all conventional methods in the art; the materials, reagents, methods and instruments used are all conventional materials, reagents, methods and instruments in the art, and those skilled in the art can obtain them through commercial channels or prepare them by conventional methods.

[0043] Reagents: TIANamp Micro DNA Kit micro-sample genomic DNA extraction kit (centrifugal column type) (DP316); 5*PerfeCTa Multiplex qPCR ToughMix (Eppeby, 95147); Fluorescein sodium salt (Eppeby, 95147); Sapphire Chip (Stilla Technologies, France); 10× buffer purchased from Sangon Biotech (Shanghai), catalog number B600001; dNTP Mixture purchased from Sangon Biotech (Shanghai), catalog number A610056; Taq enzyme purchased from Sangon Biotech (Shanghai), catalog number B600001.

[0044] The primers involved in the present invention were all synthesized by Shanghai Jierui Bioengineering Co., Ltd.

[0045] Equipment: high-speed refrigerated centrifuge (Eppendorf, Germany), NanoDrop1000 micro-volume UV spectrophotometer (Thermo Fisher Scientific, USA); Fully automatic microdroplet chip microdroplet digital PCR system (Stilla Technologies, France), real-time fluorescence PCR (Bio-Rad, USA, CFX96), pipette (Eppendorf, Germany), etc.

[0046] Test samples: The list of test insects is shown in Table 1. The test insects can be obtained by the public and can be used only for non-commercial purposes to repeat the embodiments recorded in the present invention.

[0047] Table 1 List of mealybug insects tested

[0048]

[0049]

[0050] The following is an introduction through specific embodiments.

[0051] Example 1 Verification of test insects

[0052] The target test samples introduced in the present invention have all been verified by sequencing and can be used for subsequent experiments.

[0053] Traceability identification: The universal primers (Pco-F and Lep-Rl) of the COⅠ gene of mealybugs were used to perform PCR amplification on the target insects, and the sequence comparison method was used to trace the source and determine the accurate classification of the test targets.

[0054] Pco-F: 5'-CCTTCAACTAATCATAAAAATATYAG-3' (SEQ ID NO: 1);

[0055] Lep-Rl: 5'-TAAACTTCTGGATGTCCAAAAAATCA-3' (SEQ ID NO: 2).

[0056] The 25μL PCR amplification system includes: RNase Free dH2O 17.25μL, 10× buffer 2.5μL, dNTPMixture 2μL, Taq enzyme 0.25μL, upstream primer Pco-F (concentration is 10μM) 1μL, downstream primer Lep-Rl (concentration is 10μM) 1μL, Template 1μL.

[0057] The reaction conditions were as follows: 95°C for 2 minutes; 94°C for 40 seconds, 45°C for 40 seconds, 72°C for 70 seconds, 5 cycles; 94°C for 40 seconds, 51°C for 40 seconds, 72°C for 70 seconds, 40 cycles; 72°C for 5 minutes, and stored at 4°C.

[0058] The universal primers Pco-F / Lep-R1 of COⅠ gene were used to amplify and sequence the P. papaya, P. oceanicae and P. australis. The obtained sequences were compared in Genbank. The results are as follows: Figure 1 shown. Figure 1 In the table, Mg1 corresponds to sequence number 1 in Table 1, Mg2 corresponds to sequence number 2 in Table 1, Mg3 corresponds to sequence number 3 in Table 1, D1 corresponds to sequence number 4 in Table 1, D2 corresponds to sequence number 5 in Table 1, D3 corresponds to sequence number 6 in Table 1, N1 corresponds to sequence number 7 in Table 1, N2 corresponds to sequence number 8 in Table 1, N3 corresponds to sequence number 9 in Table 1, b1 corresponds to sequence number 10 in Table 1, b2 corresponds to sequence number 11 in Table 1, and b3 corresponds to sequence number 12 in Table 1. The results showed that the three target objects, Papaya mealybug, Oceanic mealybug and South China mealybug, had similarities of 100%, 99.54% and 99.22% with Papaya mealybug (No.ON811688.1), Oceanic mealybug (No.KY211605.1) and South China mealybug (No.KU254159.1) in NCBI, respectively, indicating that the target objects were correct.

[0059] Example 2 Design of specific primers and probes

[0060] Based on the sequence comparison analysis in Genbank, high-specificity genes were selected for the design of real-time fluorescence PCR primers and probes for three targets (Papaya mealybug, Oceanic mealybug, and South China mealybug) according to the genetic distance within and between species. Beacon Designer 8 software was used to screen primers and probes with higher scores by setting different parameters ( Figure 2The primers and probes designed by the software were validated by bioinformatics for specificity ( Figure 3 ). Real-time fluorescence PCR primers and probes were synthesized by Shanghai Jierui Bioengineering Co., Ltd. The probe used to detect P. papaya was labeled with a FAM group and a BHQ1 group, the probe used to detect P. oceanicae was labeled with a HEX group and a BHQ1 group, and the probe used to detect P. australis was labeled with a Cy5 group and a BHQ2 group.

[0061] Table 2 Specific primers and probes for three target insects

[0062]

[0063]

[0064] Example 3 Establishment of single-plex digital PCR specific detection system and sensitivity detection

[0065] The single-plex ddPCR systems of P. papaya, P. oceanicae and P. australis were constructed respectively.

[0066] The ddPCR amplification system (25 μL) includes: 5*PerfeCTa Multiplex qPCR ToughMix 5.0 μL, Fluorescein sodium salt 1.0 μL, Template DNA (DNA concentration is 10 ng / μL) 2.0 μL, Forward Primer (10 μM) 2.5 μL, Reverse Primer (10 μM) 2.5 μL, Probes (10 μM) 0.625 μL, and ddH2O 11.375 μL.

[0067] use Single-plex ddPCR amplification was performed using a fully automated droplet chip droplet digital PCR system.

[0068] The standard procedure for ddPCR amplification was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 10 s, annealing at 58°C for 30 s, and 45 cycles.

[0069] 3.1 Establishment of single-plex digital PCR system and specificity screening for Papaya mealybug

[0070] The two designed primer and probe combinations (serial number 1-1 and serial number 1-2) were preliminarily verified, and the ddPCR amplification system and amplification procedure were referred to the above method. The results showed that only the serial number 1-1 primer and probe combination had good specificity for papaya mealybug, and could specifically detect papaya mealybug in target species such as oceanic mealybug, papaya mealybug, southern mealybug, and new pineapple gray mealybug ( Figure 4); while the primer and probe combination of sequence number 1-2 will produce papaya mealybug amplification droplets, it will also amplify the new pineapple gray mealybug and the ocean hip pattern mealybug, and it is impossible to achieve specific detection of papaya mealybug.

[0071] 3.2 Establishment of single-plex digital PCR system and specificity screening for P.

[0072] The designed primer and probe combination (group 2-1) was preliminarily verified. The ddPCR amplification system and amplification procedure were referred to the above method. The results are as follows: Figure 5 As shown, the primer and probe combination of sequence number 2-1 has good specificity for the oceanic mealybug, and can specifically detect the oceanic mealybug in target species such as the oceanic mealybug, the southern oceanic mealybug, the new pineapple gray mealybug, and the papaya mealybug.

[0073] 3.3 Establishment of single-plex digital PCR system and specificity screening for P. nanyangensis

[0074] The three designed primer and probe combinations (No. 3-1, No. 3-2, and No. 3-3) were preliminarily verified. The ddPCR amplification system and amplification procedure were referred to the above method. The results showed that only the primer and probe combination No. 3-3 had good specificity for the South Sea hip stripe mealybug, and could specifically detect the South Sea hip stripe mealybug in target species such as the South Sea hip stripe mealybug, the ocean hip stripe mealybug, the new pineapple gray mealybug, and the papaya mealybug. Figure 6 ); while the primers and probes of groups 3-1 and 3-2 produce droplets for the amplification of the mealybug Psoralea nanyangensis, they also amplify the new pineapple mealybug and papaya mealybug, making it impossible to achieve specific detection of the mealybug Psoralea nanyangensis.

[0075] Therefore, group No. 1-1, group No. 2-1 and group No. 3-3 are selected for subsequent embodiments.

[0076] Example 4 Specificity verification and optimization of multiplex ddPCR system

[0077] Based on the constructed single-plex ddPCR system, different primer and probe combinations were used to construct multiplex ddPCR systems for P. papaya, P. australis and P. australis. The specificity of the constructed detection system was determined by whether the corresponding target droplets in the one-dimensional spatial map were effectively distinguished and the number of droplets.

[0078] The multiplex ddPCR system included: 5*PerfeCTa Multiplex qPCR ToughMix 5.0μL, Fluorescein sodium salt 1.0μL, Template DNA (10ng / μL) 2.0μL, upstream primers 1-1-F (10μM), 2-1-F (10μM) and 3-3-F (10μM) 2.5μL each, downstream primers 1-1-R (10μM), 2-1-R (10μM) and 3-3-R (10μM) 2.5μL each, probes 1-1-P (20μM), 2-1-P (20μM) and 3-3-P (20μM) 0.625μL each, and ddH2O was used to fill the system to 25μL.

[0079] In the above system, the Template DNA is a mixed solution of papaya mealybug DNA, South Sea mealybug DNA and oceanic mealybug DNA, the sum of the concentrations of papaya mealybug DNA, South Sea mealybug DNA and oceanic mealybug DNA is 10 ng / μL, and the mass ratio of papaya mealybug DNA, South Sea mealybug DNA and oceanic mealybug DNA is 1:1:1.

[0080] The multiplex ddPCR amplification program included: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 10 s, annealing at 58°C for 30 s, and 45 cycles.

[0081] The primer and probe concentrations of the constructed multiplex ddPCR system were optimized, and the primer concentrations in the above system were set to 5μmol / L, 10μmol / L, 15μmol / L, and 20μmol / L, respectively. The probe concentration was the same as the primer concentration, and the rest was referred to the above multiplex ddPCR system. The above multiplex ddPCR amplification program was used for amplification to determine the optimal primer and probe concentrations of the system.

[0082] According to the ddPCR three-channel detection method, the probe used to detect the papaya mealybug was labeled with a FAM group and a BHQ1 group, the probe used to detect the oceanic mealybug was labeled with a HEX group and a BHQ1 group, and the probe used to detect the South China Sea mealybug was labeled with a Cy5 group and a BHQ2 group. Based on the constructed single-plex ddPCR system, different primer and probe combinations were used to construct multiplex ddPCR systems for papaya mealybug, oceanic mealybug, and South China Sea mealybug. Combined with the preparation process of the multiplex detection system, 5, 10, 15, and 20 μmol / L primers and probes were used to optimize the system, and the optimal primer and probe concentrations of the system were determined. The results are shown in the figure. Figure 7 It was shown that when the concentrations of primers and probes were both 5 μmol / L, the positive target droplet clusters were relatively concentrated, and the distinction between positive and negative droplets was more obvious, which was the optimal primer and probe concentration.

[0083] Through the optimization of the multiplex ddPCR system, it was finally determined that its reaction procedure was the same as that of the single-plex ddPCR. The optimized multiplex ddPCR system was: 5*PerfeCTa Multiplex qPCR ToughMix 5.0μL, Fluorescein sodium salt 1.0μL, Template DNA (10ng / μL) 2.0μL, Forward Primer (5μM) 2.5μL each, Reverse Primer (5μM) 2.5μL each, Probes (5μM) 0.625μL each, and ddH2O was used to fill the system to 25μL.

[0084] Forward Primer (5 μM) 2.5 μL each refers to the upstream primers 1-1-F (5 μM), 2-1-F (5 μM), and 3-3-F (5 μM) 2.5 μL each;

[0085] Reverse Primer (5 μM) 2.5 μL each refers to the downstream primers 1-1-R (5 μM), 2-1-R (5 μM) and 3-3-R (5 μM) 2.5 μL each;

[0086] Probes (5 μM) 0.625 μL each refers to probes 1-1-P (5 μM), 2-1-P (5 μM) and 3-3-P (5 μM) 0.625 μL each.

[0087] The multiplex ddPCR amplification program included: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 10 s, annealing at 58°C for 30 s, and 45 cycles.

[0088] The specificity verification was performed using the above system and procedures. The results are as follows Figure 8 As shown, multiplex ddPCR confirmed that all three mealybugs had corresponding positive droplets, while the results of the negative control and blank control showed no amplification, that is, there was no specific amplification of non-target insects, indicating that the three groups of primer probes selected by the present invention (group No. 1-1, group No. 2-1, group No. 3-3) have good specificity and will not produce cross reactions.

[0089] Example 5 Quantitative linear correlation and repeatability analysis of multiplex ddPCR system

[0090] A solution containing the genomic DNA of Papaya mealybug, a solution containing the genomic DNA of South China hip-line mealybug and a solution containing the genomic DNA of Ocean hip-line mealybug were mixed to obtain a DNA mixture, in which the sum of the concentrations of the genomic DNA of Papaya mealybug, South China hip-line mealybug and Ocean hip-line mealybug was 10 ng / μL, and the mass ratio of the genomic DNA of Papaya mealybug, South China hip-line mealybug and Ocean hip-line mealybug was 1:1:1. The DNA mixture was diluted 10 times in a gradient manner (10 0 -10 5 A total of 6 gradients). Multiplex ddPCR and multiplex qPCR were used to verify the DNA mixtures of different concentrations.

[0091] Using ddH2O as a blank control, multiple ddPCR amplification was performed to analyze the repeatability and sensitivity of multiple ddPCR detection and the linear correlation of multiple ddPCR detection of three insects, and three replicates were set for each sample. The reaction system refers to the optimized multiple ddPCR system in Example 4, and the reaction procedure refers to the reaction procedure in Example 4. According to the number of droplets and copy numbers obtained by the reaction, the average and relative standard deviation (RSD) of the three replicate copy numbers of the corresponding dilution of each sample were calculated, and RSD ≤ 25% was used as the basis for judging good repeatability.

[0092] Multiplex qPCR amplification was performed using a Bio-Rad CFX96 instrument. The reaction system was: 5*PerfeCTa MultiplexqPCR ToughMix 5.0 μL, Template DNA 2.0 μL, Forward Primer (5 μM) 2.5 μL each, Reverse Primer (5 μM) 2.5 μL each, Probes (5 μM) 0.625 μL each, and ddH2O was used to make up the system to 25 μL.

[0093] Forward Primer (5 μM) 2.5 μL each refers to the upstream primers 1-1-F (5 μM), 2-1-F (5 μM), and 3-3-F (5 μM) 2.5 μL each;

[0094] Reverse Primer (5 μM) 2.5 μL each refers to the downstream primers 1-1-R (5 μM), 2-1-R (5 μM) and 3-3-R (5 μM) 2.5 μL each;

[0095] Probes (5 μM) 0.625 μL each refers to probes 1-1-P (5 μM), 2-1-P (5 μM) and 3-3-P (5 μM) 0.625 μL each.

[0096] The qPCR amplification reaction conditions were as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 10 s, annealing at 58°C for 30 s, and 45 cycles.

[0097] The experimental results are as follows Fig. 9 and Fig.10 As shown, the sensitivity of multiplex ddPCR is the same as that of multiplex qPCR. The minimum detection concentrations of P. papaya and P. oceanica were both 10.0 pg / μL, and the minimum detection concentration of P. australis was 1.0 pg / μL. However, compared with multiplex qPCR, the advantage of multiplex ddPCR is that it can directly perform absolute quantification of copy number.

[0098] A solution containing the genomic DNA of papaya mealybug, a solution containing the genomic DNA of south-sea mealybug and a solution containing the genomic DNA of oceanic mealybug were mixed to obtain a DNA mixed solution, in which the sum of the concentrations of the genomic DNA of papaya mealybug, the genomic DNA of south-sea mealybug and the genomic DNA of oceanic mealybug was 10 ng / μL, and the mass ratio of the genomic DNA of papaya mealybug, the genomic DNA of south-sea mealybug and the genomic DNA of oceanic mealybug was 1:1:1.

[0099] To verify the accuracy of the constructed multiplex ddPCR detection system for absolute quantification of the copy number of equal-proportion mixtures of genomic DNA of three mealybug species, the above DNA mixture (10 ng / μL) was subjected to 10 0 -10 4 The reaction system was diluted and multiple ddPCR amplification was performed. The reaction system was the same as the optimized multiple ddPCR system in Example 4, and the reaction procedure was the same as the reaction procedure in Example 4.

[0100] The linear range of quantitative detection of ddPCR is shown in Table 3. 0 -10 3 During dilution, the mean copy numbers of papaya mealybug multiplex ddPCR amplification were 111.97 copies / μL, 13.60 copies / μL, 1.11 copies / μL, and 0.44 copies / μL, respectively, and the RSDs were all less than 25%, indicating that the multiplex ddPCR system had good repeatability for papaya mealybug detection. 0 -10 4 Linear correlation coefficient R 2 is 0.997, ( Fig.11 A), indicating that the multiplex ddPCR system for papaya mealybug detection has a good linear correlation, and the minimum detection limit of the multiplex ddPCR system for papaya mealybug quantitative detection is 0.44 copies / μL. 0-10 3 During dilution, the mean copy numbers of the multiplex ddPCR amplification of P. rapae were 109.63, 16.23, 2.17, and 0.44 copies / μL, respectively, and the RSDs were all less than 25%, indicating that the multiplex ddPCR system had good repeatability for the detection of P. rapae. 0 -10 3 Linear correlation coefficient R 2 is 0.9978( Fig.11 B), indicating that the multiplex ddPCR system for the detection of oceanic mealybugs has a good linear correlation, and the minimum detection limit of the multiplex ddPCR system for the quantitative detection of oceanic mealybugs is 0.44 copies / μL. 0 -10 4 During dilution, the mean copy numbers of the multiplex ddPCR amplification of P. nanyangensis were 498.70, 91.07, 11.10, 3.07, and 0.43 copies / μL, respectively, and the RSDs were all less than 25%, indicating that the multiplex ddPCR system had good repeatability for the detection of P. nanyangensis. 0 -10 4 Linear correlation coefficient R 2 is 0.9961( Fig.11 C), indicating that the multiplex ddPCR system for the detection of P. nanyangensis had a good linear correlation, and the minimum detection limit of the multiplex ddPCR system for the quantitative detection of P. nanyangensis was 0.43 copies / μL.

[0101] Table 3 Quantitative detection linear range of multiplex ddPCR

[0102]

[0103] If the amplification product is sequenced and compared with the GeneBank sequence after amplification with the COI gene universal primer, whether it is the target organism is determined based on the similarity of the comparison. However, by using the methods of Examples 2 to 5, the detection result can be directly determined in real time based on whether there is droplet amplification and absolute quantitative determination.

[0104] The present invention currently collects three targets of papaya mealybug, oceanic mealybug, and southern hip mealybug from different sources, 3 species each, a total of 9 species (Table 1), after morphological and genomic characteristics identification, the accuracy of the test targets is clarified, and further experiments can be carried out. Subsequently, sequence alignment and specific primers and probes were designed using tools such as mega6 and Genbank, and the effectiveness of primer pairs was initially verified using the PCR method. Specific primers and probes were obtained, and single ddPCR detection systems for three mealybugs were constructed respectively. On this basis, through the optimization of primer and probe concentrations, a multiplex ddPCR detection system that can quickly and absolutely quantitatively detect the genome copy number of papaya mealybug, oceanic mealybug, and southern hip mealybug in the same reaction system is constructed. The results showed that after the three mealybug DNA samples were mixed, each set of primers and probes in the multiplex ddPCR system could amplify the target mealybugs without cross-reaction, and the lowest DNA concentration detection concentration was consistent with that of qPCR; the absolute quantitative detection limit of papaya mealybug was 0.44 copies / μL, the absolute quantitative detection limit of oceanic mealybug was 0.44 copies / μL, and the absolute quantitative detection limit of South China mealybug was 0.43 copies / μL. The linear correlation coefficient R within the quantitative detection range was 0. 2 All of them were greater than 0.99, with good repeatability. The multiplex ddPCR detection system for the three mealybug species had good linear correlation.

[0105] The method established by the present invention can achieve high-efficiency and high-precision quarantine identification and epidemic monitoring of three common quarantine mealybugs, and provide technical services and support for the prevention and control of foreign pests at ports and the protection of my country's ecological security. The present invention designs specific digital PCR primers and probes, evaluates the stability and specificity of the detection system, and establishes a multiple digital PCR detection technology for important micro-insects, which is used for port laboratory detection of insects that are difficult to morphologically identify and may be carried by imported fruits and seeds, and can shorten the accurate identification time to 1-1.5 hours, achieving the purpose of absolute quantification.

[0106] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for detecting mealybugs, characterized in that: The following steps are involved: One or more primer sets among group 1-1, group 2-1, and group 3-3 are used to detect mealybug insects; Group 1-1: upstream primer is GGACATCCTGAAGTTTAC; downstream primer is GCTCAAACAATAAATCCTAAA; probe is CCAGGATTTGGTGCAATATCACAA; Group 2-1: upstream primer is ACTGGAATTATTTTATCAAATTC; downstream primer is CTCCTATAGATAATACATAATGAA; probe is CATGATACATATTTCGTTGTAGCTCAT; Group 3-3: the upstream primer is ACAGGTATTATTTTATCTAATTCA; the downstream primer is ACTCCTATAGATAAAACATAATG; the probe is ACATGATACTTATTTTGTTGTAGCAC.

2. The method for detecting mealybugs according to claim 1, wherein: The probes in group 1-1 are labeled with a FAM group and a BHQ1 group.

3. A method for detecting mealybugs according to claim 1 or 2, characterized in that: The probes in group 2-1 are labeled with a HEX group and a BHQ1 group.

4. A method for detecting mealybugs according to claim 1 or 2, characterized in that: The probes in group 3-3 are labeled with a Cy5 group and a BHQ2 group.

5. A method for detecting mealybugs according to claim 1 or 2, characterized in that: Insects were detected using ddPCR.

6. The method for detecting mealybugs according to claim 5, wherein: The reaction procedure included: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 10 s, and annealing at 58°C for 30 s, for 45 cycles.

7. A primer set for detecting mealybug insects, characterized in that: Including one or more groups among 1-1 group, 2-1 group, 3-3 group; Group 1-1: upstream primer is GGACATCCTGAAGTTTAC; downstream primer is GCTCAAACAATAAATCCTAAA; probe is CCAGGATTTGGTGCAATATCACAA; Group 2-1: upstream primer is ACTGGAATTATTTTATCAAATTC; downstream primer is CTCCTATAGATAATACATAATGAA; probe is CATGATACATATTTCGTTGTAGCTCAT; Group 3-3: the upstream primer is ACAGGTATTATTTTATCTAATTCA; the downstream primer is ACTCCTATAGATAAAACATAATG; the probe is ACATGATACTTATTTTGTTGTAGCAC.

8. A primer set for detecting mealybugs according to claim 7, characterized in that: The probes in group 1-1 were labeled with a FAM group and a BHQ1 group; the probes in group 2-1 were labeled with a HEX group and a BHQ1 group; and the probes in group 3-3 were labeled with a Cy5 group and a BHQ2 group.

9. A kit for absolute quantitative detection of mealybug insects, characterized in that: Includes the above primer set.

10. The kit according to claim 9, characterized in that It also includes one or more of an enzyme for amplification, sodium fluorescein, a negative control, and a positive control.

Images