Gene and primer probe combination for identifying red bumblebees and application of gene and primer probe combination

Abstract

The invention relates to a gene for identifying bumblebees, a primer probe combination and application thereof, and belongs to the technical field of biological identification. The invention provides an ITS gene for identifying bumblebees. The nucleotide sequence of the ITS gene is as shown in SEQ ID No. 1. The method for identifying the red bumblebees by adopting the primer probe combination for specifically amplifying the ITS gene has high sensitivity, the lowest detection limit is 4.0 copies / mu L, the specificity is good, and no cross reaction with other bumblebees exists.

Description

Technical Field

[0001] The present invention relates to the technical field of biological identification, and in particular to a gene, primer and probe combination for identifying Bombus rubrum and its application. Background Art

[0002] Bumblebees belong to the order Hymenoptera, superfamily Apoidea, family Apidae, genus Bombus. There are about 250 known species in the world. Since the 1980s, they have been widely used for pollination of greenhouse tomatoes, sweet peppers and other plants due to their long and dense hair, long beak, ability to pollinate, strong adaptability to temperature and climate, strong collecting ability, and long pollination period, and have achieved good economic benefits. Currently, three species of bumblebees have been successfully produced commercially, namely Bumblebees ignitus, Bumblebees terrestris and Bumblebees lucorum.

[0003] my country ranks first in the world in the area of ​​greenhouse cultivation of fruits and vegetables, and the application potential of bumblebee pollination is huge. However, my country's bumblebee research and application started late, and currently only stays at the laboratory breeding level. The breeding and application technology of bumblebees has not been systematically mastered. There are problems such as unstable pollination effect, short service life of most bee colonies, and small number of worker bees. Therefore, my country's agricultural pollination bumblebees still rely on foreign imports. Introducing bumblebees from abroad can increase the yield and quality of my country's cash crops and promote the development of my country's agriculture towards ecological agriculture and modern agriculture, but it also brings a series of risks to domestic biosecurity. For example, the ground bumblebee B. terrestris has a fast breeding speed and strong adaptability, which causes serious food competition, reproductive interference and epidemics to local bumblebees in importing countries, resulting in a decrease in the biodiversity of local bumblebees and even destroying the local ecological balance. It has already caused biological invasions in some countries.

[0004] Since there are many species of bumblebees and they are similar in morphology, it is impossible to accurately identify the species of bumblebees from a morphological perspective. Therefore, the front-line quarantine personnel at ports cannot meet the species identification needs of on-site quarantine of imported bumblebees based solely on morphological methods, and there is a risk of the influx of non-permitted harmful species. Therefore, it is urgent to establish a method for identifying red-glowing bumblebees for species identification of imported bumblebees, meet the technical needs of domestic species identification of imported bumblebees, prevent the introduction of foreign harmful organisms causing biological invasions, and protect my country's biodiversity and ecological balance. Summary of the invention

[0005] The purpose of the present invention is to provide a gene, primer probe combination and application thereof for identifying Bombus erythrophilus, so as to solve the problem of lack of a simple and rapid method for identifying Bombus erythrophilus in the prior art.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides an ITS gene for identifying Bombus erythematosus. The nucleotide sequence of the ITS gene is shown in SEQ ID No.1.

[0008] The present invention provides a primer-probe combination for identifying Bombus rubrum, the primer-probe combination comprising a primer pair and a probe;

[0009] The primer pair can specifically amplify the ITS gene, including a forward primer B.ignitus-F and a reverse primer B.ignitus-R;

[0010] The nucleotide sequence of the forward primer B.ignitus-F is shown in SEQ ID No.2;

[0011] The nucleotide sequence of the reverse primer B.ignitus-R is shown in SEQ ID No.3.

[0012] Preferably, the probe is a fluorescent probe B.ignitus-P;

[0013] The nucleotide sequence of the fluorescent probe B.ignitus-P is shown in SEQ ID No.4.

[0014] Preferably, the 5' end of the fluorescent probe B.ignitus-P is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group;

[0015] The fluorescent reporter group is FAM, 6-FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, TAMRA, LC RED640, LC RED705, Quasar705 or Texas Red;

[0016] The fluorescence quenching group is TAMRA, BHQ1, BHQ2, BHQ3, MGB or Dabcy1.

[0017] The present invention provides the use of the primer-probe combination in preparing a product for identifying Bombus erythematosus.

[0018] The invention provides a kit for identifying Bombus rubrum, which comprises the primer-probe combination, PCR buffer, template DNA, DNA polymerase and dNTP.

[0019] The present invention provides a method for identifying red-glowing bumblebee, comprising the following steps:

[0020] (1) Extracting DNA from the sample to be tested;

[0021] (2) using the primer-probe combination to perform PCR amplification on the DNA of the sample to be tested to obtain a PCR amplification product;

[0022] (3) Determine whether the sample to be tested contains the ITS gene based on the PCR amplification product, thereby determining whether it is Bombus erythematosus;

[0023] The primer-probe combination is the primer-probe combination described;

[0024] The ITS gene is the ITS gene described.

[0025] Preferably, the reaction system of the PCR amplification in step (2) is 2×PCR buffer 8-12 μL, MgCl 2 1.0~3.0μL, dNTPs 1.0~2.0μL, forward primer B.ignitus-F 0.2~0.6μL, reverse primer B.ignitus-R 0.2~0.6μL, fluorescent probe B.ignitus-P 0.2~0.6μL, DNA polymerase 0.1~0.9μL, sample DNA 1.0~3.0μL, ddH 2 O 1.8–3.8 μL;

[0026] The MgCl 2 The initial concentration of the dNTPs is 2.0-3.0 mmol / L; the initial concentration of the forward primer B.ignitus-F is 5-15 μmol / L; the initial concentration of the reverse primer B.ignitus-R is 5-15 μmol / L; the initial concentration of the fluorescent probe B.ignitus-P is 5-15 μmol / L; and the initial concentration of the DNA polymerase is 4-6 U / μL.

[0027] Preferably, the reaction procedure of the PCR amplification in step (2) is pre-denaturation at 95° C. for 4 to 6 min; denaturation at 95° C. for 10 to 20 s, annealing at 57 to 61.4° C. for 25 to 35 s, for a total of 40 cycles.

[0028] Preferably, the determination method in step (3) is any one of the following methods:

[0029] (1) Determine the amplification curve of the PCR amplification product. If the amplification curve is an S-shaped curve, it is determined that the sample to be tested contains the ITS gene and is Bombus erythrophilus; if the amplification curve is not an S-shaped curve, it is determined that the sample to be tested does not contain the ITS gene and is not Bombus erythrophilus;

[0030] (2) Determine the Ct value of the PCR amplification product. If the Ct value is ≤34, it is determined that the sample to be tested contains the ITS gene and is Bombus erythrophilus. If the Ct value is >34, it is determined that the sample to be tested does not contain the ITS gene and is not Bombus erythrophilus.

[0031] The present invention has the following technical effects and advantages:

[0032] The present invention provides a gene, a primer-probe combination and an application thereof for identifying Bombus erythrophilus. The present invention provides a gene that can specifically identify Bombus erythrophilus. The present invention also provides a primer-probe combination that can specifically amplify the gene and a method for identifying Bombus erythrophilus, which are used to identify whether the gene is contained in a sample, thereby determining whether it is Bombus erythrophilus. The identification method has high sensitivity, a minimum detection limit of 4.0 copies / μL, good specificity, and no cross reaction with other bumblebees. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 is the real-time fluorescence PCR amplification curve at different annealing temperatures;

[0034] Figure 2 The real-time fluorescence PCR amplification curves of primer-probe combinations with different final concentrations;

[0035] Figure 3 PCR amplification curves of templates with different dilution concentrations;

[0036] Figure 4 This is the regression curve of the PCR amplification standard curve of Bombus erythrorhizium;

[0037] Figure 5 PCR amplification curves of templates with different dilution concentrations;

[0038] Figure 6 is the PCR amplification curve of different test sample DNA;

[0039] Figure 7 Figure 2 shows the PCR amplification curves of 10 bumblebee samples. DETAILED DESCRIPTION

[0040] The present invention provides an ITS gene for identifying Bombus erythematosus, wherein the nucleotide sequence of the ITS gene is shown in SEQ ID No. 1;

[0041] The nucleotide sequence of SEQ ID No. 1 is: AACCGCTGGAATTTGTCGAGATTAGAGGAAACGGCTGTAAGAGACTGA GGACGGGCGTTAAAAATCACCGACGATCGTTCAAAGGATGTCTGGCGT GAG.

[0042] The present invention provides a primer-probe combination for identifying Bombus rubrum, the primer-probe combination comprising a primer pair and a probe;

[0043] The primer pair can specifically amplify the ITS gene, including a forward primer B.ignitus-F and a reverse primer B.ignitus-R;

[0044] The nucleotide sequence of the forward primer B.ignitus-F is shown in SEQ ID No.2;

[0045] The nucleotide sequence of SEQ ID No. 2 is: AACCGCTGGAATTTGTCGAG;

[0046] The nucleotide sequence of the reverse primer B.ignitus-R is shown in SEQ ID No.3;

[0047] The nucleotide sequence of SEQ ID No. 3 is: CTCACGCCAGACATCCTTTG.

[0048] In the present invention, the probe is the fluorescent probe B.ignitus-P;

[0049] The nucleotide sequence of the fluorescent probe B.ignitus-P is shown in SEQ ID No.4;

[0050] The nucleotide sequence of SEQ ID No.4 is: CGCCCGTCCTCAGTCTCTTACAGCC.

[0051] In the present invention, the 5' end of the fluorescent probe B.ignitus-P is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group;

[0052] The fluorescent reporter group is FAM, 6-FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, TAMRA, LC RED640, LC RED705, Quasar705 or Texas Red;

[0053] The fluorescence quenching group is TAMRA, BHQ1, BHQ2, BHQ3, MGB or Dabcy1.

[0054] The present invention provides the use of the primer-probe combination in preparing a product for identifying Bombus erythematosus.

[0055] The invention provides a kit for identifying Bombus rubrum, which comprises the primer-probe combination, PCR buffer, template DNA, DNA polymerase and dNTP.

[0056] The present invention provides a method for identifying Bombus rubrum, comprising the following steps:

[0057] (1) Extracting DNA from the sample to be tested;

[0058] (2) using the primer-probe combination to perform PCR amplification on the DNA of the sample to be tested to obtain a PCR amplification product;

[0059] (3) Determine whether the sample to be tested contains the ITS gene based on the PCR amplification product, thereby determining whether it is Bombus erythematosus;

[0060] The primer-probe combination is the primer-probe combination described;

[0061] The ITS gene is the ITS gene described.

[0062] In the present invention, the reaction system of the PCR amplification in step (2) is 2×PCR buffer 8-12 μL, preferably 10 μL; MgCl 2 1.0~3.0μL, preferably 2μL; dNTPs 1.0~2.0μL, preferably 1.5μL; forward primer B.ignitus-F 0.2~0.6μL, preferably 0.4μL; reverse primer B.ignitus-R 0.2~0.6μL, preferably 0.4μL; fluorescent probe B.ignitus-P 0.2~0.6μL, preferably 0.4μL; DNA polymerase 0.1~0.9μL, preferably 0.5μL; sample DNA to be tested 1.0~3.0μL, preferably 2.0μL; ddH 2 O 1.8-3.8 μL, preferably 2.8 μL;

[0063] The MgCl 2 The initial concentration of the dNTPs is 2.0-3.0 mmol / L, preferably 2.5 mmol / L; the initial concentration of the forward primer B.ignitus-F is 5-15 μmol / L, preferably 10 μmol / L; the initial concentration of the reverse primer B.ignitus-R is 5-15 μmol / L, preferably 10 μmol / L; the initial concentration of the fluorescent probe B.ignitus-P is 5-15 μmol / L, preferably 10 μmol / L; the initial concentration of the DNA polymerase is 4-6 U / μL, preferably 5 U / μL.

[0064] In the present invention, the reaction procedure of the PCR amplification in step (2) is pre-denaturation at 95°C for 4 to 6 minutes, preferably 5 minutes; denaturation at 95°C for 10 to 20 seconds, preferably 15 seconds, annealing at 57 to 61.4°C for 25 to 35 seconds, preferably 30 seconds, for a total of 40 cycles; the annealing temperature is preferably 59°C.

[0065] In the present invention, the determination method in step (3) is any one of the following methods:

[0066] (1) Determine the amplification curve of the PCR amplification product. If the amplification curve is an S-shaped curve, it is determined that the sample to be tested contains the ITS gene and is Bombus erythrophilus; if the amplification curve is not an S-shaped curve, it is determined that the sample to be tested does not contain the ITS gene and is not Bombus erythrophilus;

[0067] (2) Determine the Ct value of the PCR amplification product. If the Ct value is ≤34, it is determined that the sample to be tested contains the ITS gene and is Bombus erythrophilus. If the Ct value is >34, it is determined that the sample to be tested does not contain the ITS gene and is not Bombus erythrophilus.

[0068] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0069] Example 1: Genes, primer pairs and probes

[0070] The DNA sequence of Bombus erythroxylin and eosinophilus in GenBank (accession number HQ228523.1) was screened to obtain a highly conserved region fragment ITS gene of Bombus erythroxylin and eosinophilus. The nucleotide sequence of the ITS gene is SEQ ID No. 1, and the nucleotide sequence of SEQ ID No. 1 is: AACCGCTGGAATTTGTCGAGATTAGAGGAAACGGCTGTAAGAGACTGA GGACGGGCGTTAAAAATCACCGACGATCGTTCAAAGGATGTCTGGCGT GAG. A specific primer pair and probe are designed for the ITS gene of the highly conserved region of the screened red-light bumblebee. The designed primer pair consists of a forward primer B.ignitus-F and a reverse primer B.ignitus-R. The nucleotide sequence of the forward primer B.ignitus-F is shown in SEQ ID No.2, and the nucleotide sequence of SEQ ID No.2 is: AACCGCTGGAATTTGTCGAG; the nucleotide sequence of the reverse primer B.ignitus-R is shown in SEQ ID No.3, and the nucleotide sequence of SEQ ID No.3 is: CTCACGCCAGACATCCTTTG. The primer pair can be used to specifically amplify the ITS gene. The probe designed to specifically recognize the ITS gene is the fluorescent probe B.ignitus-P, and the nucleotide sequence of the fluorescent probe B.ignitus-P is shown in SEQ ID No.4, and the nucleotide sequence of SEQ ID No.4 is CGCCCGTCCTCAGTCTCTTACAGCC. The 5' end of the fluorescent probe B.ignitus-P is labeled with HEX, and the 3' end is labeled with BHQ-1.

[0071] Example 2: Optimization of real-time fluorescence PCR annealing temperature

[0072] The plasmid standard was prepared according to the ITS gene screened in Example 1. The construction method was as follows: using the DNA sequence of Bombus ignitus in GenBank (accession number HQ228523.1) as a template, the forward primer B.ignitus-F and the reverse primer B.ignitus-R designed according to Example 1 were used for PCR amplification, and the reaction system was: 2×Taq PCR mix 12.5μL, forward primer B.ignitus-F 1.0μL, reverse primer B.ignitus-R 1.0μL, template DNA 2.0μL, ddH 2O was added to 25 μL; reaction procedure: 94℃ pre-denaturation for 5min; 94℃ denaturation for 45s, 55℃ annealing for 30s, 72℃ extension for 45s, 35 cycles in total; 72℃ extension for 10min. After the reaction, the product was identified by 2.0% agarose gel electrophoresis, the target fragment was recovered by DNA gel recovery kit, cloned into pUC57 vector (purchased from Fuzhou Boshang Biotechnology Co., Ltd.), transformed into E. coli DH5α, the transformed E. coli DH5α was inoculated into LB liquid culture medium containing ampicillin, cultured at 37℃ for 8h, and the recombinant plasmid was extracted with a plasmid extraction kit and sequenced. The recombinant plasmid with correct sequencing results was used as the standard, and the constructed plasmid standard was named pUC57-B.ignitus.

[0073] Real-time fluorescence PCR was performed using pUC57-B.ignitus as a standard sample. The program of real-time fluorescence PCR was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing temperature at 55°C, annealing extension for 30 s, for a total of 40 cycles;

[0074] Real-time fluorescence PCR reaction system: 2×PCR buffer 10μL, 25mmol / LMgCl 2 2.0μL, 2.5mmol / L dNTPs 1.5μL, 10μmol / L forward primer B.ignitus-F 0.8μL, 10μmol / L reverse primer B.ignitus-F 0.8μL, 10μmol / L fluorescent probe B.ignitus-P 0.8μL, 5U / μL DNA polymerase 0.5μL, standard sample DNA 2.0μL, then add ddH 2 HO 1.6 μL to bring the total reaction volume to 20.0 μL.

[0075] Eight gradient annealing temperatures were set, namely 55°C, 55.7°C, 57°C, 59°C, 61.4°C, 63.3°C, 64.5°C, and 65°C. Real-time fluorescence PCR was performed at different gradient annealing temperatures, and the real-time fluorescence PCR amplification curves at different annealing temperatures were drawn. The results are shown in Figure 1 As shown, the horizontal axis represents the cycle number, and the vertical axis represents the relative fluorescence intensity.

[0076] according to Figure 1 It can be seen that when the annealing temperature is 59°C, the Ct value is the smallest and the fluorescence intensity is high. On the basis of maintaining the amplification efficiency, a higher annealing temperature is selected to improve the specificity, so the optimal annealing temperature is 59°C. The best real-time fluorescence PCR program is: 95°C pre-denaturation for 5 minutes; 95°C denaturation for 15 seconds, 59°C annealing and extension for 30 seconds, for a total of 40 cycles.

[0077] Example 3: Optimization of real-time fluorescence PCR reaction system

[0078] The pUC57-B.ignitus standard obtained in Example 2 was used as the standard sample for real-time fluorescence PCR, and the real-time fluorescence PCR reaction system was optimized according to the best real-time fluorescence PCR program in Example 2. The final concentrations of the forward B.ignitus-F and reverse primers B.ignitus-R (0.1 μmol / L to 1.0 μmol / L) and the final concentration of the fluorescent probe B.ignitus-P (0.1 μmol / L to 0.5 μmol / L) were optimized and selected by using a square array ratio test, and the experiment was repeated three times. The real-time fluorescence PCR amplification curves of primer-probe combinations with different final concentrations were plotted, and the results are shown in FIG. Figure 2 As shown, the horizontal axis represents the cycle number, and the vertical axis represents the relative fluorescence intensity.

[0079] according to Figure 2 It can be seen that when the volume of the forward primer B.ignitus-F with an initial concentration of 10 μmol / L is 0.4 μL (final concentration is 0.2 μmol / L), the volume of the reverse primer B.ignitus-R with an initial concentration of 10 μmol / L is 0.4 μL (final concentration is 0.2 μmol / L), and the volume of the fluorescent probe B.ignitus-P with an initial concentration of 10 μmol / L is 0.4 μL (final concentration is 0.2 μmol / L), the Ct value, fluorescence intensity and amplification curve morphology can all reach an ideal state. Therefore, the optimal real-time fluorescence PCR reaction system is: 2×PCR buffer 10 μL, initial concentration of 25 mmol / L MgCl 2 2.0μL, dNTPs with an initial concentration of 2.5mmol / L 1.5μL, forward primer B.ignitus-F with an initial concentration of 10μmol / L 0.4μL, reverse primer B.ignitus-R with an initial concentration of 10μmol / L 0.4μL, fluorescent probe B.ignitus-P with an initial concentration of 10μmol / L 0.4μL, DNA polymerase with an initial concentration of 5U / μL 0.5μL, sample DNA 2.0μL, ddH 2 O 2.8 μL.

[0080] Example 4: Establishment of real-time fluorescence PCR detection method

[0081] 1. Extract DNA from the sample to be tested

[0082] The DNA of the sample to be tested was extracted using a genomic DNA extraction kit (blood / cell / tissue genomic DNA extraction kit, Tiangen Biochemical Technology Co., Ltd.), and the extraction method was based on the kit instructions.

[0083] 2. Real-time fluorescence PCR detection method

[0084] The forward primer B.ignitus-F, reverse primer B.ignitus-R and fluorescent probe B.ignitus-P designed in Example 1 were used to perform real-time fluorescent PCR amplification reaction on the sample DNA to be tested; the real-time fluorescent PCR reaction system was: 2×PCR buffer 10 μL, initial concentration of 25 mmol / LMgCl 2 2.0μL, dNTPs with an initial concentration of 2.5mmol / L 1.5μL, forward primer B.ignitus-F with an initial concentration of 10μmol / L 0.4μL, reverse primer B.ignitus-R with an initial concentration of 10μmol / L 0.4μL, fluorescent probe B.ignitus-P with an initial concentration of 10μmol / L 0.4μL, DNA polymerase with an initial concentration of 5U / μL 0.5μL, sample DNA 2.0μL, ddH 2 O 2.8 μL.

[0085] The real-time fluorescence PCR reaction program was: 95°C pre-denaturation for 5 min; 95°C denaturation for 15 s, 59°C annealing for 30 s, for a total of 40 cycles. Single-point fluorescence detection was performed at 59°C.

[0086] 3. Result determination

[0087] The PCR amplification product is used to determine whether the sample contains the ITS gene fragment, thereby determining whether it is a Bombus erythematosus. The specific criteria for determining the test results are:

[0088] (1) Determine the amplification curve of the PCR amplification product. If the amplification curve is an S-shaped curve, it is determined that the sample to be tested contains the ITS gene fragment and is Bombus erythrophilus; if the amplification curve is not an S-shaped curve, it is determined that the sample to be tested does not contain the ITS gene fragment and is not Bombus erythrophilus;

[0089] (2) Determine the Ct value of the PCR amplification product. If the Ct value is ≤34, it is determined that the sample to be tested contains the ITS gene fragment and is Bombus erythrophilus. If the Ct value is >34, it is determined that the sample to be tested does not contain the ITS gene fragment and is not Bombus erythrophilus.

[0090] Example 5: Sensitivity experiment

[0091] The pUC57-B.ignitus obtained in Example 2 was diluted 10-fold with sterile water to 4.0×10 7 Copies / μL~4.0×10 0 Copies / μL concentration of standard samples.

[0092] The standard samples with different dilution concentrations were used as templates, the healthy bee tissue DNA was used as control, and sterile water was used as blank control. Real-time fluorescence PCR was performed according to "2. Real-time fluorescence PCR detection method" in Example 4, and repeated 3 times. The PCR amplification curves of templates with different dilution concentrations were plotted. The results are shown in FIG. Figure 3 As shown, the number 1 in the figure indicates that the concentration is 4.0×10 7 copies / μL of the standard sample, the number 2 indicates a concentration of 4.0×10 6 copies / μL of the standard sample, the number 3 indicates a concentration of 4.0×10 5 The number 4 indicates a concentration of 4.0×10 4 copies / μL of the standard sample, the number 5 indicates a concentration of 4.0×10 3 copies / μL of the standard sample, the number 6 indicates a concentration of 4.0×10 2 copies / μL of the standard sample, the number 7 indicates a concentration of 4.0×10 1 copies / μL of the standard sample, the number 8 indicates a concentration of 4.0×10 0 The horizontal axis represents the cycle number, and the vertical axis represents the relative fluorescence intensity.

[0093] according to Figure 3 It can be seen that this method can detect a minimum of about 4.0 copies / μL of Bombus erythematosus DNA template.

[0094] The regression curve of the PCR amplification standard curve of red light bumblebee was constructed, and the results are as follows Figure 4 shown.

[0095] according to Figure 4 It can be seen that the regression equation of the standard curve is Y = -3.210x + 40.951; the determination coefficient R 2 The sensitivity of the real-time fluorescence PCR detection method of the present invention is high.

[0096] Example 6: Determination of Ct value

[0097] The pUC57-B.ignitus obtained in Example 2 was diluted with sterile water to a total of 3 dilutions of 4.0 copies / μL, 2.0 copies / μL, and 1.0 copies / μL. The standard samples with these 3 dilutions were used as templates, and real-time fluorescence PCR was performed according to the real-time fluorescence PCR detection method in Example 4. Each dilution template was repeated 4 times. PCR amplification curves of templates with different dilution concentrations were drawn, and the results are shown in FIG. Figure 5 As shown, the horizontal axis represents the cycle number, and the vertical axis represents the relative fluorescence intensity.

[0098] according to Figure 5 It can be seen that when the template concentration was 4.0 copies / μL, amplification occurred in all four replicate tubes, and the average Ct value was 34.0791; when the template concentration was 2.0 copies / μL, amplification occurred in one of the four replicate tubes, and when the template concentration was 1.0 copies / μL, no amplification curve appeared, so the positive judgment Ct value of this method was determined to be 34.

[0099] Example 7: Specificity Experiment

[0100] Seven common bee species, namely, Bombus ruficollis, Bombus terrestris, Bombus brevicaulis, Bombus lanzhouensis, Bombus flamingo, Apis mellifera, and Apis mellifera, were used as samples. A genomic DNA extraction kit (blood / cell / tissue genomic DNA extraction kit, Tiangen Biochemical Technology Co., Ltd.) was used to extract the DNA of the samples to be tested. Real-time fluorescent PCR was performed according to the real-time fluorescent PCR detection method in Example 4. PCR amplification curves of the DNA of different samples to be tested were plotted. The results are shown in FIG. Figure 6 As shown, the horizontal axis represents the cycle number, and the vertical axis represents the relative fluorescence intensity.

[0101] according to Figure 6 It can be seen that only Bombus erythrorhizium produced a typical amplification curve (Ct value was 20.91), and the other samples had no amplification curve, indicating that the real-time fluorescence PCR detection method of the present invention has good specificity.

[0102] Example 8: Clinical sample test

[0103] The method of the present invention was used to detect 10 bumblebee samples, 5 of which were red-light bumblebees. The PCR amplification curves of the 10 bumblebee samples are shown in Figure 1. Figure 7 shown.

[0104] according to Figure 7 It can be seen that 5 out of 10 samples were positive, with Ct values ​​ranging from 14 to 29, and the other 5 samples and the negative control had no Ct values, which was consistent with the expected results.

[0105] As can be seen from the above embodiments, the present invention provides a gene, primer-probe combination and application thereof for identifying Bombus erythrophilus. The present invention provides a gene that can specifically identify Bombus erythrophilus. The present invention also provides a primer-probe combination and an identification method that can specifically amplify the gene, which are used to identify whether the sample contains the gene, thereby determining whether it is Bombus erythrophilus. The identification method has high sensitivity, a minimum detection limit of 4.0 copies / μL, and good specificity, and no cross reaction with other bumblebees.

[0106] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An ITS gene for identifying Bombus erythematosus, characterized in that: The nucleotide sequence of the ITS gene is shown as SEQ ID No.

1.

2. A primer-probe combination for identifying Bombus rubrum, characterized in that: The primer-probe combination comprises a primer pair and a probe; The primer pair can specifically amplify the ITS gene of claim 1, comprising a forward primer B.ignitus-F and a reverse primer B.ignitus-R; The nucleotide sequence of the forward primer B.ignitus-F is shown in SEQ ID No.2; The nucleotide sequence of the reverse primer B.ignitus-R is shown in SEQ ID No.

3.

3. The primer-probe combination according to claim 2, characterized in that: The probe is a fluorescent probe B.ignitus-P; The nucleotide sequence of the fluorescent probe B.ignitus-P is shown in SEQ ID No.

4.

4. The primer-probe combination according to claim 3, characterized in that: The 5' end of the fluorescent probe B.ignitus-P is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group; The fluorescent reporter group is FAM, 6-FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, TAMRA, LC RED640, LC RED705, Quasar705 or Texas Red; The fluorescence quenching group is TAMRA, BHQ1, BHQ2, BHQ3, MGB or Dabcy1.

5. Use of the primer-probe combination according to any one of claims 2 to 4 in the preparation of a product for identifying Bombus erythematosus.

6. A kit for identifying Bombus rubrum, characterized in that: The kit comprises the primer-probe combination according to any one of claims 2 to 4, a PCR buffer, a template DNA, a DNA polymerase and dNTPs.

7. A method for identifying Bombus rubrum, characterized in that: The steps include: (1) Extracting DNA from the sample to be tested; (2) using the primer-probe combination to perform PCR amplification on the DNA of the sample to be tested to obtain a PCR amplification product; (3) Determine whether the sample to be tested contains the ITS gene based on the PCR amplification product, thereby determining whether it is Bombus erythematosus; The primer-probe combination is the primer-probe combination according to any one of claims 2 to 4; The ITS gene is the ITS gene according to claim 1.

8. The method according to claim 7, characterized in that The reaction system of the PCR amplification in step (2) is 2×PCR buffer 8-12 μL, MgCl2 1.0-3.0 μL, dNTPs 1.0-2.0 μL, forward primer B.ignitus-F 0.2-0.6 μL, reverse primer B.ignitus-R 0.2-0.6 μL, fluorescent probe B.ignitus-P 0.2-0.6 μL, DNA polymerase 0.1-0.9 μL, sample DNA 1.0-3.0 μL, and ddH2O 1.8-3.8 μL; The initial concentration of MgCl2 is 20-30 mmol / L; the initial concentration of dNTPs is 2.0-3.0 mmol / L; the initial concentration of the forward primer B.ignitus-F is 5-15 μmol / L; the initial concentration of the reverse primer B.ignitus-R is 5-15 μmol / L; the initial concentration of the fluorescent probe B.ignitus-P is 5-15 μmol / L; and the initial concentration of the DNA polymerase is 4-6 U / μL.

9. The method according to claim 7, characterized in that: The reaction procedure of the PCR amplification in step (2) is pre-denaturation at 95° C. for 4 to 6 minutes; denaturation at 95° C. for 10 to 20 seconds, annealing at 57 to 61.4° C. for 25 to 35 seconds, for a total of 40 cycles.

10. The method according to claim 7, characterized in that The determination method in step (3) is any one of the following methods: (1) Determine the amplification curve of the PCR amplification product. If the amplification curve is an S-shaped curve, it is determined that the sample to be tested contains the ITS gene and is Bombus erythrophilus; if the amplification curve is not an S-shaped curve, it is determined that the sample to be tested does not contain the ITS gene and is not Bombus erythrophilus; (2) Determine the Ct value of the PCR amplification product. If the Ct value is ≤34, it is determined that the sample to be tested contains the ITS gene and is Bombus erythrophilus. If the Ct value is >34, it is determined that the sample to be tested does not contain the ITS gene and is not Bombus erythrophilus.

Images