Vannamei shrimp Lvpsma5 gene hypoxia tolerance trait related snp molecular marker and application thereof

Abstract

The application discloses a SNP molecular marker related to the low-oxygen tolerance trait of Litopenaeus vannamei Lvpsma5 genes, wherein the SNP molecular marker is located at the 904th nucleotide from the 5' end of a nucleotide sequence shown in SEQ ID NO:1, and the base is T or C; the application also discloses primers for amplifying the SNP molecular marker, a kit, a detection method of the low-oxygen tolerance trait of Litopenaeus vannamei, and application of reagents for detecting the SNP molecular marker, the primers, the kit or the method in identifying or breeding the low-oxygen tolerance trait of Litopenaeus vannamei; the low-oxygen tolerance trait of an individual with a TC genotype of the SNP molecular marker is significantly higher than that of an individual with a TT genotype; the SNP molecular marker can be used for molecular marker assisted breeding and genetic improvement of Litopenaeus vannamei, so as to improve the low-oxygen tolerance of Litopenaeus vannamei and increase the breeding benefit.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to a molecular marker for hypoxia tolerance in the Lvpsma5 gene of Litopenaeus vannamei and its application. Background Technology

[0002] Litopenaeus vannamei, belonging to the order Decapoda, family Penaeidae, and genus Litopenaeus, is a shallow-sea crustacean found in tropical and subtropical waters, widely distributed in countries along the Pacific coast. Its delicious meat, rich in protein and various trace elements, makes it highly nutritious and popular with consumers, giving it significant economic value. However, Litopenaeus vannamei is quite sensitive to environmental changes, particularly its ability to adapt to low-oxygen conditions, which severely limits the sustainable development of aquaculture. Therefore, molecular genetic breeding research is urgently needed to elucidate the genetic mechanisms related to important economic traits.

[0003] In recent years, although the academic community has conducted some research on the artificial breeding, population genetics, genomics, and hypoxia and salinity adaptation of Litopenaeus vannamei, there are still few reports on the development and application of molecular markers related to hypoxia tolerance. Molecular marker-assisted selection breeding technology selects breeding materials through DNA molecular markers to improve important economic traits of species. Single nucleotide polymorphisms (SNPs), as third-generation molecular markers, have been widely used in the field of molecular breeding research of animals and plants due to their advantages such as high polymorphism, genetic stability and convenient detection. They have opened up a new avenue for crustacean breeding and have shown their unique advantages.

[0004] Because the early Litopenaeus vannamei reference genome assembly was incomplete, the development of SNP markers related to low dissolved oxygen tolerance in Litopenaeus vannamei was very difficult. At the same time, the limited accuracy of first-generation sequencing and the high cost of second-generation genome sequencing resulted in a small number of individuals in the experimental population that could be effectively detected, leading to unstable SNP markers. Therefore, further screening of SNP markers is urgently needed to identify genetic markers that are more closely related to low oxygen tolerance.

[0005] Therefore, this invention aims to develop a SNP molecular marker on the Litopenaeus vannamei Lvpsma5 gene (Litopenaeus vannamei Proteasome subunit alpha type-5, Lvpsma5) that is significantly associated with hypoxia tolerance, in order to improve its environmental adaptability and aquaculture efficiency, increase its economic and ecological value, and provide a new perspective for understanding the adaptation mechanisms of crustaceans to hypoxic environments; through molecular marker-assisted selection breeding technology, the hypoxia tolerance trait of Litopenaeus vannamei can be improved more efficiently, thereby enhancing the overall efficiency and sustainable development capacity of the aquaculture industry. Summary of the Invention

[0006] The purpose of this invention is to provide a molecular marker for the hypoxia tolerance trait of the Lvpsma5 gene in Litopenaeus vannamei, primers for amplifying the molecular marker, and a kit for detecting the molecular marker.

[0007] The present invention also aims to provide a method for detecting the hypoxia tolerance trait of Litopenaeus vannamei.

[0008] The final object of the present invention is to provide the application of reagents, primers, kits or methods for detecting the SNP molecular markers in the identification or selection of Litopenaeus vannamei varieties with hypoxia tolerance.

[0009] The first objective of the present invention can be achieved by the following technical solution: a SNP molecular marker related to the hypoxia tolerance trait of the Litopenaeus vannamei Lvpsma5 gene, wherein the SNP molecular marker is located at position 904 from the 5' end of the nucleotide sequence of the Litopenaeus vannamei Lvpsma5 gene as shown in SEQ ID NO: 1, and its base is T or C.

[0010] The research group of the inventors of this application conducted large-scale whole-genome sequencing on Litopenaeus vannamei and compared the obtained sequencing data with the Litopenaeus vannamei reference genome (NCBI: GCF 042767895.1) assembled using third-generation sequencing technology. SNP identification and filtering were performed using GATK (-type Unified Genotyper) software to obtain a usable SNP dataset. Based on the parental genotype detection results of the reference genome, polymorphic markers were developed between parents and offspring genotyping was performed. Chi-square test was used to filter biased segregating markers. For the high-quality genetic markers obtained after screening, a genetic map was constructed using Joinmap 4.0 software. QTL localization was performed using the Interval Mapping method of the R package qtl. Linkage analysis was performed between molecular markers on the genetic map and hypoxia tolerance traits, locating the Litopenaeus vannamei Lvpsma5 gene as associated with hypoxia tolerance, and identifying a SNP marker in the intron region of the Lvpsma5 gene.

[0011] The SNP molecular markers described in this invention are significantly correlated with the survival rate of Litopenaeus vannamei under hypoxic stress.

[0012] This invention focuses on the SNP sites of the Lvpsma5 gene in Litopenaeus vannamei. It found that one SNP site (g.904T>C) located in the intron region of the Lvpsma5 gene is significantly associated with the hypoxia tolerance trait of Litopenaeus vannamei. Therefore, the SNP molecular marker was obtained through screening.

[0013] Further small-group experiments and large-group validations revealed that the SNP sites in the Litopenaeus vannamei Lvpsma5 gene identified as follows:

[0014] Individuals with the TC genotype (g.904T>C) exhibited significantly higher hypoxia tolerance than those with the TT genotype.

[0015] The hypoxia tolerance trait of different genotypes at SNP sites in the intron region of the Litopenaeus vannamei Lvpsma5 gene showed significant differences (P<0.05).

[0016] That is, the individuals with the TC genotype of the Lvpsma5 gene, as shown by the SNP molecular marker at position 904 in SEQ ID NO: 1, exhibited significantly higher hypoxia tolerance than the individuals with the TT genotype.

[0017] The hypoxia tolerance trait refers to the ability to survive in environments with low dissolved oxygen levels, such as within the range of dissolved oxygen concentration from the asphyxiation point (around 0.4 mg / L) to the normal dissolved oxygen concentration (around 7 mg / L).

[0018] The present invention also provides primers for amplifying the SNP molecular marker, the primers comprising a forward primer Lvpsma5-F and a reverse primer Lvpsma5-R, the nucleotide sequence of the forward primer Lvpsma5-F being shown in SEQ ID NO: 2, and the nucleotide sequence of the reverse primer Lvpsma5-R being shown in SEQ ID NO: 3.

[0019] Specifically, the nucleotide sequences of the forward primer Lvpsma5-F and the reverse primer Lvpsma5-R are as follows:

[0020] Forward primer Lvpsma5-F:5'-cttctctggggtgactgctg-3' (as shown in SEQ ID NO: 2);

[0021] Reverse primer Lvpsma5-R:5'-aaccttgccattcgctttgg-3' (as shown in SEQ ID NO: 3).

[0022] The present invention also provides a kit for detecting the SNP molecular marker, the kit comprising the primers.

[0023] The second objective of this invention can be achieved through the following technical solution: a method for detecting the hypoxia tolerance trait of Litopenaeus vannamei, comprising the following steps:

[0024] (S1) Genomic DNA was extracted from the muscle tissue of Litopenaeus vannamei;

[0025] (S2) Using the primers described above, the genomic DNA of the Litopenaeus vannamei muscle tissue described in step (S1) is amplified by PCR to obtain the amplification product;

[0026] (S3) Sequencing the amplification products described in step (S2), and determining the genotype of the SNP molecular marker based on the sequencing results;

[0027] (S 4) The hypoxia tolerance trait of Litopenaeus vannamei is determined by the genotype of the SNP molecular marker described in step (S3).

[0028] In the above-mentioned methods for detecting the hypoxia tolerance trait of Litopenaeus vannamei:

[0029] Preferably, the PCR reaction system used in step (S2) for PCR amplification is 40 μL, comprising: PCRSuperMix 20 μL, 10 mM forward and reverse primers 2 μL each, 40 ng / μL DNA template 2 μL, and the remainder is ddH2O.

[0030] Preferably, in step (S2), the PCR amplification process uses a total of 35 cycles of PCR reaction program, with pre-denaturation at 95°C for 5 min before each cycle, each cycle including denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 30 sec, and extension at 72°C for 10 min after each cycle.

[0031] Preferably, in step (S4), individuals with the SNP molecular marker genotype TC (g.904T>C) have significantly higher hypoxia tolerance than individuals with the TT genotype.

[0032] The present invention provides a method for detecting the hypoxia tolerance trait of Litopenaeus vannamei, which determines the hypoxia tolerance ability of Litopenaeus vannamei by detecting the SNP molecular marker genotype of Litopenaeus vannamei based on the detection results of the hypoxia tolerance trait.

[0033] The last objective of the present invention can be achieved by the following technical solution: the application of reagents, primers, kits or methods for detecting the SNP molecular markers in the identification or selection of Litopenaeus vannamei varieties with hypoxia tolerance.

[0034] In summary, this invention discloses a molecular marker for the hypoxia tolerance trait of the Lvpsma5 gene in Litopenaeus vannamei and its application. By screening for hypoxia tolerance in Litopenaeus vannamei, this invention identified a SNP site on the Lvpsma5 gene that is significantly associated with hypoxia tolerance and designed a pair of primers to amplify this SNP site. The disclosed SNP site is significantly correlated with the survival rate of Litopenaeus vannamei under hypoxia stress. Individuals with the TC genotype at this SNP site exhibit significantly stronger hypoxia tolerance than individuals with other genotypes. This marker can be used for marker-assisted breeding and genetic improvement of Litopenaeus vannamei, enhancing its hypoxia tolerance and increasing aquaculture efficiency.

[0035] The beneficial effects of this invention are as follows:

[0036] (1) This invention takes the SNP site of the Lvpsma5 gene of Litopenaeus vannamei as the research target and finds that a SNP site (g.904T>C) located in the intron region of the Lvpsma5 gene is significantly associated with the hypoxia tolerance trait of Litopenaeus vannamei.

[0037] (2) In this invention, individuals with the TC genotype g.904T>C showed significantly higher hypoxia tolerance than individuals with the TT genotype (P<0.05);

[0038] (3) The SNP loci disclosed in this invention are significantly correlated with the survival rate of Litopenaeus vannamei under hypoxia stress. Individuals with the TC genotype in the SNP loci have significantly stronger hypoxia tolerance than individuals with other genotypes. They can be used for molecular marker-assisted breeding and genetic improvement of Litopenaeus vannamei to improve the hypoxia tolerance of Litopenaeus vannamei and increase aquaculture benefits.

[0039] (4) In the genetic breeding research of Litopenaeus vannamei with hypoxia tolerance as the breeding index, individuals with g.904T>C locus as TC can be selected as breeding parents. This has important guiding significance for the breeding of new varieties of Litopenaeus vannamei with excellent hypoxia tolerance. Attached Figure Description

[0040] Figure 1 This is a sequencing peak diagram of the PCR amplification product sequenced using Lvpsma5-F primers in Example 2. The figure shows the position of the g.904T>C site. Detailed Implementation

[0041] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. However, it should be noted that the following embodiments are only used to describe the content of the invention and do not constitute a limitation on the scope of protection of the present invention. Unless otherwise specified, the reagents or materials used in the embodiments are all from commercial sources. Unless otherwise specified, the experimental instruments used are all conventional laboratory instruments.

[0042] Example 1

[0043] This embodiment utilizes data obtained from whole-genome resequencing to construct a genetic map. Using genetic markers from the map and hypoxia tolerance phenotype data of Litopenaeus vannamei, RQTL (R / qtl) localization analysis was performed. A SNP site on the Lvpsma5 gene was identified within the QTL region. This site is located at position 904 from the 5' end of the Litopenaeus vannamei Lvpsma5 gene (as shown in SEQ ID NO: 1), with a base of either T or C (g. 904T>C). The method for screening the SNP site includes the following steps:

[0044] (1) Acquisition of Litopenaeus vannamei populations

[0045] The experiment was conducted at Guangdong Guoxing Aquatic Technology Co., Ltd. in China. Before the experiment, sexually mature male and female individuals of the Litopenaeus vannamei cultivar “Xinghai No. 1” with good traits were selected as parents, and a semi-directional mating method was used to construct an F1 full-sib family. Under these conditions, artificial insemination was used to collect spermatophores from male shrimp and transfer them to the gonopodium of mature female breeding shrimp to achieve the required mating. The fertilized female shrimp laid eggs and hatched in isolated ponds to obtain the first generation (F1) individuals for family tracing. The offspring were initially raised in nursery ponds for 15 days, and then raised outdoors in 3.0m×3.0m×1.2m ponds for 45 days at a temperature of 29.0±1.0℃, a pH of 8.0±0.2, a dissolved oxygen of 6.5±0.5mg / L, and a salinity of 22‰.

[0046] (2) Hypoxia stress treatment of Litopenaeus vannamei

[0047] Nitrogen gas was injected into the water to reduce the dissolved oxygen content, maintaining the dissolved oxygen level at 0.4 mg / L (asphyxiation point dissolved oxygen concentration) to achieve a low-oxygen environment. 450 shrimp were randomly selected for hypoxia stress treatment. The time from the start of hypoxia treatment to the shrimp stopping swimming, becoming unbalanced, and unresponsive to touch was recorded as hypoxia tolerance phenotypic data. Based on the recorded duration of the experimental shrimp phenotype, muscle tissue was randomly collected from 200 individuals from the beginning of the shrimp stopping swimming, becoming unbalanced, and unresponsive to touch to the last shrimp for genomic DNA extraction.

[0048] (3) Whole genome resequencing

[0049] Genomic DNA was extracted from the muscle tissue of the individuals and their parents obtained in step (2), and then a whole-genome sequencing library was constructed. The resulting library was sequenced on the BGISEQ-500 high-throughput sequencing platform.

[0050] (4) Genetic map construction

[0051] The obtained sequencing data were aligned with the Litopenaeus vannamei reference genome (NCBI: GCF042767895.1) assembled using third-generation sequencing technology. SNPs were identified and quality controlled using GATK (-type Unified Genotyper) software to obtain a usable SNP dataset. Based on the parental genotype detection results of the reference genome, polymorphic markers were developed between parents and offspring genotyping was performed. The chi-square test was used to filter biased segregating markers. The high-quality genetic markers obtained after screening were used to construct genetic maps using Joinmap 4.0 software.

[0052] (5) Association analysis between genetic markers and hypoxia tolerance traits

[0053] QTL localization was performed using the Interval Mapping method of the R package qtl. Linkage analysis was conducted between SNP molecular markers on the genetic map and hypoxia tolerance traits to identify SNP molecular markers on genes in regions related to the trait.

[0054] The results showed that the Lvpsma5 gene of Litopenaeus vannamei is associated with its hypoxia tolerance trait, and a SNP molecular marker exists in the intron region of the Lvpsma5 gene. This SNP marker is located at position 904 from the 5' end of the Lvpsma5 gene of Litopenaeus vannamei (as shown in SEQ ID NO: 1), with a base of T or C (g. 904T>C). It can be used as a molecular marker for screening hypoxia-tolerant parents of Litopenaeus vannamei for assisted breeding.

[0055] The nucleotide sequence of the Litopenaeus vannamei Lvpsma5 gene (as shown in SEQ ID NO: 1) is as follows:

[0056]

[0057]

[0058] Note: Underlined lines represent complementary sequences of the forward and reverse primers, and bold italics represent SNP molecular markers.

[0059] Example 2

[0060] This invention also designs primers for PCR amplification of the SNP sites obtained in Example 1 and obtains the genotype of hypoxia-tolerant Litopenaeus vannamei by sequencing, thereby screening for hypoxia-tolerant Litopenaeus vannamei. The specific implementation method is as follows:

[0061] (S1) Acquisition of Litopenaeus vannamei populations

[0062] A population of Litopenaeus vannamei was obtained using the same method as in Example 1, and 80 individuals were randomly selected for hypoxia stress treatment.

[0063] (S2) Hypoxia stress treatment of Litopenaeus vannamei

[0064] Nitrogen gas was injected into the water to reduce the dissolved oxygen content, maintaining the dissolved oxygen level at 0.4 mg / L (asphyxiation point dissolved oxygen concentration) to achieve a low-oxygen environment. The time from the start of the low-oxygen treatment to the shrimp ceasing to swim, becoming unbalanced, and unresponsive to touch was used as data on the low-oxygen tolerance phenotypic traits. Based on the recorded phenotypic time of the experimental shrimp, muscle tissue was randomly collected from 80 individuals from the beginning of the shrimp ceasing to swim, becoming unbalanced, and unresponsive to touch to the last shrimp for genomic DNA extraction.

[0065] (S3) Extract DNA from Litopenaeus vannamei to be tested

[0066] Muscle tissue was collected from 80 individuals, and genomic DNA was extracted from the samples using the CTAB method. The specific steps are as follows:

[0067] (1) Remove individuals that have stopped swimming, are unbalanced, and do not respond to touch; for subsequent DNA extraction, cut the muscle of each individual and freeze the muscle sample in liquid nitrogen.

[0068] (2) DNA was separated from the sample using CTAB technology. The sample was properly ground under liquid nitrogen conditions, and about 0.1g of the liquid was transferred to a pre-cooled centrifuge tube, and then CTAB and β-mercaptoethanol solution were added.

[0069] (3) Place the mixed sample in a water bath at 65°C for about 1 hour, ensuring that it is stirred evenly in the water bath. Then transfer the sample to a centrifuge and centrifuge at 12,000 rpm for 10 min.

[0070] (4) Add the mixture of phenol, chloroform and isopropanol, mix well, centrifuge at 12,000 rpm for 10 min, and transfer the upper aqueous phase to a new centrifuge tube.

[0071] (5) Add the mixture of chloroform and isopropanol, mix well, centrifuge at 12,000 rpm for 10 min, and transfer the upper aqueous phase to a new centrifuge tube.

[0072] (6) The sample was precipitated and washed with isopropanol and anhydrous ethanol, centrifuged, and the supernatant was discarded.

[0073] (7) Repeat the above steps once, perform a short centrifugation, remove the ethanol, dry, then add an appropriate amount of ddH2O and store at -20℃.

[0074] (8) Finally, the integrity of the DNA sample was detected by 1% agarose gel electrophoresis, and its concentration and purity were detected by NanoDrop2000 micro spectrophotometer.

[0075] (S4) PCR amplification of the target fragment

[0076] Primers were designed using Primer Premier 5 software to target the SNP site 904T>C in the Litopenaeus vannamei Lvpsma5 gene. The primers included a forward primer Lvpsma5-F and a reverse primer Lvpsma5-R, as shown below: forward primer Lvpsma5-F: 5'-cttctctggggtgactgctg-3' (as shown in SEQ ID NO: 2); reverse primer Lvpsma5-R: 5'-aaccttgccattcgctttgg-3' (as shown in SEQ ID NO: 3).

[0077] Using the Litopenaeus vannamei muscle tissue DNA extracted in step (S3) as a template, the target fragment (696 bp) was amplified by PCR using the following reaction system and procedure: The PCR reaction system was 40 μL, in which... PCR SuperMix 20 μL, 10 mM forward and reverse primers 2 μL each, 40 ng / μL DNA template 2 μL, ddH2O 14 μL. The PCR reaction program consisted of 35 cycles, with pre-denaturation at 94℃ for 5 min before each cycle. Each cycle included denaturation at 94℃ for 30 sec, annealing at 60℃ for 30 sec, extension at 72℃ for 30 sec, and a final extension at 72℃ for 10 min after each cycle.

[0078] The target fragment (as shown in SEQ ID NO: 4) was amplified by specific primer PCR as follows:

[0079] cttctctggggtgactgctgcgacctccacatttgtgccgctgaccttctcctccatgacctgcttcaacacagtcagggcaacctttaaggcctcctgtagagtcattgactgaaaagatgagaggaaaaacaaactgaggttagaaaacaatgacaaatttccagatgttcctatactaatagaaacttcccatga taatgataaagtgaactcctctaacatagtatatcaccagtaactatgtaatgccttgggacaaaactacaaaacccactttagttatatacaataaaacaatacatctaaattagtgattgaagtaatttttagatatgaataacatctcag[t(g.904T>C)]ggcaaaaaatagc agttaccttgtggtaggattcttggagggactgctgtgcaccctcagagccagagcctatggcctttgcaccgaactctaggaaggtgccagaggggtccatgtgatacagatgtgagcctgtcttatcaataccagcaaataacatagccacac caaatggacgactctgtggaaatataaaaagaaatttgggaatgtgttatcaatgctatttgcattaacaccaaaaagaaggcagtgaattaataaatacataaccattaaaattcaaaatcattaccattgctggaccatcatcatcagaatca ccaaagcgaatggcaaggtt (as shown in SEQ ID NO: 4).

[0080] The underlined part indicates the location of the forward and reverse primers (forward sequence, and the base sequence of Lvpsma5-R after reverse complementation), and the square brackets indicate the SNP sites to be detected.

[0081] (S5) Sequencing the PCR amplification products to determine the genotype of the SNP loci.

[0082] The PCR amplification products of 80 Litopenaeus vannamei individuals were sequenced at Shanghai Sangon Biotech using direct sequencing (Sanger sequencing). Genotyping analysis of the sequencing peaks was performed using Snapgene software. A double peak at the SNP site indicated a heterozygous genotype, while a single peak indicated a homozygous genotype, thus determining the g.904T>C genotype.

[0083] Figure 1 The peak diagram of haplotype TC at position 904 of the Lvpsma5 gene in this embodiment is shown (g.904T>C).

[0084] (S6) Correlation analysis of SNP locus genotypes and hypoxia tolerance in Litopenaeus vannamei.

[0085] One-way ANOVA in a general linear model using SPSS 26 was used to analyze the correlation between genotypes of the above SNP loci and the quantitative trait of hypoxia tolerance. For SNP loci with significant differences, Ducan's method was used for multiple comparison analysis. The results are as follows:

[0086] Table 1. Correlation between SNP sites in the Litopenaeus vannamei Lvpsma5 gene and hypoxia tolerance trait.

[0087]

[0088] Wherein, the P-value is the result of one-way ANOVA in a general linear model; the superscript letters of the hypoxia tolerance time indicate the results of Ducan's multiple comparison analysis between genotypes, with different letters indicating significant differences and the presence of the same letter indicating no significant differences.

[0089] The results in Table 1 show that there were significant differences between the three genotypes of the Lvpsma5 gene (g.904T>C) in Litopenaeus vannamei and the hypoxia tolerance trait (P = 0.024 < 0.05), indicating that this SNP locus is significantly associated with hypoxia tolerance. Among them, Litopenaeus vannamei individuals with the TC genotype had the longest survival time under hypoxia tolerance (i.e., TC is the dominant genotype), while individuals with the TT genotype had the shortest survival time (i.e., TT is the inferior genotype), and there was a significant difference between the two. This indicates that in the process of breeding Litopenaeus vannamei populations with hypoxia tolerance, individuals with the TC SNP genotype should be preferentially selected as parents for breeding Litopenaeus vannamei with hypoxia tolerance.

[0090] Example 3

[0091] The experiment was conducted at Guangdong Guoxing Aquatic Technology Co., Ltd. in China. One hundred and ninety-six 60-day-old Litopenaeus vannamei shrimp from Zhanjiang, Guangdong Province, were randomly selected and subjected to hypoxia stress treatment using the same method as in Example 1 or 2 for large-scale validation.

[0092] Genomic DNA was extracted from the muscle of 196 Litopenaeus vannamei. Using the primers described in Example 2, the genomic DNA from the muscle of Litopenaeus vannamei was amplified by PCR. The PCR amplification system and procedure were the same as in Example 2. PCR amplification products were obtained. The PCR amplification products were sequenced, and the genotypes of the SNP molecular markers were determined based on the sequencing results. The hypoxia tolerance of the Litopenaeus vannamei to be tested was determined by the genotype.

[0093] The analysis results are shown in Table 2 below:

[0094] Table 2. Correlation between SNP sites in the Litopenaeus vannamei Lvpsma5 gene and hypoxia tolerance trait.

[0095]

[0096]

[0097] Wherein, the P-value is the result of one-way ANOVA in a general linear model; the superscript letters of the hypoxia tolerance time indicate the results of Ducan's multiple comparison analysis between genotypes, with different letters indicating significant differences and the presence of the same letter indicating no significant differences.

[0098] The results in Table 2 show that in the large-scale validation experiment, TC at the SNP site (g.904T>C) on the Lvpsma5 gene of Litopenaeus vannamei was still the dominant genotype, and there was a significant difference between this SNP site and the hypoxia tolerance trait (P = 0.041 < 0.05), which was statistically significant.

[0099] Therefore, the above SNP molecular markers can be applied to the screening of hypoxia-tolerant Litopenaeus vannamei populations. Individuals with the genotype TC at the SNP site (g.904T>C) on the Lvpsma5 gene of Litopenaeus vannamei can be used as culture subjects to cultivate hypoxia-tolerant Litopenaeus vannamei populations.

[0100] Further research in this invention revealed that the alpha 5 (Lvpsma5) gene of the proteasome subunit 20S in Litopenaeus vannamei, as a member of the proteasome 20S subunit, can participate in regulating cellular oxygen transport and adaptation to hypoxic environments through its protein degradation function under hypoxic conditions, affecting the expression of genes related to cellular metabolism and transport. Therefore, the function of the Lvpsma5 gene is closely related to the adaptability of Litopenaeus vannamei to hypoxic environments and is a key factor in improving the farming efficiency and adaptability of Litopenaeus vannamei.

[0101] Furthermore, when the SNP molecular marker described in this invention is applied to the breeding process of Litopenaeus vannamei for its hypoxia tolerance trait, specifically during the breeding process, the genomic DNA of the Litopenaeus vannamei to be tested is extracted, and the primers designed in this invention are used to amplify the genomic DNA of the Litopenaeus vannamei to be tested by PCR. The PCR amplification products are obtained, and the PCR amplification products are sequenced. Based on the sequencing results, the genotype of the SNP locus is detected in the candidate population for Litopenaeus vannamei breeding. Combined with the genotypes of other loci related to growth traits, disease resistance, and stress resistance traits, individuals with the SNP genotype TC described in this invention are preferentially selected as parents of Litopenaeus vannamei for breeding hypoxia tolerance traits.

[0102] Therefore, the reagents, primers, or kits for detecting the SNP molecular markers can be used in the identification and selective breeding of hypoxia traits in Litopenaeus vannamei.

[0103] Furthermore, the application of the reagents for detecting the SNP molecular markers, the primers, and the kit in evaluating the hypoxia tolerance of Litopenaeus vannamei is also within the scope of protection of this invention.

[0104] The above embodiments are only used to illustrate the present invention, and the scope of protection of the present invention is not limited to the above embodiments. Those skilled in the art can achieve the purpose of the present invention based on the above disclosure. Any improvements and modifications made based on the concept of the present invention fall within the scope of protection of the present invention, and the specific scope of protection is determined by the claims.

Claims

1. A species of Litopenaeus vannamei Lvpsma5 SNP molecular markers associated with hypoxia tolerance in genes, characterized by: The SNP molecular marker is located in Litopenaeus vannamei. Lvpsma5 The gene has the nucleotide sequence shown in SEQ ID NO: 1, wherein the base at position 904 from the 5' end is either T or C.

2. A primer for amplifying the SNP molecular marker of claim 1, characterized in that, The primers include forward primers. Lvpsma5 -F and reverse primer Lvpsma5 -R, the forward primer Lvpsma5 The nucleotide sequence of -F is shown in SEQ ID NO: 2, and the reverse primer Lvpsma5 The nucleotide sequence of -R is shown in SEQ ID NO:

3.

3. A kit for detecting the SNP molecular marker of claim 1, characterized in that, The kit includes the primers as described in claim 2.

4. A method for detecting the hypoxia tolerance trait of Litopenaeus vannamei, characterized in that, Includes the following steps: (S1) Genomic DNA was extracted from the muscle tissue of Litopenaeus vannamei; (S2) Using the primers described in claim 2, the genomic DNA of the Litopenaeus vannamei muscle tissue described in step (S1) is amplified by PCR to obtain the amplification product; (S3) Sequencing the amplification products described in step (S2), and determining the genotype of the SNP molecular marker based on the sequencing results; (S4) Determine the hypoxia tolerance trait of Litopenaeus vannamei by using the genotype of the SNP molecular markers described in step (S3); In step (S4), individuals with the TC genotype of the SNP molecular marker showed significantly higher hypoxia tolerance than individuals with the TT genotype.

5. The method for detecting the hypoxia tolerance trait of Litopenaeus vannamei according to claim 4, characterized in that, The PCR reaction system used in step (S2) for PCR amplification is 40 μL, including: 20 μL of 2×EasyTaq PCR SuperMix, 2 μL each of 10 mM forward and reverse primers, 2 μL of 40 ng / μL DNA template, and the remainder is ddH2O.

6. The method for detecting the hypoxia tolerance trait of Litopenaeus vannamei according to claim 4, characterized in that, In step (S2), the PCR amplification process used a total of 35 cycles. The pre-denaturation was performed at 95°C for 5 min before each cycle. Each cycle included denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 30 sec, and extension at 72°C for 10 min after each cycle.

7. The application of the reagent for detecting the SNP molecular marker of claim 1, the primer of claim 2, or the kit of claim 3 in identifying or selecting Litopenaeus vannamei varieties with hypoxia tolerance, wherein the SNP molecular marker is located in the nucleotide sequence of the Litopenaeus vannamei Lvpsma5 gene as shown in SEQ ID NO: 1, and the nucleotide sequence shown in SEQ ID NO: 1 is at position 904 from the 5' end, with a base of T or C; individuals with the TC genotype of the SNP molecular marker have significantly higher hypoxia tolerance than individuals with the TT genotype.

8. The application of the detection method according to any one of claims 4-6 in the identification or selection of Litopenaeus vannamei varieties with hypoxia tolerance.

Images