Vannamei Lvrpp14 gene hypoxia tolerance trait related snp molecular marker and application thereof

Abstract

The application discloses a SNP molecular marker related to a L. vannamei Lvrpp14 gene low-oxygen tolerance character and application thereof. The SNP molecular marker is located at the 543th position from the 5' end of a nucleotide sequence shown in SEQ ID NO:1, and the base is G or A. The application further provides primers for amplifying the molecular marker, a kit, a detection method for the low-oxygen tolerance character of L. vannamei, and application of reagents for detecting the SNP molecular marker, the primers, the kit or the method in identifying or breeding L. vannamei varieties with the low-oxygen tolerance character. In the genetic breeding research of L. vannamei with the low-oxygen tolerance character as a breeding index, individuals with the g.543G>A site as GA can be preferentially selected as breeding parents, which has important guiding significance for breeding of new L. vannamei varieties with excellent low-oxygen tolerance character.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker for hypoxia tolerance in the Lvrpp14 gene of Litopenaeus vannamei and its application. Background Technology

[0002] Litopenaeus vannamei, belonging to the family Penaeidae and genus Litopenaeus, mainly inhabits shallow tropical and subtropical sea areas and is widely distributed in many countries along the Pacific coast. It is favored by consumers for its delicious meat, high protein content, rich trace elements, and unsaturated fatty acids, possessing extremely high nutritional and economic value. However, Litopenaeus vannamei is sensitive to environmental changes, especially its poor adaptability to low-oxygen environments, which severely limits the sustainable development of its aquaculture industry. Therefore, molecular genetic breeding research is urgently needed to elucidate the genetic mechanisms of important economic traits.

[0003] Despite significant research achievements in areas such as hypoxia tolerance, salinity adaptation, population genetics, artificial breeding, and genomics of Litopenaeus vannamei, research on the development and application of molecular markers, especially those related to hypoxia tolerance, remains insufficient. Marker-assisted selection (MAG) breeding technology uses DNA molecular markers to screen breeding materials to improve important economic traits of species. Single nucleotide polymorphisms (SNPs), as third-generation molecular markers, have been widely used in molecular breeding research of plants and animals due to their high genetic diversity, stable genetic characteristics, and convenient detection procedures. They provide a new approach for the genetic improvement of crustaceans and exhibit unique advantages.

[0004] However, the early assembly of the Litopenaeus vannamei reference genome was not complete, making it very difficult to develop SNP markers related to low dissolved oxygen tolerance in Litopenaeus vannamei. At the same time, the limited accuracy of first-generation sequencing and the high cost of second-generation genome sequencing resulted in a small number of individuals in the experimental population that could be effectively detected, leading to unstable SNP markers. Therefore, it is urgent to further screen SNP markers closely related to low oxygen tolerance in order to identify and develop more stable genetic markers.

[0005] Therefore, this invention aims to develop a SNP molecular marker on the Litopenaeus vannamei Lvrpp14 gene (Litopenaeus vannamei Ribonuclease p protein subunit p14, Lvrpp14) that is significantly associated with hypoxia tolerance, in order to improve its farming efficiency and environmental adaptability, increase its economic and ecological value, and provide a new perspective for understanding the adaptation mechanisms of crustaceans to hypoxic environments; through molecular marker-assisted selection breeding technology, the hypoxia tolerance trait of Litopenaeus vannamei can be improved more efficiently, thereby enhancing the overall efficiency and sustainable development capacity of the aquaculture industry. Summary of the Invention

[0006] The purpose of this invention is to provide a molecular marker for the hypoxia tolerance trait of the Lvrpp14 gene in Litopenaeus vannamei, primers for amplifying the SNP molecular marker, and a kit for detecting the SNP molecular marker.

[0007] The present invention also aims to provide a method for detecting the hypoxia tolerance trait of Litopenaeus vannamei.

[0008] The final object of the present invention is to provide the application of reagents, primers, kits or detection methods for detecting the SNP molecular markers in the identification or selection of Litopenaeus vannamei varieties with hypoxia tolerance.

[0009] The first objective of the present invention can be achieved by the following technical solution: a SNP molecular marker related to the hypoxia tolerance trait of the Litopenaeus vannamei Lvrpp14 gene, wherein the SNP molecular marker is located at position 543 from the 5' end of the nucleotide sequence of the Litopenaeus vannamei Lvrpp14 gene as shown in SEQ ID NO: 1, and its base is G or A.

[0010] The research group of the inventors of this application conducted large-scale whole-genome sequencing on Litopenaeus vannamei and compared the obtained sequencing data with the Litopenaeus vannamei reference genome (NCBI: GCF 042767895.1) assembled using third-generation sequencing technology. SNP identification and filtering were performed using GATK (-type Unified Genotyper) software to obtain a usable SNP dataset. Based on the parental genotype detection results of the reference genome, polymorphic markers were developed between parents and offspring genotyping was performed. Chi-square test was used to filter biased segregating markers. For the high-quality genetic markers obtained after screening, a genetic map was constructed using Joinmap 4.0 software. QTL localization was performed using the Interval Mapping method of the R package qtl. Linkage analysis was performed between molecular markers on the genetic map and hypoxia tolerance traits, locating the Litopenaeus vannamei Lvrpp14 gene as associated with hypoxia tolerance, and identifying a SNP marker in the intron region of the Lvrpp14 gene.

[0011] The SNP molecular markers described in this invention are significantly correlated with the survival rate of Litopenaeus vannamei under hypoxic stress.

[0012] This invention focuses on the SNP sites of the Lvrpp14 gene in Litopenaeus vannamei. It found that one SNP site (g.543G>A) located in the intron region of the Lvrpp14 gene is significantly associated with the hypoxia tolerance trait of Litopenaeus vannamei. Therefore, the SNP molecular marker was obtained through screening.

[0013] Further small-group experiments and large-group validations revealed that the SNP sites in the Lvrpp14 gene of Litopenaeus vannamei were identified as follows:

[0014] Individuals with the GA genotype (g.543G>A) exhibited significantly higher hypoxia tolerance than individuals with the GG genotype.

[0015] The hypoxia tolerance trait of different genotypes at the SNP sites in the intron region of the Lvrpp14 gene in Litopenaeus vannamei showed significant differences (P<0.05).

[0016] That is, individuals with the GA genotype of the Lvrpp14 gene, as shown by the SNP molecular marker at position 543 in SEQ ID NO: 1, exhibit significantly higher hypoxia tolerance than individuals with the GG genotype.

[0017] The hypoxia tolerance trait refers to the ability to survive in environments with low dissolved oxygen levels, such as within the range of dissolved oxygen concentration from the asphyxiation point (around 0.4 mg / L) to the normal dissolved oxygen concentration (around 7 mg / L).

[0018] The present invention also provides primers for amplifying the SNP molecular marker, the primers comprising a forward primer Lvrpp14-F and a reverse primer Lvrpp14-R, the nucleotide sequence of the forward primer Lvrpp14-F being shown in SEQ ID NO: 2, and the nucleotide sequence of the reverse primer Lvrpp14-R being shown in SEQ ID NO: 3.

[0019] Specifically, the nucleotide sequences of the forward primer Lvrpp14-F and the reverse primer Lvrpp14-R are as follows:

[0020] Forward primer Lvrpp14-F:5'-tcaaccgtggattgcgagt-3' (as shown in SEQ ID NO: 2);

[0021] Reverse primer Lvrpp14-R:5'-gcacggaaacacccttaacc-3' (as shown in SEQ ID NO: 3).

[0022] The present invention also provides a kit for detecting the SNP molecular marker, the kit comprising the primers.

[0023] The second objective of this invention can be achieved through the following technical solution: a method for detecting the hypoxia tolerance trait of Litopenaeus vannamei, comprising the following steps:

[0024] (S1) Extract genomic DNA from the muscle tissue of Litopenaeus vannamei;

[0025] (S2) Using the primers described above, the genomic DNA of the Litopenaeus vannamei muscle tissue described in step (S1) is amplified by PCR to obtain the amplification product;

[0026] (S3) Sequencing the amplification products described in step (S2), and determining the genotype of the SNP molecular marker based on the sequencing results;

[0027] (S 4) The hypoxia tolerance trait of Litopenaeus vannamei is determined by the genotype of the SNP molecular marker described in step (S3).

[0028] In the above-mentioned methods for detecting the hypoxia tolerance trait of Litopenaeus vannamei:

[0029] Preferably, the PCR reaction system used in step (S2) for PCR amplification is 40 μL, comprising: PCRSuperMix 20 μL, 10 mM forward and reverse primers 2 μL each, 40 ng / μL DNA template 2 μL, ddH2O 14 μL.

[0030] Preferably, in step (S2), the PCR amplification process uses a total of 35 cycles of PCR reaction program, with pre-denaturation at 95°C for 5 min before each cycle, each cycle including denaturation at 95°C for 30 sec, annealing at 59.5°C for 30 sec, extension at 72°C for 30 sec, and extension at 72°C for 10 min after each cycle.

[0031] Preferably, in step (S4), individuals with the GA genotype (g.543G>A) of the SNP molecular marker have significantly higher hypoxia tolerance than individuals with the GG genotype.

[0032] The present invention provides a method for detecting the hypoxia tolerance trait of Litopenaeus vannamei, which determines the hypoxia tolerance ability of Litopenaeus vannamei by detecting the SNP molecular marker genotype of Litopenaeus vannamei based on the detection results of the hypoxia tolerance trait.

[0033] The last objective of the present invention can be achieved by the following technical solution: the application of reagents, primers, kits or methods for detecting the SNP molecular markers in the identification or selection of Litopenaeus vannamei varieties with hypoxia tolerance.

[0034] In summary, this invention discloses a molecular marker for a hypoxia-tolerant trait in the Lvrpp14 gene of Litopenaeus vannamei and its application. By screening for hypoxia tolerance in Litopenaeus vannamei, this invention identified a SNP site on the Lvrpp14 gene that is significantly associated with hypoxia tolerance and designed a pair of primers to amplify this SNP site. The disclosed SNP site is significantly correlated with the survival rate of Litopenaeus vannamei under hypoxia stress. Individuals with the GA genotype at this SNP site exhibit significantly stronger hypoxia tolerance than individuals with other genotypes. This marker can be used for marker-assisted breeding and genetic improvement of Litopenaeus vannamei, enhancing its hypoxia tolerance and increasing aquaculture efficiency.

[0035] The beneficial effects of this invention are as follows:

[0036] (1) This invention takes the SNP site of the Lvrpp14 gene of Litopenaeus vannamei as the research target and finds that a SNP site (g.543G>A) located in the intron region of the Lvrpp14 gene is significantly associated with the hypoxia tolerance trait of Litopenaeus vannamei.

[0037] (2) In this invention, individuals with the GA genotype of g.543G>A showed significantly higher hypoxia tolerance than individuals with the GG genotype (P<0.05);

[0038] (3) The SNP loci disclosed in this invention are significantly correlated with the survival rate of Litopenaeus vannamei under hypoxia stress. Individuals with the genotype GA in the SNP loci have significantly stronger hypoxia tolerance than individuals with other genotypes. They can be used for molecular marker-assisted breeding and genetic improvement of Litopenaeus vannamei to improve the hypoxia tolerance of Litopenaeus vannamei and increase aquaculture benefits.

[0039] (4) In the genetic breeding research of Litopenaeus vannamei with hypoxia tolerance as the breeding index, individuals with g.543G>A locus as GA can be selected as breeding parents. This has important guiding significance for the breeding of new varieties of Litopenaeus vannamei with excellent hypoxia tolerance. Attached Figure Description

[0040] Figure 1 This is a sequencing peak diagram of the PCR amplification product sequenced using Lvrpp14-F primers in Example 2. The figure shows the position of the g.543G>A site. Detailed Implementation

[0041] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. However, it should be noted that the following embodiments are only used to describe the content of the invention and do not constitute a limitation on the scope of protection of the present invention. Unless otherwise specified, the reagents or materials used in the embodiments are all from commercial sources. Unless otherwise specified, the experimental instruments used are all conventional laboratory instruments.

[0042] Example 1

[0043] This embodiment utilizes data obtained from whole-genome resequencing to construct a genetic map. Using genetic markers from the map and hypoxia-tolerant phenotype data of Litopenaeus vannamei, RQTL (R / qtl) localization analysis was performed. A SNP site on the Lvrpp14 gene was identified within the QTL region. This site is located at position 543 from the 5' end of the Litopenaeus vannamei Lvrpp14 gene (as shown in SEQ ID NO: 1), with a base of either G or A (g. 543G>A). The method for screening the SNP site includes the following steps:

[0044] (1) Acquisition of Litopenaeus vannamei populations

[0045] The experiment was conducted at Guangdong Guoxing Aquatic Technology Co., Ltd. in China. Before the experiment, sexually mature male and female individuals of the Litopenaeus vannamei cultivar “Xinghai No. 1” with good traits were selected as parents, and a semi-directional mating method was used to construct an F1 full-sib family. Under these conditions, artificial insemination was used to collect spermatophores from male shrimp and transfer them to the gonopodium of mature female breeding shrimp to achieve the required mating. The fertilized female shrimp laid eggs and hatched in isolated ponds to obtain the first generation (F1) individuals for family tracing. The offspring were initially raised in nursery ponds for 15 days, and then raised outdoors in 3.0m×3.0m×1.2m ponds for 45 days at a temperature of 29.0±1.0℃, a pH of 8.0±0.2, a dissolved oxygen of 6.5±0.5mg / L, and a salinity of 22‰.

[0046] (2) Hypoxia stress treatment of Litopenaeus vannamei

[0047] Nitrogen gas was injected into the water to reduce the dissolved oxygen content, maintaining the dissolved oxygen level at 0.4 mg / L (asphyxiation point dissolved oxygen concentration) to achieve a hypoxic environment. 450 shrimp were randomly selected for hypoxic stress treatment. The time from the start of hypoxic treatment to the shrimp stopping swimming, becoming unbalanced, and unresponsive to touch was recorded as hypoxic tolerance phenotypic data. Based on the recorded duration of the experimental shrimp phenotype, muscle tissue was randomly collected from 200 shrimp from the beginning of the shrimp stopping swimming, becoming unbalanced, and unresponsive to touch to the last shrimp for genomic DNA extraction.

[0048] (3) Whole genome resequencing

[0049] Muscle tissues from 200 individuals and their parents obtained in step (2) were cut off, and genomic DNA was extracted from the samples using the CTAB method. Then, a whole-genome sequencing library was constructed, and the obtained library was sequenced on the BGISEQ-500 high-throughput sequencing platform.

[0050] (4) Genetic map construction

[0051] The obtained sequencing data were aligned with the Litopenaeus vannamei reference genome (NCBI: GCF042767895.1) assembled using third-generation sequencing technology. SNPs were identified and quality controlled using GATK (-type Unified Genotyper) software to obtain a usable SNP dataset. Based on the parental genotype detection results of the reference genome, polymorphic markers were developed between parents and offspring genotyping was performed. The chi-square test was used to filter biased segregating markers. The high-quality genetic markers obtained after screening were used to construct genetic maps using Joinmap 4.0 software.

[0052] (5) Association analysis between genetic markers and hypoxia tolerance traits

[0053] QTL localization was performed using the Interval Mapping method of the R package qtl. Linkage analysis was conducted between SNP molecular markers on the genetic map and hypoxia tolerance traits to identify SNP molecular markers on genes in regions related to the trait.

[0054] The results showed that the Lvrpp14 gene of Litopenaeus vannamei is associated with its hypoxia tolerance trait, and a SNP molecular marker exists in the intron region of the Lvrpp14 gene. This SNP marker is located at position 543 from the 5' end of the Lvrpp14 gene of Litopenaeus vannamei (as shown in SEQ ID NO: 1), with a base of G or A (g. 543G>A). It can be used as a molecular marker for screening hypoxia-tolerant parents of Litopenaeus vannamei for assisted breeding.

[0055] The nucleotide sequence of the Lvrpp14 gene in Litopenaeus vannamei (as shown in SEQ ID NO: 1) is as follows:

[0056]

[0057]

[0058]

[0059] Note: Underlined text indicates complementary primers for forward and reverse primers, and bold italic text indicates SNP sites.

[0060] Example 2

[0061] In this embodiment, primers were designed for PCR amplification of the SNP sites obtained in Example 1, and the genotype of hypoxia-tolerant Litopenaeus vannamei was obtained by sequencing. Hypoxia-tolerant Litopenaeus vannamei was then screened for. The specific implementation method is as follows:

[0062] (S1) Obtaining Litopenaeus vannamei populations and hypoxia treatment

[0063] The same method as in Example 1 was used to obtain a population of Litopenaeus vannamei, and 80 individuals were randomly selected for hypoxia stress treatment at 0.4 mg / L (dissolved oxygen concentration at the asphyxiation point).

[0064] (S2) Extract DNA from Litopenaeus vannamei to be tested

[0065] Muscle tissue was collected from 80 shrimp, and genomic DNA was extracted from the samples using the CTAB method. The specific steps are as follows:

[0066] (1) Remove individuals that have stopped swimming, are unbalanced, and do not respond to touch; for subsequent DNA extraction, cut the muscle of each shrimp and freeze the muscle sample in liquid nitrogen.

[0067] (2) DNA was separated from the sample using CTAB technology. The sample was properly ground under liquid nitrogen conditions, and about 0.1g of the liquid was transferred to a pre-cooled centrifuge tube, and then CTAB and β-mercaptoethanol solution were added.

[0068] (3) Place the mixed sample in a water bath at 65°C for about 1 hour, ensuring that it is stirred evenly in the water bath. Then transfer the sample to a centrifuge and centrifuge at 12,000 rpm for 10 min.

[0069] (4) Add the mixture of phenol, chloroform and isopropanol, mix well, centrifuge at 12,000 rpm for 10 min, and transfer the upper aqueous phase to a new centrifuge tube.

[0070] (5) Add the mixture of chloroform and isopropanol, mix well, centrifuge at 12,000 rpm for 10 min, and transfer the upper aqueous phase to a new centrifuge tube.

[0071] (6) The sample was precipitated and washed with isopropanol and anhydrous ethanol, centrifuged, and the supernatant was discarded.

[0072] (7) Repeat the above steps once, perform a short centrifugation, remove the ethanol, dry, then add an appropriate amount of ddH2O and store at -20℃.

[0073] (8) Finally, the integrity of the DNA sample was detected by 1% agarose gel electrophoresis, and its concentration and purity were detected by NanoDrop2000 micro spectrophotometer.

[0074] (S3) PCR amplification of the target fragment

[0075] Primers were designed using Primer Premier 5 software based on the Lvrpp14 gene SNP site 543G>A in Litopenaeus vannamei. The primers included a forward primer Lvrpp14-F and a reverse primer Lvrpp14-R, as shown below: Forward primer Lvrpp14-F: 5'-tcaaccgtggattgcgagt-3' (as shown in SEQ ID NO: 2); Reverse primer Lvrpp14-R: 5'-gcacggaaacacccttaacc-3' (as shown in SEQ ID NO: 3).

[0076] Using the Litopenaeus vannamei muscle tissue DNA extracted in step (S3) as a template, the target fragment (892 bp) was amplified by PCR using the following reaction system and procedure. The PCR reaction volume was 40 μL, in which... PCR SuperMix 20 μL, 10 mM forward and reverse primers 2 μL each, 40 ng / μL DNA template 2 μL, ddH2O 14 μL; PCR reaction program consists of 35 cycles, with pre-denaturation at 94℃ for 5 min before each cycle, each cycle including denaturation at 94℃ for 30 sec, annealing at 59.5℃ for 30 sec, extension at 72℃ for 30 sec, and extension at 72℃ for 10 min after each cycle.

[0077] The target fragment (as shown in SEQ ID NO: 4) was amplified by specific primer PCR as follows:

[0078] tcaaccgtggattgcgagt[g(g.543G>A)]atatacctagaat cagtcattttatagttcaatggaggcggctgcacccctgcgacctcctcatggcggctgcaacccccaacccccgccagggaaaacaaggaattttacatgaattcatggcaggagagagcattggacatacttggcaatgctgctcctgcatggca atcataggctcttttctgtaaggaatacttgctttcctgagtaggggttcggtgtcgcaggacagtatagtgactgatattgtgtatatttacattttaccatgattttcatttcattttctcatgccctccccagctatcaaggccaagaatgtggg ggttaagggtgtttccgtgc (as shown in SEQ ID NO: 4);

[0079] The underlined part indicates the location of the forward and reverse primers (forward sequence, and the base sequence of Lvrpp14-R after reverse complementation), and the square brackets indicate the SNP sites to be detected.

[0080] (S4) Sequencing the PCR amplification products to determine the genotype of the SNP loci.

[0081] The PCR amplification products of 80 Litopenaeus vannamei individuals were sequenced at Shanghai Sangon Biotech using direct sequencing (Sangerc sequencing). Genotyping analysis was performed on the sequencing peaks using Snapgene software. A double peak at the SNP site indicated a heterozygous genotype, while a single peak indicated a homozygous genotype. This determined the g.543G>A genotype. The results are as follows: Figure 1 As shown.

[0082] (S5) Correlation analysis of SNP locus genotypes and hypoxia tolerance in Litopenaeus vannamei.

[0083] One-way ANOVA in a general linear model using SPSS 26 was used to analyze the correlation between genotypes of the SNP loci and the quantitative trait of hypoxia tolerance. For SNP loci with significant differences, Ducan's method was used for multiple comparison analysis. The results are as follows:

[0084] Table 1. Correlation between SNP sites in the Lvrpp14 gene of Litopenaeus vannamei and hypoxia tolerance trait.

[0085]

[0086] Wherein, the P-value is the result of one-way ANOVA in a general linear model; the superscript letters of the hypoxia tolerance time indicate the results of Ducan's multiple comparison analysis between genotypes, with different letters indicating significant differences and the presence of the same letter indicating no significant differences.

[0087] The results in Table 1 show that there were significant differences (P = 0.040 < 0.05) between the three genotypes of the Lvrpp14 gene in Litopenaeus vannamei and the hypoxia tolerance trait, indicating that this SNP locus is significantly associated with hypoxia tolerance. Among them, Litopenaeus vannamei individuals with the GA genotype had the longest survival time under hypoxia tolerance (i.e., GA is the dominant genotype), while individuals with the GG genotype had the shortest survival time (i.e., GG is the inferior genotype), and there was a significant difference between the two. This indicates that in the process of breeding Litopenaeus vannamei populations with hypoxia tolerance, individuals with the GA SNP genotype should be preferentially selected as parents for breeding Litopenaeus vannamei with hypoxia tolerance.

[0088] Example 3

[0089] The experiment was conducted at Guangdong Guoxing Aquatic Technology Co., Ltd. in China. One hundred and ninety-six 60-day-old Litopenaeus vannamei shrimp from Zhanjiang, Guangdong Province, were randomly selected and subjected to hypoxia stress treatment using the same method as in Example 1 or 2 for large-scale validation.

[0090] Genomic DNA was extracted from the muscle of 196 Litopenaeus vannamei. Using the primers described in Example 2, the genomic DNA from the muscle of Litopenaeus vannamei was amplified by PCR. The PCR amplification system and procedure were the same as in Example 2. PCR amplification products were obtained. The PCR amplification products were sequenced. Based on the sequencing results, the genotypes of the SNP molecular markers were determined. The hypoxia tolerance of the Litopenaeus vannamei to be tested was determined by the genotypes.

[0091] The analysis results are shown in Table 2 below:

[0092] Table 2. Correlation between SNP sites in the Lvrpp14 gene of Litopenaeus vannamei and hypoxia tolerance trait.

[0093]

[0094]

[0095] Wherein, the P-value is the result of one-way ANOVA in a general linear model; the superscript letters of the hypoxia tolerance time indicate the results of Ducan's multiple comparison analysis between genotypes, with different letters indicating significant differences and the presence of the same letter indicating no significant differences.

[0096] The results in Table 2 show that in the large-scale validation experiment, GA was still the dominant genotype at the SNP site (g.543G>A) on the Lvrpp14 gene of Litopenaeus vannamei, and there was a significant difference between this SNP site and the hypoxia tolerance trait (P = 0.008 < 0.05), which was statistically significant.

[0097] Therefore, the above SNP molecular markers can be applied to the screening of hypoxia-tolerant Litopenaeus vannamei populations. Individuals with the genotype GA at the SNP site (g.543G>A) on the Lvrpp14 gene of Litopenaeus vannamei can be used as culture subjects to cultivate hypoxia-tolerant Litopenaeus vannamei populations.

[0098] Further research revealed that the protein subunit encoded by the p14 (ribonuclease pprotein subunit p14, rpp14) gene in Litopenaeus vannamei possesses 3' to 5' ribonuclease activity, which is crucial for the maturation of tRNA. tRNA is one of the earliest responders to various environmental stresses such as heat shock, hypoxia, or nutrient deprivation, protecting cells from peroxide damage through multiple regulatory mechanisms, including shutting down the entire protein translation process and limiting oxidative phosphorylation. It plays a vital role under hypoxic conditions. Therefore, the rpp14 gene is essential for protecting Litopenaeus vannamei cells from hypoxic stress under low-oxygen conditions.

[0099] Furthermore, when the SNP molecular marker described in this invention is applied to the breeding process of Litopenaeus vannamei for its hypoxia tolerance trait, specifically during the breeding process, genomic DNA of the Litopenaeus vannamei to be tested is extracted, and the primers designed in this invention are used to amplify the genomic DNA of the Litopenaeus vannamei to be tested by PCR. The PCR amplification products are obtained, and the PCR amplification products are sequenced. Based on the sequencing results, the genotype of the SNP locus is detected in the candidate population for Litopenaeus vannamei breeding. Combined with the genotypes of other loci related to growth traits, disease resistance, and stress resistance traits, individuals with the SNP genotype GA described in this invention are preferentially selected as parents of Litopenaeus vannamei for breeding hypoxia tolerance traits.

[0100] Therefore, the reagents, primers, or kits used to detect the SNP sub-labels can be applied to the identification and selective breeding of hypoxia traits in Litopenaeus vannamei.

[0101] Furthermore, the application of reagents for detecting the SNP molecular markers, the primers or kits described therein, in evaluating the hypoxia tolerance of Litopenaeus vannamei is also within the scope of protection of this invention.

[0102] The above embodiments are only used to illustrate the present invention, and the scope of protection of the present invention is not limited to the above embodiments. Those skilled in the art can achieve the purpose of the present invention based on the above disclosure. Any improvements and modifications made based on the concept of the present invention fall within the scope of protection of the present invention, and the specific scope of protection is determined by the claims.

Claims

1. A species of Litopenaeus vannamei Lvrpp14 SNP molecular markers associated with hypoxia tolerance in genes, characterized by: The SNP molecular marker is located in Litopenaeus vannamei. Lvrpp14 The gene has the nucleotide sequence shown in SEQ ID NO: 1, wherein the base at position 543 from the 5' end is G or A.

2. A primer for amplifying the SNP molecular marker of claim 1, characterized in that, The primers include forward primers. Lvrpp14 -F and reverse primer Lvrpp14 -R, the forward primer Lvrpp14 The nucleotide sequence of -F is shown in SEQ ID NO: 2, and the reverse primer Lvrpp14 The nucleotide sequence of -R is shown in SEQ ID NO:

3.

3. A kit for detecting the SNP molecular marker of claim 1, characterized in that, The kit includes the primers as described in claim 2.

4. A method for detecting the hypoxia tolerance trait of Litopenaeus vannamei, characterized in that, Includes the following steps: (S1) Genomic DNA was extracted from the muscle tissue of Litopenaeus vannamei; (S2) Using the primers described in claim 2, the genomic DNA of the Litopenaeus vannamei muscle tissue described in step (S1) is amplified by PCR to obtain the amplification product; (S3) Sequencing the amplification products described in step (S2), and determining the genotype of the SNP molecular marker based on the sequencing results; (S4) Determine the hypoxia tolerance trait of Litopenaeus vannamei by using the genotype of the SNP molecular markers described in step (S3); In step (S4), individuals with the GA genotype of the SNP molecular marker showed significantly higher hypoxia tolerance than individuals with the GG genotype.

5. The method for detecting the hypoxia tolerance trait of Litopenaeus vannamei according to claim 4, characterized in that, The PCR reaction system used in step (S2) for PCR amplification is 40 μL, including: 20 μL of 2×EasyTaq PCR SuperMix, 2 μL each of 10 mM forward and reverse primers, 2 μL of 40 ng / μL DNA template, and 14 μL of ddH2O.

6. The method for detecting the hypoxia tolerance trait of Litopenaeus vannamei according to claim 4, characterized in that, In step (S2), the PCR amplification process used a total of 35 cycles. Before each cycle, the cells were pre-denatured at 94°C for 5 min. Each cycle consisted of denaturation at 94°C for 30 sec, annealing at 59.5°C for 30 sec, extension at 72°C for 30 sec, and extension at 72°C for 10 min after each cycle.

7. The application of the reagent for detecting the SNP molecular marker of claim 1, the primer of claim 2, or the kit of claim 3 in the identification or selection of Litopenaeus vannamei varieties with hypoxia tolerance, wherein the SNP molecular marker is located in Litopenaeus vannamei. Lvrpp14 The gene has the nucleotide sequence shown in SEQ ID NO: 1, and the base at position 543 from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1 is G or A. Individuals with the GA genotype of the SNP molecular marker have significantly higher hypoxia tolerance than individuals with the GG genotype.

8. The application of the detection method according to any one of claims 4-6 in the identification or selection of Litopenaeus vannamei varieties with hypoxia tolerance.

Images