Method and detection kit for detecting ureaplasma urealyticum, ureaplasma parvum and tetracycline drug resistance genes

Abstract

The invention discloses a method for detecting ureaplasma urealyticum, ureaplasma parvum and tetracycline drug resistance genes and a detection kit, and relates to the technical field of prokaryotic microorganism detection. The nucleic acid composition provided by the invention can be used for rapidly, sensitively, accurately and specifically detecting and identifying the infection conditions of ureaplasma parvum and ureaplasma urealyticum from a sample to be detected, and can be used for detecting the drug sensitivity condition of the tetracycline drug-resistant gene tet (M), so that the nucleic acid composition has important significance on early diagnosis, timely treatment and effective control of genital tract ureaplasma infection.

Description

Technical Field

[0001] The present invention relates to the technical field of prokaryotic microorganism detection, and in particular to a method and a detection kit for detecting Ureaplasma urealyticum, Ureaplasma microphylla and tetracycline resistance genes. Background Art

[0002] At present, Ureaplasma is the smallest prokaryotic microorganism discovered so far that can replicate and survive independently. It often colonizes the epithelial cells of the urogenital tract mucosa and is the most common microbial species isolated from the female reproductive tract. The genus Ureaplasma includes two biological groups: Ureaplasma parvum (Up) and Ureaplasma urealyticum (Uu). The most common disease caused by Ureaplasma is non-gonococcal urethritis, accounting for 60% of non-bacterial urethritis. Ureaplasma urealyticum mostly parasitizes in the male urethra, foreskin of the penis and vagina of women. Ascending infection can cause prostatitis or epididymitis in men, vaginitis and cervicitis in women, and can infect the fetus, leading to miscarriage, premature birth and low birth weight fetus, and can also cause infection of the respiratory tract and central nervous system of newborns.

[0003] Studies have shown that among common female genital tract inflammations, ureaplasma accounts for 67.6% of non-gonococcal vaginitis, and the detection rate of ureaplasma is 67% in cases of cervicitis and vaginitis. Among infertile couples, about 90% of women are infected with ureaplasma, while only 22% of normal women can detect ureaplasma. Ureaplasma infection can cause urogenital tract infection and is considered to be an important pathogen in non-gonococcal urethritis second only to chlamydia (accounting for 50%). The detection rate in vaginal secretions of women of childbearing age is 40% to 80%, and the detection rate in pregnant women is as high as 82%, both of which are mainly Up. Ureaplasma can infect newborns through vertical transmission from mother to child. It has been reported that the vertical transmission rate of Up is as high as 100%, which can lead to premature birth, fetal systemic inflammatory response syndrome, etc. The positive rate of Ureaplasma in the respiratory secretions of newborns is inversely proportional to the gestational age. The positive rate of Ureaplasma in premature infants with a gestational age of less than 26 weeks can reach 65% within one month after birth, while the positive rate in premature infants with a gestational age of more than 26 weeks is 31%. The classification is mainly Up.

[0004] Tetracyclines are commonly used drugs for the treatment of mycoplasma infections, including chlortetracycline, oxytetracycline, demeclocycline, doxycycline, minocycline, etc. However, genital mycoplasma variants resistant to tetracycline have been found. The main resistance gene to tetracycline is tet M. Therefore, when tetracyclines are used clinically, attention should be paid to the detection of resistance genes in patients and corresponding treatment plans suitable for patients should be made.

[0005] Ureaplasma infection lacks typical clinical manifestations, and diagnosis relies on laboratory tests, including ureaplasma culture + PCR, chemical kit method, PCR method, mNGS, etc. Ureaplasma culture is the gold standard, but the culture cycle is long, the culture conditions are high, and it cannot distinguish between Uu and Up. The chemical kit method can identify Uu and Up, and some kits can be used for drug sensitivity identification. The detection time is shorter than the culture method, but it can only detect vaginal swab or nasopharyngeal swab specimens, and the sensitivity is lower than PCR. The cost of mNGS testing is relatively high, and it is often performed when the pathogen is unclear and the effect of conventional anti-infection treatment is poor.

[0006] Therefore, there is an urgent need for a specific, efficient, sensitive, and low-cost kit that can detect and identify Uu and Up and can also detect tetracycline resistance. Currently, there are commercial kits for detecting Uu and Up based on real-time fluorescence quantitative PCR technology, loop-mediated isothermal amplification (LAMP), and melting curve method on the market, but there is no kit for detecting Uu, Up combined with tetracycline resistance genes.

[0007] The dye cost of melting curve analysis technology is low and the detection speed is fast, but it cannot distinguish primer dimers or non-specific amplification products (prone to false positives), the detection requires high specificity of primer design, and it is impossible to perform single-tube multiple detection analysis. LAMP isothermal amplification detection technology has the advantages of rapid detection, simple operation, low detection cost, and high specificity, but its disadvantages include complex primer design, easy contamination, visual judgment of results is easily interfered by human factors, and it is impossible to distinguish multiple areas in one tube detection.

[0008] In view of this, the present invention is proposed. Summary of the invention

[0009] The object of the present invention is to provide a method and a detection kit for detecting Ureaplasma urealyticum, Ureaplasma microphylla and tetracycline resistance gene to solve the above technical problems.

[0010] The present invention is achieved in that:

[0011] In a first aspect, the present invention provides a nucleic acid composition for detecting Ureaplasma urealyticum, Ureaplasma parvum and tetracycline resistance gene, comprising: a first nucleic acid combination for detecting Ureaplasma urealyticum, a second nucleic acid combination for detecting Ureaplasma parvum and a third nucleic acid combination for detecting tetracycline resistance gene; the first nucleic acid combination comprises a primer sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the primer sequence shown in SEQ ID NO: 1-2, the second nucleic acid combination comprises a primer sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the primer sequence shown in SEQ ID NO: 4-5, and the third nucleic acid combination comprises a primer sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the primer sequence shown in SEQ ID NO: 5-6. The primer sequences shown in NO:7-8 have primer sequences with at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity.

[0012] The present invention provides a nucleic acid composition for multiple detection of Ureaplasma urealyticum (Uu), Ureaplasma microti (Up) and tetracycline resistance gene, PCR primers are designed for UreC gene of Uu, UreD gene of Up and tetracycline resistance gene tetM respectively, and a PCR detection method is established, which can quickly identify Uu, Up and tetracycline resistance gene tetM. The nucleic acid composition is prepared into a kit, which can specifically detect Uu, Up and tetracycline resistance gene tetM at the same time, and the sensitivity can reach 4 copies / reaction.

[0013] The specific primer pair provided by the present invention can quickly, sensitively and accurately detect and identify the infection status of Up and Uu from the sample to be tested, and can also detect the drug sensitivity of the tetracycline resistance gene tet (M), which is of great significance for early diagnosis, timely treatment and effective control of genital ureaplasma infection.

[0014] The first nucleic acid combination for detecting Ureaplasma urealyticum (Uu) specifically includes the following primer sequences, which are used for detecting the UreC gene:

[0015] Uu UreC gene forward primer: 5'TGTCTTCGGTGGTGGTAAAACTC3' (SEQ ID NO: 1);

[0016] Uu UreC gene reverse primer: 5'TCCATTACTTCAGCATTCCCTAACT3' (SEQ ID NO: 2).

[0017] The second nucleic acid combination for detecting Ureaplasma microti (Up) includes the following primer sequences, which are used for detecting the UreD gene:

[0018] Up UreD gene forward primer: 5'CATGGGTCTGCTTATCAATACGAA 3' (SEQ ID NO: 4);

[0019] Up UreD gene reverse primer: 5'TCCATGATTCCAAATGCTGATTC 3' (SEQ ID NO: 5).

[0020] The third nucleic acid combination for detecting tetracycline resistance gene includes the following primer sequence, which detects the tet (M) gene:

[0021] Tetracycline tet (M) forward primer: 5'TCTGCCGAAATTGTAATCAAACA3' (SEQ ID NO: 7)

[0022] Tetracycline tet (M) reverse primer: 5'AGATTCGGTAAAGTTCGTCACACA 3' (SEQ ID NO: 8).

[0023] In a preferred embodiment of the present invention, the first nucleic acid combination also includes a probe sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the probe sequence shown in SEQ ID NO:3, the second nucleic acid combination also includes a probe sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the probe sequence shown in SEQ ID NO:6, and the third nucleic acid combination also includes a probe sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the probe sequence shown in SEQ ID NO:9.

[0024] Probe for Uu UreC gene: 5'AACTCTACTATGAAGTTAGACGAC3' (SEQ ID NO: 3);

[0025] Probe for Up UreD gene: 5'TCAACCACGTAAAAAT 3' (SEQ ID NO: 6);

[0026] Probe for tetracycline tet (M): 5'AGGTAGAACTGTATCCTAATAT 3' (SEQ ID NO: 9).

[0027] In a preferred embodiment of the present invention, the 5' end of the probe sequence carries a fluorescent reporter group, and the 3' end carries a fluorescent quencher group; any method is feasible as long as fluorescence quenching can be achieved.

[0028] In a preferred embodiment of the present invention, the fluorescent reporter group is selected from any one of 5-FAM, 6-FAM, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, ROX, Texas Red, Cy5, Cy5.5 and Quasar670;

[0029] The fluorescence quenching group is selected from any one of TAMRA, BHQ1, BHQ2, BHQ3, MGB and QSY.

[0030] In a second aspect, the present invention provides an amplification system for detecting Ureaplasma urealyticum, Ureaplasma parvum and tetracycline resistance genes, which includes the above-mentioned nucleic acid composition for detecting Ureaplasma urealyticum, Ureaplasma parvum and tetracycline resistance genes and a PCR premix.

[0031] In a preferred embodiment of the present invention, the PCR premix includes: DNA polymerase, dNTPs, Mg 2+ and Buffer;

[0032] In a preferred embodiment of the present invention, the PCR premix is ​​qPCR Mix or PCR Mix; the qPCR Mix can be selected from commercially available qPCR Mix.

[0033] In a preferred embodiment of the present invention, the PCR premix is ​​PCR Mix, which includes a fluorescent dye.

[0034] Fluorescent dyes include, but are not limited to, any one of SYBR Green I, EvaGreen, Sytox Green, EtBr, SYBR GreenII, SYBR Gold, SYBR Safe, LC Green, GelGreen, GelRed, DAPI, Syto 9, Sytox Blue, SytoxRed, Sytox Orange and ThiazoleOrange.

[0035] In a third aspect, the present invention provides an application of a nucleic acid composition or amplification system for detecting Ureaplasma urealyticum, Ureaplasma parvum and tetracycline resistance genes in the preparation of detection products for detecting Ureaplasma urealyticum, Ureaplasma parvum and tetracycline resistance genes, and the detection products are reagents, kits and chips.

[0036] The form of the reagent includes but is not limited to: liquid, solid or semi-solid.

[0037] The chip includes but is not limited to a gene chip, such as embedding a nucleic acid composition in a gene chip.

[0038] In a fourth aspect, the present invention provides a kit, comprising: the above-mentioned nucleic acid composition for detecting Ureaplasma urealyticum, Ureaplasma parvum and tetracycline resistance gene or the above-mentioned amplification system, a positive control and a negative control.

[0039] The positive control is a plasmid containing: Ureaplasma urealyticum (Uu) target gene UreC, Ureaplasma microti (Up) UreD gene and tetracycline resistance gene (tet (M)). The three plasmids are mixed in equal volume ratio to form the positive control.

[0040] In a fifth aspect, the present invention provides a method for detecting Ureaplasma urealyticum, Ureaplasma parvum and tetracycline resistance genes, which comprises the following steps: mixing the above-mentioned nucleic acid composition or the above-mentioned amplification system with the DNA of the sample to be tested, performing PCR amplification, and the method is not intended for the diagnosis of the disease.

[0041] In a preferred embodiment of the present invention, in the reaction system of PCR amplification, the final concentration of the upstream primer and the downstream primer in the first nucleic acid combination is 0.2-0.8 μM, and the final concentration of the probe sequence is 0.02-0.4 μM; the final concentration of the upstream primer and the downstream primer in the second nucleic acid combination is 0.2-0.8 μM, and the final concentration of the probe sequence is 0.02-0.4 μM; the final concentration of the upstream primer and the downstream primer in the third nucleic acid combination is 0.2-0.8 μM, and the final concentration of the probe sequence is 0.02-0.4 μM. With the above-mentioned multiple primer probe concentration coordination, it has good sensitivity and specificity for detecting Ureaplasma urealyticum, Ureaplasma microphylla and tetracycline resistance genes. For example, the final concentration of the upstream primer and the downstream primer in the first nucleic acid combination is 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8 μM, and the final concentration of the probe sequence is 0.02-0.1 μM, 0.05-0.4 μM, 0.1-0.2 μM or 0.2-0.4 μM. The final concentration of the upstream primer and the downstream primer in the second nucleic acid combination is 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8 μM, and the final concentration of the probe sequence is 0.02-0.1 μM, 0.05-0.4 μM, 0.1-0.2 μM or 0.2-0.4 μM. The final concentration of the upstream primer and the downstream primer in the third nucleic acid combination is 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8 μM, and the final concentration of the probe sequence is 0.02-0.1 μM, 0.03-0.4 μM, 0.05-0.1 μM, 0.1-0.2 μM or 0.2-0.4 μM.

[0042] In the reaction system of PCR amplification, the final concentrations of the upstream primer and the downstream primer in the first nucleic acid combination are both 0.2 μM, and the final concentration of the probe sequence is 0.2 μM; the final concentrations of the upstream primer and the downstream primer in the second nucleic acid combination are both 0.3 μM, and the final concentration of the probe sequence is 0.2 μM; the final concentrations of the upstream primer and the downstream primer in the third nucleic acid combination are both 0.25 μM, and the final concentration of the probe sequence is 0.1 μM. This system has a better detection effect.

[0043] In a preferred embodiment of the present invention, PCR amplification is qPCR amplification or common PCR amplification. When performing detection, those skilled in the art can use a qPCR reaction system or a common PCR system.

[0044] In a preferred embodiment of the present invention, when qPCR amplification is performed, the reaction conditions include: 94°C to 98°C, 3 to 5 min; 94°C to 98°C, 5 to 10 s; 60°C, 34 to 40 s, during which fluorescence is collected and the cycle is repeated 35-45 times.

[0045] When performing ordinary PCR amplification, the reaction conditions include: 94°C ~ 98°C, 3 ~ 5 min; 94°C ~ 98°C, 5 ~ 10 s; 60°C, 34 ~ 40 s, cycle 35-45 times; and then run a high-resolution dissolution program.

[0046] As an alternative to the present invention, the probe detection method is transformed into high-resolution melting curve detection. The PCR amplification technology is combined with the melting curve analysis technology, and the gene sequence analysis technology is realized by relying on a high-resolution temperature detection PCR instrument and a new saturated fluorescent dye. The principle is that after the PCR is completed, the high-resolution dissolution program is directly run on the PCR amplification product, and the fluorescence intensity change of the saturated fluorescent dye in the amplicon is detected by the instrument to obtain a characteristic melting curve. Finally, the sequence variation is judged according to the position and morphological changes of the melting curve, and the sequence difference of a single base can be distinguished.

[0047] The saturation dye used for high-resolution melting curve amplification can be Lc Green, Ly Green or EvaGreen, and Eva Green is preferably used.

[0048] In a preferred embodiment of the present invention, the sample to be tested is a human or animal tissue, body fluid, vaginal swab, urethral swab, nasopharyngeal swab or environmental sample.

[0049] Environmental samples include but are not limited to: soil samples, ward samples, water samples, water-soil mixed samples, etc.

[0050] The present invention has the following beneficial effects:

[0051] The nucleic acid composition provided by the present invention can rapidly, sensitively, accurately and specifically detect and identify the infection of ureaplasma parvum (Up) and ureaplasma urealyticum (Uu) from a sample to be tested, and can also detect the drug sensitivity of the tetracycline resistance gene tet (M), which is of great significance for early diagnosis, timely treatment and effective control of genital ureaplasma infection.

[0052] In addition, the present invention also provides a method for detecting Ureaplasma urealyticum, Ureaplasma microti and tetracycline resistance gene, which has no cross reaction with Staphylococcus aureus and Streptococcus agalactiae and has good specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0054] Figure 1 This is a schematic diagram of the specificity test of Experimental Example 1 of the present invention;

[0055] Figure 2 The result of the sensitivity test of the template of 10 copies / μL in Experimental Example 2 of the present invention (blue amplification curve—Uu; light blue amplification curve—tet(M); red amplification curve—Up);

[0056] Figure 3 The result of the sensitivity test of the template of 2 copies / μL in Experimental Example 2 of the present invention (green amplification curve—Uu; red amplification curve—tet(M); blue amplification curve—Up));

[0057] Figure 4 The fluorescence quantitative result diagram of the three different primer-probe amplification templates in the primer-probe combination 1 of Experimental Example 3 of the present invention;

[0058] Figure 5 This is a fluorescence quantitative result diagram of the three different primer-probe amplification templates in the primer-probe combination 2 of Experimental Example 3 of the present invention;

[0059] Figure 6 This is a fluorescence quantitative result diagram of the three different primer-probe amplification templates in the primer-probe combination 4 of Experimental Example 3 of the present invention. DETAILED DESCRIPTION

[0060] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0061] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the capabilities of a skilled artisan. This technique is fully explained in the literature, such as Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Animal Cell Culture (RI Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction (PCR: The Polymerase Chain Reaction) (Academic Press, Inc.); Reaction" (Mullis et al., eds., 1994); and Current Protocols in Immunology (JE Coligan et al., eds., 1991), each of which is expressly incorporated herein by reference.

[0062] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0063] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0064] In the following examples and experimental examples, Uu refers to Ureaplasma urealyticum, Up refers to Ureaplasma microti, and tet (M) refers to tetracycline resistance gene.

[0065] Example 1

[0066] This embodiment provides a triple real-time fluorescence PCR detection kit for detecting Ureaplasma urealyticum, Ureaplasma microtyping, and tetracycline resistance gene tetM, including a first nucleic acid combination for detecting Ureaplasma urealyticum (Uu), a second nucleic acid combination for detecting Ureaplasma microtyping (Up), and a third nucleic acid combination for detecting tetracycline resistance gene.

[0067] 1. Sequence design of nucleic acid composition:

[0068] According to the UreC gene sequence of Uu, the UreD gene sequence of Up and the tetracycline resistance gene tet (M) gene sequence on Genbank, specific TaqMan probes and primers were designed using Primer 5.0 software. The primers and probes are shown in Table 1.

[0069] Table 1 Primer sequences

[0070]

[0071]

[0072] The first nucleic acid composition is as follows:

[0073] Uu UreC gene forward primer (Uu F):

[0074] 5'TGTCTTCGGTGGTGGTAAAACTC3' (SEQ ID NO: 1);

[0075] Uu UreC gene reverse primer (Uu R):

[0076] 5'TCCATTACTTCAGCATTCCCTAACT 3' (SEQ ID NO: 2);

[0077] Uu UreC gene probe (UuP):

[0078] 5'AACTCTACTATGAAGTTAGACGAC3' (SEQ ID NO:3).

[0079] The 5' end of the Uu UreC gene primer probe is labeled with a reporter fluorescent dye Fluorophore of FAM, and the 3' end is labeled with a fluorescent quencher group Quencher of MGB. The Uu UreC primer can detect Uu infection sensitively and specifically.

[0080] The second nucleic acid combination is as follows:

[0081] Up UreD gene forward primer (Up-F): 5'CATGGGTCTGCTTATCAATACGAA3' (SEQ ID NO: 4);

[0082] Up UreD gene reverse primer (Up-R): 5'TCCATGATTCCAAATGCTGATTC 3' (SEQ ID NO: 5);

[0083] Up UreD gene probe (Up-P): 5'TCAACCACGTAAAAAT3' (SEQ ID NO: 6).

[0084] The 5' end of the Up UreD gene primer probe is labeled with a reporter fluorescent dye Fluorophore ROX, and the 3' end is labeled with a fluorescent quencher Quencher MGB. The Up UreD primer can detect Up infection sensitively and specifically.

[0085] The third nucleic acid combination is as follows:

[0086] Tetracycline tet(M) forward primer (tet(M)F): 5'TCTGCCGAAATTGTAATCAAACA3' (SEQ ID NO: 7)

[0087] Tetracycline tet(M) reverse primer (tet(M) R): 5'AGATTCGGTAAAGTTCGTCACACA 3' (SEQ ID NO: 8)

[0088] Tetracycline tet(M) probe (tet(M)P): 5'AGGTAGAACTGTATCCTAATAT 3' (SEQ ID NO: 9)

[0089] The 5' end of the tetracycline tet (M) primer probe is labeled with a reporter fluorescent dye Fluorophore of VIC, and the 3' end is labeled with a fluorescent quencher group Quencher of MGB. The tetracycline tet (M) primer can sensitively and specifically detect tetracycline resistance gene tet (M) infection. Anti-PCR inhibitor factors are added to the reaction solution, so that the method provided by the present invention can be applied to the detection of complex clinical samples.

[0090] 2. Preparation of Positive Control

[0091] Three plasmid sequences containing the target gene sequences to be tested, Uu, Up and tetracycline resistance gene tet (M), were synthesized at Shanghai Sangon Biotechnology. pUC57 (2710 bp) was used as the vector. The inserted fragments of Uu, Up and tetracycline resistance gene tet (M) were 496 bp, 450 bp and 263 bp, respectively, and 4 μg of dry powder was synthesized for each target.

[0092] (1) Plasmid dry powder treatment

[0093] Centrifuge at 2000 rpm / min for 2 min, add 200 μL of nuclease-free water, at which point the theoretical concentrations of Uu, Up, and tetracycline resistance gene tet (M) plasmids are 5.69×10 9 copies / μL, 5.77×10 9 copies / μL, 6.14×10 9 copies / μL of the mother plasmid.

[0094] Copy number calculation formula: copies / ml (copy number) = (6.02 × 10 23 (copies / mole)×(concentration) / (MWg / mol).

[0095] (2) The three plasmid stock solutions were diluted 10-fold in six gradients using nuclease-free water, i.e., the theoretical concentrations were 5.69×10 3 copies / μL, 5.77×10 3 copies / μL, 6.14×10 3 copies / μL are used as test templates.

[0096] (3) The three plasmid dilutions with 1000 copies / μL were mixed in equal volume ratios and used as the positive control of the detection kit.

[0097] 3. Fluorescence PCR reaction system of the kit:

[0098] The fluorescent PCR reaction system of the kit is 2×Taqman plusMix for qPCR 10μl, 10μmol / L UuF / UuR / UuP 0.4μl each, 10μmol / L Up-F / Up-R / Up-P 0.4μl, 0.4μl and 0.3μl respectively, 10μmol / L tet(M)F / tet(M)R / tet(M)P 0.5μl, 0.5μl and 0.3μl respectively, the volume of template / negative control / positive control is 2μl, and sterile water is added to make the PCR system 20μl.

[0099] In addition, nuclease-free water was used as a negative control.

[0100] 4. The PCR reaction conditions of the kit are: 95℃ pre-denaturation for 3min, 94℃ for 5s, and 60℃ for 40s. In this step, fluorescence is collected, and the fluorescence values ​​of the three channels of FAM, ROX and VIC are collected at the same time. A total of 40 cycles are performed.

[0101] 5. Result determination

[0102] (1) Validity determination: The positive control should show a specific amplification curve and the Ct value should be less than 32, and the negative control should have no Ct value; otherwise, the test results are invalid.

[0103] (2) Samples with a Ct value of ≤40 in the FAM channel and No Ct in the ROX channel and VIC channel were judged as Uu positive;

[0104] (3) Samples with a Ct value of ≤40 in the ROX channel and No Ct in the FAM channel and VIC channel were judged as Up positive;

[0105] (4) Samples with a Ct value of ≤40 in the VIC channel and No Ct in the ROX channel and FAM channel were determined to be positive for the tetracycline resistance gene tet(M).

[0106] The specific primer pairs of ureaplasma parvum (Up), ureaplasma urealyticum (Uu) and tetracycline resistance gene tet (M) provided by the present invention can quickly, sensitively and accurately detect and identify the infection of Up and Uu from clinical samples, and can also detect the drug sensitivity of tetracycline resistance gene tet (M), which is of great significance for early diagnosis, timely treatment and effective control of genital ureaplasma infection.

[0107] Experimental Example 1

[0108] The triple real-time fluorescence PCR detection kit for detecting Ureaplasma urealyticum, Ureaplasma microti, and tetracycline resistance gene tetM provided in Example 1 was specifically verified.

[0109] Staphylococcus aureus (CCTCC AB 2010020) and Streptococcus agalactiae strains (ATCC 12386) were purchased from China Center for Type Culture Collection (CACC), and the bacteria were cultured according to the instructions for use of the strains. The corresponding DNA was extracted using an Ezup column bacterial genomic DNA extraction kit (Sangon Biotechnology, B518255) as a template. At the same time, a mixed plasmid of Uu, Up and tetracycline resistance gene tet (M) was used as a positive control, and nuclease-free water was used as a negative control. Amplification was performed using the kit of the present invention. The detection method was referred to Example 1. The detection results are shown in Table 2.

[0110] The operating procedures of the Ezup Column Bacterial Genomic DNA Extraction Kit are as follows:

[0111] (1) Take 1 ml of overnight cultured Staphylococcus aureus and Streptococcus agalactiae, add them to a 1.5 ml centrifuge tube, centrifuge at 8,000 rpm for 1 min at room temperature, discard the supernatant, and collect the cells. Add 100 μl of Buffer Digestion and 80 μl of lysozyme solution (add the corresponding lysozyme to the Enzymatic lysis buffer before use to prepare a 20 mg / ml lysozyme solution) to resuspend the bacterial solution, and incubate in a 37°C water bath for 30 min.

[0112] (2) Add 20 μl of Proteinase K solution and shake to mix. Incubate in a 56°C water bath for 30 min until the cells are completely lysed.

[0113] (3) Add 200 μl of Buffer BD, mix thoroughly by inversion, and incubate in a 70°C water bath for 10 min.

[0114] (4) Add 200 μl of anhydrous ethanol and mix thoroughly by inversion.

[0115] (5) Place the adsorption column in a collection tube and use a pipette to add all the solution and translucent fibrous suspension into the adsorption column. Let it stand for 2 min, then centrifuge at 12,000 rpm at room temperature for 1 min, and discard the waste liquid in the collection tube.

[0116] (6) Place the adsorption column back into the collection tube, add 500 μl of PW Solution, centrifuge at 10,000 rpm for 30 seconds, and discard the filtrate.

[0117] (7) Place the adsorption column back into the collection tube, add 500 μl of Wash Solution, centrifuge at 10,000 rpm for 30 seconds, and discard the filtrate.

[0118] (8) Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm for 2 min at room temperature to remove the remaining Wash Solution.

[0119] (9) Remove the adsorption column and place it in a new 1.5 ml centrifuge tube. Add 50-100 μl CE Buffer and let stand for 3 min. Centrifuge at 12,000 rpm for 2 min at room temperature to collect the DNA solution. The extracted DNA can be used for the next experiment immediately or stored at -20°C.

[0120] Table 2 Detection results of the kit of the present invention for different viruses

[0121]

[0122] Figure 1 The specificity test results show that the kit of the present invention has no cross reaction with Staphylococcus aureus and Streptococcus agalactiae, and has good specificity.

[0123] Experimental Example 2

[0124] Uu, Up and tetracycline resistance gene tet(M) triple real-time fluorescence PCR detection reagent, sensitivity verification.

[0125] The plasmids of Uu, Up and tetracycline resistance gene tet (M) in Example 1 were dissolved in nuclease-free water and diluted to a theoretical concentration of 5.69×10 3 copies / μL, 5.77×10 3 copies / μL, 6.14×10 3 The concentrations were quantified using a digital PCR instrument (Zhenzhun Biotech), and the quantitative results were 2.18×10 3 copies / μL, 3.01×10 3 copies / μL、9.86×10 2 The three digital quantitative plasmids were diluted to quantitative concentrations of 100 copies / μL, 10 copies / μL, 2 copies / μL, and 0.5 copies / μL, respectively, and the three plasmids of the same concentration of Uu, Up and tetracycline resistance gene tet (M) were mixed in equal volumes to obtain 1000 copies / μL, 100 copies / μL, 10 copies / μL, 2 copies / μL, and 0.5 copies / μL of three-plasmid mixed test samples. According to the detection method provided in Example 1, the reaction system was prepared, and the amount of the sample to be tested in each PCR system was 2 μL, and sensitivity detection was performed respectively.

[0126] Test results see Figure 2 and Figure 3 The detection sensitivity of Uu was 4 copies / reaction, the detection sensitivity of Up was 4 copies / reaction and the detection sensitivity of tetracycline resistance gene tet(M) was 4 copies / reaction.

[0127] Experimental Example 3

[0128] The multiple amplification system was screened. The detection template was 1000 copies / μL of an equal volume mixed sample of three plasmids of Uu, Up and tetracycline resistance gene tet (M). The amplification conditions were the same as step 4 of Example 1. The difference between the fluorescent PCR reaction system and Example 1 was only that the final concentrations of the upstream primer, downstream primer and probe were different, and the other conditions were the same.

[0129] After screening, Figure 4 , Figure 5 and Figure 6 The results showed that when the amplification system included the following "Group 3" concentration of primer probes, it had a good detection effect, specifically including a first nucleic acid combination for detecting Uu, a second nucleic acid combination for detecting Ureaplasma microphylla (Up) and a third nucleic acid combination for detecting tetracycline resistance genes, it had a good detection effect.

[0130] Table 3 Primer and probe concentration adjustment for reaction system optimization

[0131]

[0132]

[0133] Experimental Example 4

[0134] The repeatability performance of the kit was tested. Three batches of kits were prepared, namely Batch One, Batch Two and Batch Three. Two experimental operators used two qPCR instruments to perform the detection operation. The three-plasmid mixed samples of 2000 copies / μL and 20 copies / μL shown in the above Experimental Example 2 were used as templates for the amplification reaction, respectively. According to the detection method provided in Example 1, the reaction system was prepared, and the amount of the sample to be tested in each PCR system was 2μL. The repeatability test results were all good, with a CV value (coefficient of variation) of less than 5%. The results are shown in the following table

[0135] Table 4 Amplification results of repeatability performance test

[0136]

[0137] Table 5 Intra-batch CV values ​​of repeatability test

[0138]

[0139]

[0140] Table 6 CV values ​​between batches of repeatability test

[0141]

[0142] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A nucleic acid composition for detecting Ureaplasma urealyticum, Ureaplasma microphylla and tetracycline resistance gene, characterized in that: It includes: A first nucleic acid combination for detecting Ureaplasma urealyticum, a second nucleic acid combination for detecting Ureaplasma microphylla, and a third nucleic acid combination for detecting a tetracycline resistance gene; the first nucleic acid combination includes a primer sequence having at least 90% identity with the primer sequence shown in SEQ ID NO: 1-2, the second nucleic acid combination includes a primer sequence having at least 90% identity with the primer sequence shown in SEQ ID NO: 4-5, and the third nucleic acid combination includes a primer sequence having at least 90% identity with the primer sequence shown in SEQ ID NO: 7-8.

2. The nucleic acid composition for detecting Ureaplasma urealyticum, Ureaplasma parvum and tetracycline resistance gene according to claim 1, characterized in that: The first nucleic acid combination also includes a probe sequence that has at least 90% identity with the probe sequence shown in SEQ ID NO: 3, the second nucleic acid combination also includes a probe sequence that has at least 90% identity with the probe sequence shown in SEQ ID NO: 6, and the third nucleic acid combination also includes a probe sequence that has at least 90% identity with the probe sequence shown in SEQ ID NO:

9.

3. The nucleic acid composition for detecting Ureaplasma urealyticum, Ureaplasma microphylla and tetracycline resistance gene according to claim 2, characterized in that: The 5' end of the probe sequence carries a fluorescent reporter group, and the 3' end carries a fluorescent quencher group; Preferably, the fluorescent reporter group is selected from any one of 5-FAM, 6-FAM, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, ROX, Texas Red, Cy5, Cy5.5 and Quasar670; The fluorescence quenching group is selected from any one of TAMRA, BHQ1, BHQ2, BHQ3, MGB and QSY.

4. An amplification system for detecting Ureaplasma urealyticum, Ureaplasma microti and tetracycline resistance genes, characterized in that: The invention comprises the nucleic acid composition for detecting Ureaplasma urealyticum, Ureaplasma microphylla and tetracycline resistance gene as described in any one of claims 1 to 3 and a PCR premix.

5. The amplification system according to claim 4, characterized in that: The PCR premix includes: DNA polymerase, dNTPs, Mg 2+ and Buffer; Preferably, the PCR premix is ​​qPCR Mix or PCR Mix; Preferably, the PCR premix is ​​PCR Mix, which includes a fluorescent dye.

6. Use of the nucleic acid composition for detecting Ureaplasma urealyticum, Ureaplasma parvum and tetracycline resistance gene according to any one of claims 1 to 3 or the amplification system according to any one of claims 4 to 5 in the preparation of a detection product for detecting Ureaplasma urealyticum, Ureaplasma parvum and tetracycline resistance gene, characterized in that: The detection products are reagents, test kits and chips.

7. A kit, characterized in that: It includes: The nucleic acid composition for detecting Ureaplasma urealyticum, Ureaplasma microti and tetracycline resistance gene as described in any one of claims 1-3 or the amplification system, positive control and negative control as described in any one of claims 4-5.

8. A method for detecting Ureaplasma urealyticum, Ureaplasma microphylla and tetracycline resistance gene, characterized in that: The method comprises the following steps: mixing the nucleic acid composition according to any one of claims 1 to 3 or the amplification system according to any one of claims 4 to 5 with the DNA of the sample to be tested, and performing PCR amplification, and the method is not intended for the diagnosis of a disease.

9. The method according to claim 8, characterized in that In the reaction system of the PCR amplification, the final concentration of the upstream primer and the downstream primer in the first nucleic acid combination is 0.2-0.8 μM, and the final concentration of the probe sequence is 0.02-0.4 μM; the final concentration of the upstream primer and the downstream primer in the second nucleic acid combination is 0.2-0.8 μM, and the final concentration of the probe sequence is 0.02-0.4 μM; the final concentration of the upstream primer and the downstream primer in the third nucleic acid combination is 0.2-0.8 μM, and the final concentration of the probe sequence is 0.02-0.4 μM; Preferably, in the reaction system of the PCR amplification, the final concentrations of the upstream primer and the downstream primer in the first nucleic acid combination are both 0.2 μM, and the final concentration of the probe sequence is 0.2 μM; the final concentrations of the upstream primer and the downstream primer in the second nucleic acid combination are both 0.3 μM, and the final concentration of the probe sequence is 0.2 μM; the final concentrations of the upstream primer and the downstream primer in the third nucleic acid combination are both 0.25 μM, and the final concentration of the probe sequence is 0.1 μM.

10. The method according to claim 9, characterized in that The PCR amplification is qPCR amplification or common PCR amplification; Preferably, when performing qPCR amplification, the reaction conditions include: 94°C to 98°C, 3 to 5 min; 94°C to 98°C, 5 to 10 s; 60°C, 34 to 40 s, collecting fluorescence in this step, and cycling 35-45 times; When performing ordinary PCR amplification, the reaction conditions include: 94℃~98℃, 3~5min; 94℃~98℃, 5~10s; 60℃, 34~40s, 35-45 cycles; then run the high-resolution dissolution program; Preferably, the sample to be tested is a human or animal tissue, body fluid, vaginal swab, urethral swab, nasopharyngeal swab or environmental sample.

Images