SNP markers associated with wheat kernel type and uses thereof

Abstract

The present application relates to the technical field of genetic engineering, and discloses a SNP marker related to wheat kernel type and application thereof. The SNP site of the present application is located at 687135095 bp of wheat 1B chromosome, and has G / A polymorphism. Through phenotype difference analysis and exon capture technology, it is determined that the SNP is closely related to kernel type, and a specific KASP primer combination is developed for rapid and accurate identification of wheat kernel type. The technology has important significance in accelerating wheat high-yield breeding, not only improves selection efficiency and shortens breeding period, but also helps to quickly identify and cultivate wheat varieties with ideal kernel type. The KASP primer combination provides an effective tool for molecular marker-assisted selection, which can improve yield-related traits and thus improve overall yield and quality of crops.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more specifically, to a SNP marker related to wheat grain shape and its application. Background Technology

[0002] wheat( Triticum aestivum Wheat (L.) is one of the most widely cultivated food crops globally, and its high yield plays a vital role in food security. Wheat grain shape refers to the shape, size, and structural characteristics of wheat grains. It includes the length, width, and thickness of the grain. Grain shape not only affects wheat yield and quality but also its performance during processing. Wheat grain shape is one of the important indicators for evaluating and improving wheat, and it is of great significance to food production and the food industry. With the increasing global demand for food security and nutrition, optimizing wheat grain shape has become an important direction in breeding research.

[0003] Exome sequencing is a technique that uses sequence capture technology to capture and enrich DNA from exon regions of the entire genome, and then uses high-throughput sequencing technology to detect genetic mutations associated with variations in protein function. Compared to whole-genome sequencing, exome sequencing is more economical and efficient, especially in studying known SNPs, InDel, and other genetic variations.

[0004] KASP (Kompetitive Allele Specific PCR) is a molecular marker method based on SNP sites, widely popular in the field of genotyping due to its high stability, accuracy, and cost-effectiveness. KASP technology is particularly suitable for high-throughput analysis, especially when the sample size is large and the number of available SNP sites is limited. The application of KASP not only significantly accelerates the speed and efficiency of genotyping but also effectively reduces costs, thus showing broad application prospects in agricultural breeding, genetic research, and molecular diagnostics. Summary of the Invention

[0005] The purpose of this invention is to provide a SNP marker related to wheat grain shape and its application.

[0006] To achieve the objectives of this invention, in a first aspect, this invention provides an SNP marker related to wheat grain type, the marker containing a nucleotide sequence with a polymorphism of G / A at position 687135095 bp on wheat chromosome 1B.

[0007] The above physical locations are based on wheat genome version number IWGSC 2.1.

[0008] Furthermore, plants with the genotype AA containing the polymorphic loci of the marker have higher thousand-grain weight, grain length, grain width, and grain thickness compared to plants with the genotype GG.

[0009] In a second aspect, the present application provides a KASP primer combination for amplifying the marker, comprising a forward primer 1 (ACCTCTTTTTTCGACAGAG) as shown in SEQ ID NO: 1, a forward primer 2 (ACCTCTTTTTTCGACAGAA) as shown in SEQ ID NO: 2, and a reverse primer (TCTGCCAAAGTTCCTCTGGA) as shown in SEQ ID NO: 3.

[0010] Further, the 5' end of the forward primer 1 and the forward primer 2 in the KASP primer combination can be further connected to a fluorescently labeled sequence, such as FAM (GAAGGTGACCAAGTTCATGCT) or HEX (GAAGGTCGGAGTCAACGGATT).

[0011] In one embodiment of the present application, the KASP primer combination is as follows:

[0012] 687135095-F1: 5'-GAAGGTGACCAAGTTCATGCTACCTCTTTTTTCGACAGAG-3'; (SEQ ID NO: 4)

[0013] 687135095-F2: 5'-GAAGGTCGGAGTCAACGGATTACCTCTTTTTTCGACAGAA-3'; (SEQ ID NO: 5)

[0014] 687135095-R: 5'-TCTGCCAAAGTTCCTCTGGA-3' (SEQ ID NO: 3).

[0015] In a third aspect, the present application further provides a detection reagent or a kit containing the primer combination.

[0016] In a fourth aspect, the present application provides a method for identifying the grain type of a plant, comprising: using the DNA of a plant sample to be tested as a template, performing PCR amplification using the KASP primer combination or the detection reagent or kit, and determining the grain type of the plant sample to be tested according to the amplification result.

[0017] Preferably, the system used for PCR amplification includes 2xKASP Mix 4-6 μL, primer mixture 0.12-0.16 μL, DNA template 25-35 ng, and the rest is water, based on a total system of 10 μL.

[0018] The primer mixture, in 100 μL, comprises: 100 μM forward primer 1 10-14 μL, 100 μM forward primer 2 10-14 μL, 100 μM reverse primer 28-32 μL, and the rest is water.

[0019] Preferably, the reaction program for PCR amplification is: 95℃ 8-12min; 95℃ 15-25s, 61℃ 60s, 8-12 cycles, and the annealing temperature decreases by 0.5-0.7℃ in each cycle; 95℃ 15-25s, 55℃ 35-45s, 32-36 cycles; 25℃ 10-20min.

[0020] Further, judging the thousand-grain weight of the plant sample to be tested according to the amplification result comprises: analyzing the genotype of the polymorphic site contained in the marker in the amplification product, and the plant with genotype AA has higher thousand-grain weight, grain length, grain width and grain thickness than the plant with genotype GG.

[0021] Further, the plant is wheat.

[0022] In a fifth aspect, the present application provides any of the following applications of the marker, the marker combination or the detection reagent or kit:

[0023] (1) used for identifying, selecting and improving the grain type of wheat;

[0024] (2) used for early prediction of the grain type trait of wheat;

[0025] (3) used for molecular marker-assisted breeding of wheat;

[0026] (4) used for screening or cultivating high-yield plants.

[0027] By means of the above technical solutions, the present application has at least the following advantages and beneficial effects:

[0028] (I) The present application successfully identifies a SNP site closely related to the grain type of plants through phenotype difference analysis and exon capture sequencing technology. The polymorphism detection of the site can accurately and quickly evaluate the grain type characteristics of plants.

[0029] (II) Using KASP technology, the SNP site and the corresponding primer combination provided by the present application not only improve the efficiency of plant variety selection, but also help to shorten the breeding period and accelerate the cultivation of high-quality plant varieties. These markers have good genetic stability, high resolution, are suitable for high-throughput detection, and have significant application value in the field of plant breeding. BRIEF DESCRIPTION OF DRAWINGS

[0030] Figure 1is an exon SNP site map of TraesCS1B02G479200 gene obtained by the exon capture sequencing technology provided in Embodiment 1 of the present application.

[0031] Figure 2 is a statistical diagram of kernel traits of different genotypes at the site 687135095 on the 1B chromosome provided in Embodiment 2 of the present application.

[0032] Figure 3 is a genotyping result of wheat genotypes at the site 687135095 on the 1B chromosome provided in Embodiment 2 of the present application; wherein, AA represents 687135095-A, GG represents 687135095-G, and CK represents a no template control, i.e., using ultrapure water instead of sample DNA.

[0033] Figure 4 is a sequencing peak diagram of different genotypes at the site 687135095 on the 1B chromosome provided in Embodiment 2 of the present application. DETAILED DESCRIPTION

[0034] The present application aims to provide a SNP marker related to plant kernel traits and application thereof.

[0035] The present application adopts the following technical solution:

[0036] The present application provides a SNP molecular marker related to plant kernel traits, which contains a nucleotide sequence with polymorphism of G / A at the site 687135095 on the 1B chromosome of wheat.

[0037] Further, the plant with genotype AA at the polymorphism site contained in the marker has higher thousand kernel weight, kernel length, kernel width and kernel thickness than the plant with genotype GG.

[0038] The present application also provides a KASP primer combination for amplifying the marker, which includes a forward primer 1 (ACCTCTTTTTTCGACAGAG) as shown in SEQ ID NO: 1, a forward primer 2 (ACCTCTTTTTTCGACAGAA) as shown in SEQ ID NO: 2 and a reverse primer (TCTGCCAAAGTTCCTCTGGA) as shown in SEQ ID NO: 3.

[0039] Further, the 5' end of the forward primer 1 and the forward primer 2 in the KASP primer combination can be further connected with a fluorescent label sequence, such as FAM (GAAGGTGACCAAGTTCATGCT) or HEX (GAAGGTCGGAGTCAACGGATT).

[0040] In one specific embodiment of the present application, the KASP primer combination is as follows: In one specific embodiment of the present application, the KASP primer combination is as follows:

[0041] 687135095-F1: 5'-GAAGGTGACCAAGTTCATGCTACCTCTTTTTTCGACAGAG-3' (SEQ ID NO: 4)

[0042] 687135095-F2: 5'-GAAGGTCGGAGTCAACGGATTACCTCTTTTTTCGACAGAA-3' (SEQ ID NO: 5)

[0043] 687135095-R: 5'-TCTGCCAAAGTTCCTCTGGA-3' (SEQ ID NO: 3).

[0044] The application further provides a detection reagent or kit containing the primer combination.

[0045] The application further provides a method for identifying the grain type of a plant, comprising: using the DNA of a plant sample to be tested as a template, and performing PCR amplification using the KASP primer combination or the detection reagent or kit, and determining the grain type of the plant sample to be tested according to the amplification result.

[0046] Preferably, the system used for PCR amplification comprises 2xKASP Mix 4~6 μL, primer mixture 0.12~0.16 μL, DNA template 25~35 ng, and the rest is water, based on a total system of 10 μL.

[0047] The primer mixture comprises 100 μM forward primer 1 10~14 μL, 100 μM forward primer 2 10~14 μL, 100 μM reverse primer 28~32 μL, and the rest is water, based on 100 μL.

[0048] Preferably, the reaction program used for PCR amplification is: 95℃ 8~12min; 95℃ 15~25s, 61℃ 60s, 8~12 cycles, with the annealing temperature decreasing by 0.5℃~0.7℃ for each cycle; 95℃ 15~25s, 55℃ 35~45s, 32~36 cycles; 25℃ 10~20min.

[0049] Further, determining the grain type of the plant sample to be tested according to the amplification result comprises: analyzing the genotype of the polymorphic site contained in the marker in the amplification product, and plants with genotype AA have higher thousand-grain weight, grain length, grain width and grain thickness than plants with genotype GG.

[0050] Further, the plant is wheat.

[0051] In a fifth aspect, the present application provides any of the following applications of the marker, the marker combination, or the detection reagent or kit:

[0052] (1) for identification, selection and improvement of wheat kernel type;

[0053] (2) for early prediction of wheat kernel type traits;

[0054] (3) for wheat molecular marker-assisted breeding;

[0055] (4) for screening or breeding high-yield plants.

[0056] The following examples are used to illustrate the present application, but not to limit the scope of the present application. If not specifically indicated, the technical means used in the examples are the conventional means well known to those skilled in the art, and the raw materials used are commercially available.

[0057] The related wheat varieties (lines) involved in the following examples are all provided by Professor Zhang Xueyong of the Institute of Crop Science, Chinese Academy of Agricultural Sciences, and the related wheat is sown in Xinxiang, Henan, and harvested after physiological maturity, naturally dried and used for subsequent analysis.

[0058] It should be noted that, as a professional agricultural research institution, the applicant has long-term preservation of related germplasm materials, and the related wheat varieties are publicly available in the market or existing germplasm bank.

[0059] Example 1 Obtaining of SNP marker related to plant kernel type and KASP primer design

[0060] 1. Exome capture sequencing of 152 samples

[0061] The process of whole exome sequencing mainly includes the following four steps:

[0062] 1) Sample detection: Before DNA sequencing, the quality and quantity of sample DNA must be ensured by agarose gel electrophoresis and nanodrop detection. The DNA concentration should be no less than 20 ng / ul, and the total amount should be no less than 800 ng, to ensure the accuracy and repeatability of sequencing.

[0063] 2) Library construction: Covaris disruptor is used to randomly break the genomic DNA into 180-280 bp fragments. Then, the end repair, phosphorylation and polyA tailing of DNA are completed using Agilent SureSelect kit. The exonic region is enriched by liquid phase hybridization, and the biotin-labeled probe is specifically hybridized with the library with specific index, followed by PCR amplification. Finally, the quality of the amplified library is detected to ensure that the quality of the library before sequencing meets the standard.

[0064] 3) Library inspection: After the library construction, first, use Qubit 2.0 to carry out preliminary quantification. Then, use Agilent 2100 Bioanalyzer to detect the insert fragments to ensure the appropriate size. After passing, use Q-PCR to accurately quantify the effective concentration of the library to 3 nmol / L to ensure the quality and accuracy of the sequencing library.

[0065] 4) Sequencing: After passing the library inspection, according to the effective concentration of the library and the data requirement, use Illumina HiSeq platform to carry out PE150 sequencing. PE150 is double-end sequencing, each end reads 150 bp, uses the insert fragments of small fragment library to carry out high-throughput sequencing, which is convenient for subsequent sequence alignment and analysis, and improves the accuracy and reliability of the data.

[0066] 2, Obtain different wheat kernel type and SNP molecular marker development

[0067] In order to screen the key genes affecting wheat kernel type, first, the kernel type related traits of 152 wheat varieties were determined to evaluate the phenotypic variation. This basic data collection work is the first step to understand the genetic background of kernel type. The determination results are shown in Table 1, which lays the foundation for further gene analysis and breeding research.

[0068] Based on the 152 kernel type phenotype data obtained in step 2, combined with the exon capture sequencing analysis results, the contribution of SNP sites of important genes to kernel type was mined, and the TraesCS1B02G479200 gene exon on chromosome 1B of wheat genome was screened to exist SNP site, the thousand kernel weight, kernel length, kernel width and kernel thickness of the SNP variation site were significantly increased, and a significant site affecting wheat kernel type was identified (1B: 687135095bp) (part of the results are shown in Figure 1 ), and the site was named: 687135095.

[0069] Based on the above sequence difference, and based on the KASP principle, further developed and designed a primer set for PCR amplification to obtain the wheat molecular marker, the specific design is as follows:

[0070] 687135095-F1: 5'-GAAGGTGACCAAGTTCATGCTACCTCTTTTTTCGACAGAG-3' (5' end "GAAGGTGACCAAGTTCATGCT" part of the sequence is FAM labeled sequence)

[0071] 687135095-F2: 5'-GAAGGTCGGAGTCAACGGATTACCTCTTTTTTCGACAGAA-3', (5' end "GAAGGTCGGAGTCAACGGATT" part of the sequence is HEX labeled sequence)

[0072] 687135095-R: 5'-TCTGCCAAAGTTCCTCTGGA-3';

[0073] The primer pair combination of 687135095-F1 and 687135095-R is used to amplify the sequence of the 687135095 locus on the 1B chromosome in the wheat molecular marker with a G base.

[0074] The primer pair combination of 687135095-F2 and 687135095-R is used to amplify the sequence of the 687135095 locus on the 1B chromosome in the wheat molecular marker with an A base.

[0075] Example 2 Application of the SNP marker in identifying the grain type of wheat

[0076] 1. Based on the primer pair design in Example 1, the genotypes (GG 20 / AA 20) of 152 wheat materials were detected, and the correlation between the genotypes and the grain type phenotypes was identified. The specific process is as follows:

[0077] First, the genomic DNA of each wheat variety was extracted;

[0078] Then, according to the primers designed in Example 1, the extracted DNA was used as a template to perform PCR (using a Quant Studio1 fluorescent quantitative PCR instrument) detection analysis on different wheat samples.

[0079] Specifically, the 10 μL amplification system is designed as follows:

[0080] KASP Mix (2x), 5 μL; HiGeno 2x Probe Mix (provided at 2x concentration), containing Taq DNA polymerase, universal fluorescent reporter probe, dNTP, buffer, MgCl2, and reference dye ROX.

[0081] Primer Mix (primer mixture), 0.14 μL;

[0082] DNA, 30 ng;

[0083] ddH2O, supplemented to 10 μL.

[0084] Among them, the Primer Mix is 100 μL:

[0085] 687135095-F1, 100 μM, 12 μL;

[0086] 687135095-F2, 100 μM, 12 μL;

[0087] 687135095-R, 100 μM, 30 μL;

[0088] ddH2O, 46 μL.

[0089] PCR reaction program (may be adjusted according to the amplification results) is:

[0090] 95℃ 10min; 95℃ 20s, 61℃ 60 s (10 cycles, each cycle decreases by 0.6℃); 95℃ 20s, 55℃ 40 s, 34 cycles; 25℃ 15 min.

[0091] 2, using the genomic DNA extracted in step 1 of each wheat variety for ordinary PCR, sequencing to verify the accuracy of KASP genotyping.

[0092] First, specific primers are designed for amplification at 687135095 bp of wheat 1B chromosome (reference sequence is Chinese spring wheat), and the primer sequence is:

[0093] CF: 5'- GTGATGACCTTTCACCTTTGTGACT-3'

[0094] CR: 5'- GTGTGTGTTGCAGTATGCTTGCA-3'

[0095] Randomly select 6 wheat varieties of GG / AA genotype KASP genotyping results, use ordinary PCR instrument for amplification, electrophoresis detection and sequencing to verify the reliability of genotyping results.

[0096] Specific PCR amplification, 25 μL amplification system is designed as follows:

[0097] Full type Jinsheng biological 2x EasyTaq PCR SuperMix for PAGE (+dye), 10 μL;

[0098] Primer CF / CR, 1 μL each; primer concentration is 10 μM;

[0099] DNA, 60 ng;

[0100] ddH2O, supplemented to 25 μL.

[0101] PCR reaction program (may be adjusted according to the amplification results) is:

[0102] 94℃ 5min; 94℃ 30s, 58℃ 30 s, 72℃ 40s (35 cycles); 72℃ 10min; 16℃ end.

[0103] The statistical results of the specific genotype and the wheat kernel type related traits are shown in Tables 1-3 and Figures 1-4 .

[0104] Table 1 Corresponding results of different wheat variety genotypes and kernel type related traits

[0105]

[0106] Table 2 Corresponding results of different wheat variety genotypes and kernel type related traits

[0107]

[0108] Table 3 Corresponding results of different wheat variety genotypes and kernel type related traits

[0109]

[0110] From the above experimental results, it can be seen that the average 1000-grain weight of the GG genotype wheat is 32.423 g, the average 1000-grain weight of the AA genotype wheat is 49.074 g, and the 1000-grain weight of the AA genotype wheat is significantly higher than that of the GG genotype wheat, increasing by 51.36%; the average kernel length of the GG genotype wheat is 6.332 mm, the average kernel length of the AA genotype wheat is 7.266 mm, and the kernel length of the AA genotype wheat is significantly higher than that of the GG genotype wheat, increasing by 14.75%; the average kernel thickness of the GG genotype wheat is 2.701 mm, the average kernel thickness of the AA genotype wheat is 2.878 mm, and the kernel thickness of the AA genotype wheat is significantly higher than that of the GG genotype wheat, increasing by 6.55%; the average kernel width of the GG genotype wheat is 3.043 mm, the average kernel width of the AA genotype wheat is 3.688 mm, and the kernel thickness of the AA genotype wheat is significantly higher than that of the GG genotype wheat, increasing by 21.24%; all have significant differences at the level of p<0.01. That is, the 1000-grain weight, kernel length, kernel thickness and kernel width of the GG genotype wheat are significantly lower than those of the AA genotype wheat.

[0111] The present application can accurately determine the kernel type traits of wheat by carefully designed primers for detecting specific SNP sites. This technology not only provides accurate genotype information for molecular breeding, but also helps to quickly screen wheat varieties with ideal kernel type. In addition, the technical and theoretical support of the present application has a significant technical contribution to the development of high-yield wheat varieties, and promotes the progress of agricultural science and technology and the improvement of crop yield.

[0112] While the application has been described in detail and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that various modifications or changes can be made therein without departing from the spirit and scope thereof. Accordingly, it is intended that all such modifications and changes be included within the scope of the application as claimed.

Claims

1. A method for identifying plant grain shape, characterized in that, include: Using the DNA of the plant sample to be tested as a template, PCR amplification was performed using the KASP primer combination shown in SEQ ID NO:1-3 or a detection reagent containing the primer combination to be tested. The polymorphic site of G / A at 687135095bp on wheat chromosome 1B was amplified, and the grain type of the plant sample to be tested was determined based on the amplification results. The above physical locations are based on wheat genome version number IWGSC 2.1; Determining the grain type of the plant sample to be tested based on the amplification results includes: analyzing the genotype of the polymorphic sites in the amplification product; plants with genotype AA have higher thousand-grain weight, grain length, grain width, and grain thickness compared to plants with genotype GG. The plant in question is wheat.

2. The method according to claim 1, characterized in that, The total volume of the PCR amplification system is 10 μL. The system consists of 4–6 μL of 2×KASP Mix, 0.12–0.16 μL of primer mixture, 25–35 ng of DNA template, and the remainder is water.

3. The method according to claim 2, characterized in that, The reaction program used for PCR amplification was as follows: 95℃ for 8–12 min; 95℃ for 15–25 s, 61℃ for 60 s, 8–12 cycles, with the annealing temperature decreasing by 0.5℃–0.7℃ in each cycle; 95℃ for 15–25 s, 55℃ for 35–45 s, 32–36 cycles; 25℃ for 10–20 min.

4. Any of the following applications of the KASP primer combinations shown in SEQ ID NO:1-3 or detection reagents containing said primer combinations: (1) Used for the identification, selection and improvement of wheat grain type; (2) Used for early prediction of wheat grain shape traits; (3) Used for marker-assisted breeding of wheat grain shape traits; The particle shape refers to the thousand-grain weight, grain length, grain width, and grain thickness.

Images