Molecular marker associated with potato PVX virus resistance and application thereof

Abstract

The invention belongs to the technical field of potato breeding, and particularly relates to a molecular marker related to potato PVX virus resistance and application of the molecular marker. According to the embodiment of the invention, specific mutation sites closely related to disease resistance and susceptibility are screened from PVX resistance genes Rx1 and Rx2, and a PCR molecular marker and a KASP molecular marker are developed based on the mutation sites. The markers can be used for detecting the genotype of the potato at the specific site, so that the resistance of the potato to the PVX virus is identified, and an effective auxiliary tool is provided for potato PVX disease-resistant breeding.

Description

Technical Field

[0001] The present application relates to the technical field of potato breeding, and in particular to molecular markers associated with potato PVX virus resistance and applications thereof. Background Art

[0002] Potato (Solanum tuberosum L.) is the world's fourth largest food crop and is of great significance to global food security and economic stability (Islam et al., 2022; Rahman et al., 2022). However, potato production is affected by many diseases, including various viral diseases, resulting in significant declines in yield and quality. Among them, potato virus X (PVX) is a globally distributed single-stranded positive-sense RNA virus belonging to the genus Potexvirus of the family Alphaflexiviridae. Its single infection and combined infection with other viruses have a significant negative impact on potato yield (Liu et al., 2021; He et al., 2022).

[0003] At present, potato production mainly uses virus-free seed potatoes to control major viruses including PVX, but in temperate and tropical regions where viral diseases are prevalent, the re-infection of field potatoes makes this method limited in effectiveness. In addition, although genetic engineering methods such as CRISPR / Cas9-mediated resistance, RNA silencing-related resistance, and virus-induced genome editing can enhance resistance, they face restrictions on the safety of genetically modified organisms (Jiang et al., 2022; Tiwari et al., 2022; Lee et al., 2024). Therefore, discovering and utilizing potato's own resistance genes has become the most economical, efficient and environmentally friendly strategy.

[0004] Two cloned potato PVX virus extreme resistance genes: Rx1 gene and Rx2 gene, are located on chromosome XII of cultivated potato Solanum tuberosum subsp. andigena and chromosome V of wild potato Solanum acaule, respectively. Both genes encode immune proteins with CC-NB-LRR (coiled-coil nucleotide-binding leucine-rich repeat) structure, which can recognize PVX coat protein and thus stimulate extreme resistance (Liu et al., 2021; Tameling and Baulcombe, 2007). Although Rx1 and Rx2 genes have different origins and are located on different chromosomes, they show high sequence similarity at the nucleotide and amino acid levels. In addition, there are multiple R gene analogs in the potato genome that are highly similar to Rx1 and Rx2. These situations pose challenges to determining the presence of functional resistance genes and distinguishing the sources of the two resistance genes during marker-assisted selection (Ahmadvand et al., 2013).

[0005] A large number of molecular markers related to Rx1 and Rx2 genes have been reported, such as the markers Rx-1230, 1Rx1, and 5Rx1 for detecting the Rx1 gene, and the markers 10Rx2 and 106Rx2 for detecting the Rx2 gene (Ahmadvand et al., 2013; Shaikhaldein et al., 2018). However, these markers have limitations in resistance identification and screening, especially in judging the presence or absence of resistance genes, which may lead to inaccurate PVX resistance detection results (Nie et al., 2018; Caruana et al., 2019). At the same time, mutations in both Rx1 and Rx2 genes increase the risk of loss of their antiviral function (Hinge et al. 2021). Therefore, studying the relationship between the resistance function and gene variation of Rx1 and Rx2 genes and developing more accurate and efficient molecular markers are of great significance for accurately detecting PVX resistance in potatoes and promoting the breeding of antiviral varieties. Summary of the invention

[0006] The present application provides molecular markers and applications associated with potato PVX virus resistance. Based on mutation sites associated with PVX resistance, the embodiments develop PCR molecular markers and KASP molecular markers, which can more accurately detect Rx1 and Rx2 genes in various potato genotypes and large-scale breeding populations, thereby determining their resistance to PVX. Ultimately, these new tools will significantly improve the efficiency of potato PVX resistance breeding.

[0007] To this end, the embodiments of the present application disclose at least the following technical solutions:

[0008] In the first aspect, the embodiments disclose molecular markers associated with PVX virus resistance of potato Rx1 gene, including a single nucleotide polymorphism site (SNP-1) formed by a G mutation to C at 14,363bp of Rx1 gene (AJ011801.1), and a three-base (TCC) deletion mutation site (InDel-1) occurring at 14,025bp.

[0009] In a second aspect, the embodiments disclose molecular markers associated with PVX virus resistance of potato Rx2 gene, including a single nucleotide polymorphism site (SNP-2) formed by a C mutation to G at 2,482bp of Rx2 gene (AJ249448.1), and a three-base insertion mutation site (InDel-2) occurring at 2,215bp.

[0010] In a third aspect, the embodiments disclose a primer set for detecting the PVX resistance gene Rx1, including a PCR marker detection primer set, such as the DNA molecules described in SEQ ID NOs: 1 and 2; and a KASP marker detection primer set, such as the DNA molecules described in SEQ ID NOs: 3, 4 and 5.

[0011] In a fourth aspect, the embodiments disclose a primer set for detecting the PVX resistance gene Rx2, including a PCR marker detection primer set, such as the DNA molecules described in SEQ ID NOs: 6 and 7; and a KASP marker detection primer set, such as the DNA molecules shown in SEQ ID NOs: 8, 9 and 10.

[0012] In the fifth aspect, the embodiment discloses a PCR detection method for potato PVX virus resistance genes Rx1 and Rx2. The method comprises: extracting potato genomic DNA; performing PCR amplification on the genomic DNA using the PCR marker detection primer set described in the third aspect or the fourth aspect; performing electrophoresis detection on the PCR amplification product; and judging whether the potato contains resistance genes and whether the resistance genes contained are Rx1 or Rx2 according to the electrophoresis detection results.

[0013] In the sixth aspect, the embodiment discloses a KASP detection method for potato PVX virus resistance genes Rx1 and Rx2. The method comprises: extracting potato genomic DNA; performing competitive allele-specific PCR amplification on the genomic DNA using the KASP marker detection primer set described in the third aspect or the fourth aspect; performing fluorescence detection on the competitive allele-specific PCR amplification product; and judging whether the potato contains the PVX virus resistance gene based on the fluorescence signal of the amplification product.

[0014] In the seventh aspect, the embodiments disclose the use of the molecular markers described in the first or second aspect, and the primer sets described in the third or fourth aspect in preparing a kit for detecting potato PVX virus resistance genes Rx1 and Rx2 and / or potato PVX virus resistance marker-assisted breeding.

[0015] Compared with the prior art, this application has at least the following technical effects:

[0016] (1) The accuracy of molecular marker detection is significantly improved. The present application used the newly developed PVX virus resistance PCR marker and KASP marker to detect 58 potato materials with known PVX resistance. The results showed that the newly developed Rx1 gene PCR marker (Rx1-1PCRF / Rx1-PCRR) and KASP marker (Rx1-KASPF1 / Rx1-KASPR1 / Rx1-KASPR2) in the present application had completely consistent detection results in the above materials, and the accuracy of these marker detection results and resistance identification phenotypic results reached 98.3%, while the accuracy of the three reported Rx1 gene molecular markers Rx-1230, 1Rx1 and 5Rx1 in detecting the above materials was 70.7%, 74. 1% and 75.9%; at the same time, the newly developed Rx2 gene PCR markers (Rx2-PCRF / Rx2-PCRR) and KASP markers (Rx2-KASPF2 / Rx2-KASPR3 / Rx2-KASPR4) detected results in the above materials are also completely consistent, and the accuracy of these marker detection results and resistance identification phenotype results is 100.0%, while the accuracy of the two reported Rx2 gene molecular markers 10Rx2 and 106Rx2 in detecting the above materials is 72.4% and 75.9% respectively. In addition, in the inspection of PVX resistance genes Rx1 and Rx2 in the hybrid population (F1), it was found that the detection results of the newly developed Rx1 and Rx2 gene molecular markers are completely consistent with the F1 offspring resistance identification results, and the accuracy is 100%, indicating that the marker can be used for auxiliary selection in potato PVX resistance breeding.

[0017] (2) Newly developed high-throughput molecular markers provide breeders with an efficient and reliable tool set to accelerate the selection of potato PVX-resistant genotypes. Their high consistency, consistency across different genotyping platforms, and high correlation with phenotypic resistance identification make them a valuable asset in potato PVX virus-resistant variety selection programs.

[0018] (3) The KASP molecular marker provided in the present application can effectively distinguish between homozygous resistance genotypes and heterozygous resistance genotypes, as well as homozygous susceptible genotypes. Compared with traditional molecular markers, the detection results can be obtained without electrophoresis, and the operation convenience is significantly improved in the high-throughput molecular marker-assisted selection process of potato PVX virus resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of the structure of Rx1 and Rx2 genes and their encoded proteins provided in the embodiment. Among them, the DNA coding sequence is represented by a straight line (black), and the intron sequence is represented by a dotted line; the protein sequence and functional domain are represented by rectangles of different colors; the numerical value marked on the sequence represents the position information corresponding to the DNA sequence or protein sequence; the PVX-Rx1230 marker area is the target area for molecular marker screening of this application.

[0020] Figure 2 The electrophoresis diagram provided in the example is the detection of some potato materials using Rx1 and Rx2 gene PCR molecular markers. "M" stands for Marker; A, the detection result of Rx1 gene molecular marker; B, the detection result of Rx2 gene molecular marker; S and R represent susceptibility and resistance to PVX virus, respectively; 1-20 are commercial potato varieties Huashu No. 1, Huashu No. 2, Huashu No. 3, Huashu No. 4, Huayu Shu No. 5, Huayu No. 6, Huashu No. 7, Huashu No. 8, Huashu No. 9, Huashu No. 10, Huashu No. 11, Huashu No. 12, Huashu No. 13, Huashu No. 41, Huashu No. 15, Huashu No. 16, Huacai No. 1, Huacai No. 3, Huaen No. 1, and Huaen No. 2; 21, the positive control resistant variety Atlantic containing Rx1 gene; 22, the positive control resistant material MPI.163.613.63 containing Rx2 gene; 23-24, the negative control susceptible varieties Kexin No. 1 and Zhongshu No. 3 without Rx1 and Rx2 genes. Material 22 (MPI.163.613.63) needs to be obtained from the National Potato Germplasm Resource Bank, and the rest of the materials are commercial varieties.

[0021] Figure 3 Schematic diagram of KASP marker primer sets for Rx1 and Rx2 genes respectively provided in the examples (including a common forward primer and two allele-specific reverse primers). The target SNP is highlighted in red, and the position of the SNP in the coding sequence (CDS) is indicated by numbers. FAM and HEX represent the fluorescent groups carried by the two allele primers, corresponding to the favorable allele and unfavorable allele, respectively.

[0022] Figure 4 The fluorescence detection results of KASP labeling provided in the examples. Figure 4 A is the detection result of KASP marker of Rx1 gene in 58 potato materials. Figure 4 B is the detection result of KASP marker of Rx1 gene in the hybrid F1 population between the resistant male parent Huashu No. 1 (Rrrr) containing Rx1 gene and the susceptible female parent Huacai No. 1 (rrrr) without resistance gene. Figure 4C is the detection result of KASP marker of Rx2 gene in 7 potato materials. Figure 4 D is the result of KASP marker detection of Rx2 gene in the hybrid F1 population of Huashu No. 16 (Rrrr), a resistant female parent with Rx2 gene, and Huacai No. 3 (rrrr), a susceptible male parent without resistance gene. NTC represents negative control, small green triangles represent homozygous susceptible genotypes (unfavorable alleles) without resistance gene, and small red triangles represent heterozygous resistant genotypes with resistance gene (two fluorescences are detected at the same time, containing favorable alleles and unfavorable alleles).

[0023] Figure 5 This is a screenshot of the effect of detecting PVX resistance of 58 potato materials using PVX anti-molecular markers provided in the example.

[0024] In the figure, each potato variety was grafted and inoculated with PVX-HB isolate for 3 weeks before ELISA testing to identify PVX resistance, R for resistance (ELISA reading less than 0.1), S for susceptible (ELISA reading greater than 0.5); each variety was tested with published Rx1 and Rx2 gene-related molecular markers after genomic DNA extraction, "+" indicates the presence of a band; "-" indicates the absence of a band, and the highlighted green indicates that the test result is accurate, that is, the molecular marker is consistent with the resistance identification result; red indicates a false positive test result, that is, the molecular marker test result is positive, while the resistance identification result is susceptible; blue indicates a false negative test result, that is, the molecular marker test result is negative, while the resistance identification result is resistant. DETAILED DESCRIPTION

[0025] In order to make the purpose, technical solutions and advantages of this application clearer, the present application is further described in detail below in conjunction with specific examples. It should be emphasized that the embodiments described herein are only used to explain the technical content of this application and are not used to limit the scope of this application. The reagents not described separately in detail in this application are all conventional reagents and can be obtained through commercial channels; the methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art.

[0026] Screening of molecular markers

[0027] 1. Identification of PVX resistance in potato materials

[0028] Twenty potato materials obtained from Huazhong Agricultural University (HZAU) were inoculated with PVX friction and grafting, and then the virus was detected by ELISA three weeks after inoculation. Only materials with no virus detected by friction and grafting were determined to be PVX extremely resistant materials. In addition, the potato variety Atlantic, which was reported to contain the Rx1 gene in the literature, was used as a positive control for Rx1, and MPI.163.613.63, which was reported to contain the Rx2 gene in the literature, was used as a positive control for Rx2, while the varieties Kexin No. 1 and Zhongshu No. 3 were used as negative controls without Rx1 and Rx2 resistance genes. Thus, 9 materials with extreme resistance to PVX virus were obtained, namely: Huashu No. 1, Huashu No. 2, Huashu No. 4, Huashu No. 12, Huashu No. 13, Huashu No. 14, Huashu No. 15, Huashu No. 16, and Huaen No. 2. There are 11 susceptible materials, namely: Huashu No. 3, Huayu No. 5, Huayu No. 6, Huashu No. 7, Huashu No. 8, Huashu No. 9, Huashu No. 10, Huashu No. 11, Huacai No. 1, Huacai No. 3, and Huaen No. 1.

[0029] 2. Sequencing of the CDS region of the resistance gene

[0030] According to the above resistance identification results, 7 extremely resistant varieties (Huashu No. 1, Huashu No. 2, Huashu No. 4, Huashu No. 13, Huashu No. 15, Huashu No. 16, Huaen No. 2) and 5 susceptible varieties (Huashu No. 3, Huayu No. 6, Huashu No. 9, Huacai No. 1, Huaen No. 1) were randomly selected, and genomic DNA was extracted using the CTAB method. The partial CDS region of the PVX resistance gene Rx1 and Rx2 gene was amplified using primers PVX-Rx1230 (Mori et al., 2011), and TA clones were constructed and sequenced ( Figure 1 In addition, the positive control variety Atlantic containing the Rx1 gene, the positive control MPI163.613.63 containing the Rx2 gene, and the negative control Kexin 1 without the Rx1 and Rx2 resistance genes were also amplified using the same primers and subjected to TA cloning and sequencing.

[0031] 3. Analyze sequencing data to identify SNP or Indel variations between resistant and sensitive materials

[0032] The data obtained from the above sequencing were compared with the Rx1 reference gene (AJ011801.1) and the Rx2 reference gene (AJ249448.1) using MEGAXI software (version 0.13). Combined with the results of PVX resistance identification of the sequenced materials, SNiplay (https: / / sniplay.southgreen.fr / cgi-bin / home.cgi) was used to discover variant sites associated with disease-resistant and susceptible phenotypes.

[0033] After sequence analysis, two variant sites highly correlated with PVX resistance mediated by the Rx1 gene were discovered: SNP-1 and InDel-1, and two variant sites highly correlated with PVX resistance mediated by the Rx2 gene were discovered: SNP-2 and InDel-2, which can be used to detect and distinguish the two PVX virus resistance genes.

[0034] SNP-1 is a single nucleotide polymorphism (SNP) site formed by the mutation of G to C at 14,363bp of the Rx1 reference gene (AJ011801.1).

[0035] InDel-1 is a three-base (TCC) deletion mutation site (InDel) occurring at 14,025 bp of the Rx1 reference gene (AJ011801.1).

[0036] SNP-2 is a single nucleotide polymorphism (SNP) site formed by a mutation from C to G at 2,482bp of the Rx2 reference gene (AJ249448.1).

[0037] InDel-2 is a three-base (TCC) insertion mutation site (InDel) occurring at 2,215 bp of the Rx2 reference gene (AJ249448.1). Application of PCR Molecular Markers of Rx1 and Rx2 Genes

[0038] Based on the resistance-related mutation sites discovered in the examples, the present application designs PCR primer sets, detection methods and applications for detecting resistance genes Rx1 and Rx2, respectively.

[0039] The embodiment discloses a primer set for PCR detection of the Rx1 gene, including the DNA molecules described in SEQ ID NOs: 1 and 2. The primer set can specifically detect the presence of the Rx1 gene using two resistance-related mutation sites, SNP-1 and InDel-1.

[0040] The embodiment discloses a primer set for PCR detection of the Rx2 gene, including the DNA molecules described in SEQ ID NOs: 6 and 7. The primer set can specifically detect the presence of the Rx2 gene using two resistance-related variation sites, SNP-2 and InDel-2.

[0041] In addition, the embodiment also discloses a method for detecting potato PVX resistance gene by PCR. The method comprises: extracting potato genomic DNA; performing PCR amplification on the genomic DNA using the primer set; performing electrophoresis detection on the PCR amplification product; and judging whether the potato contains resistance gene and the type of resistance gene contained according to the electrophoresis detection result.

[0042] In some embodiments, the DNA molecules described in SEQ ID NOs: 1 and 2 are used as primers to perform PCR amplification on potato genomic DNA to determine whether the Rx1 gene exists.

[0043] Upstream primer (Rx1-PCRF): CACCTTCAGGTTCTACGC (SEQ ID NO: 1)

[0044] Downstream primer (Rx1-PCRR): ACGGCAATCTCTAAGAATAACT (SEQ ID NO: 2)

[0045] In some embodiments, the DNA molecules described in SEQ ID NOs: 6 and 7 are used as primers to perform PCR amplification on potato genomic DNA to determine whether the Rx2 gene exists.

[0046] Upstream primer (Rx2-PCRF): ACCTTCAGGTTCTACTCCGC (SEQ ID NO: 6)

[0047] Downstream primer (Rx2-PCRR): CATCATCCAGAAACAAGAAGT (SEQ ID NO: 7)

[0048] Specifically, some embodiments provide a method for detecting potato PVX resistance gene by PCR, including:

[0049] 1) Breeds and populations to be tested

[0050] PVX resistance screening was performed using 58 commercial varieties and two hybrid populations collected in the laboratory using the newly developed PCR markers. One of the two populations was a hybrid F1 population of the resistant male parent Huashu No. 1 (Rrrr) containing the Rx1 gene and the susceptible female parent Huacai No. 1 (rrrr) without the resistance gene; the other was a hybrid F1 population of the resistant female parent Huashu No. 16 (Rrrr) containing the Rx2 gene and the susceptible male parent Huacai No. 3 (rrrr) without the resistance gene.

[0051] 2) Extraction of genomic DNA

[0052] The CTAB method was used to extract genomic DNA from potato varieties and population progeny materials.

[0053] 3) PCR and product electrophoresis detection

[0054] The genomic DNA was amplified by PCR using primer sets Rx1-PCRF (SEQ ID NO: 1) and Rx1-PCRR (SEQ ID NO: 2). Alternatively, the genomic DNA was amplified by PCR using primer sets Rx2-PCRF (SEQ ID NO: 6) and Rx2-PCRR (SEQ ID NO: 7). The PCR amplification products of these genomic DNAs were respectively detected by 1% agarose gel.

[0055] The PCR amplification reaction system (10 μl) included 1.0 μL of 50 ng / μL DNA template, 0.5 μL of 10 μM upstream and downstream primers, 5.0 μL of 2×FtaqPCRmix (Zomanbio, Beijing, China), and 3.0 μL of ddH2O. The PCR reaction program was as follows: 94°C for 5 min; 35 cycles of 94°C for 30 s, annealing temperature of 63°C (Rx1) or 61°C (Rx2) for 30 s, and 72°C for 30 s; and finally extension at 72°C for 10 min.

[0056] 4) Test results

[0057] In the Rx1 gene PCR molecular marker detection, if the electrophoresis detects a band of 374bp, the Rx1 resistance gene molecular marker detection of the test material is judged to be positive, otherwise it is negative. In the Rx2 gene PCR molecular marker detection, if the electrophoresis detects a band of 302bp, the Rx2 resistance gene molecular marker detection of the test material is judged to be positive, otherwise it is negative.

[0058] The results of the material Rx1 and Rx2 gene molecular marker detection were compared with the PVX resistance identification results. If one of the molecular markers was detected as positive and the material resistance was also identified as PVX virus resistant, the detection result was consistent with the actual resistance and the marker detection result was accurate; if one of the molecular markers was detected as positive and the material resistance was identified as PVX virus susceptible, the detection result was inconsistent with the actual resistance and the marker detection result was false positive; if both molecular markers were detected as negative and the material resistance was identified as PVX virus resistant, the detection result was inconsistent with the actual resistance and the marker detection result was false negative ( Figure 2 ).

[0059] In the example of using PCR molecular markers to detect 58 known resistant varieties Rx1 and Rx2, the accuracy of primers Rx1-PCRF and Rx1-PCRR in detecting the Rx1 gene was 98.3%, with only 1.7% of the samples showing false positives, while the accuracy of primers Rx2-PCRF and Rx2-PCRR in detecting the Rx2 gene was 100.0%, both of which were significantly higher than the detection accuracy of other molecular markers in the prior art. The reported molecular markers of Rx1 gene, PVX-Rx1230, 1Rx1 and 5Rx1, had detection accuracy rates of 70.7%, 74.1% and 75.9% for 58 potato varieties, respectively, with false positive rates of 25.9%, 22.4% and 19.0%, and false negative rates of 3.4%, 3.4% and 5.2%; the reported molecular markers of Rx2 gene, 10Rx2 and 106Rx2, had detection accuracy rates of 72.4% and 75.9% for 58 potato varieties, with false positive rates of 19.0% and 6.9%, and false negative rates of 8.6% and 17.2% ( Figure 5 ). In addition, two F1 populations were tested using PCR detection primers for Rx1 and Rx2 genes, and the marker detection results were completely consistent with the resistance identification results, indicating that the newly developed PCR molecular marker can accurately identify PVX resistance.

[0060] Application of KASP molecular markers in Rx1 and Rx2 genes

[0061] Based on the resistance-related mutation sites found in the examples, the present application also designed KASP primer sets for detecting resistance genes Rx1 and Rx2 ( Figure 3 ), detection methods and applications.

[0062] The embodiment discloses a primer set for detecting KASP of the Rx1 gene, including DNA molecules as described in SEQ ID NOs: 3, 4 and 5. The primer set can detect the genotype of the resistance-related variation site SNP-1 of the Rx1 gene.

[0063] The embodiment discloses a primer set for detecting KASP of the Rx2 gene, including DNA molecules as described in SEQ ID NOs: 8, 9 and 10. The primer set can detect the genotype of the resistance-related variation site SNP-2 of the Rx2 gene.

[0064] In addition, the embodiment also discloses a method for detecting potato PVX resistance gene by KASP. The method comprises: extracting potato genomic DNA; performing PCR amplification on the genomic DNA using the primer set; performing fluorescence detection on the competitive allele-specific PCR amplification product; and judging whether the potato contains PVX virus resistance gene according to the fluorescence signal of the competitive allele-specific PCR amplification product.

[0065] In some embodiments, the DNA molecules described in SEQ ID NOs: 3, 4 and 5 are used as primer sets to perform KASP detection on potato genomic DNA to determine the genotype of the Rx1 gene resistance-related loci.

[0066] Universal forward primer (Rx1-KASPF1): AGTAGTGATCACTTTCCGTACCTTGAACGA (SEQ ID NO: 3)

[0067] Allele-specific reverse primer 1 (Rx1-KASPR1): FAM-CAAATTACGGCAATCTCTAAGAATAAC (SEQ ID NO: 4)

[0068] Allele-specific reverse primer 2 (Rx1-KASPR2): HEX-CCAAATTACGGCAATCTCTAAGAATAAG (SEQ ID NO: 5)

[0069] In some embodiments, the DNA molecules described in SEQ ID NOs: 8, 9 and 10 are used as primer sets to perform KASP detection on potato genomic DNA to determine the genotype of the Rx2 gene resistance-related loci.

[0070] Universal forward primer (Rx2-KASPF2): GTTGAGGAAGGGTTTCCTCACTTGAA (SEQ ID NO: 8)

[0071] Allele-specific reverse primer 1 (Rx2-KASPR3): FAM-GAATGTATACATCATCCAGAAACAAGAAG (SEQ ID NO: 9)

[0072] Allele-specific reverse primer 2 (Rx2-KASPR4): HEX-GAATGTATACATCATCCAGAAACAAGAAC (SEQ ID NO: 10)

[0073] Specifically, some embodiments provide a method for detecting potato PVX resistance gene using KASP, including:

[0074] 1) Breeds and populations to be tested

[0075] PVX resistance screening was performed using 58 commercial varieties and two hybrid populations collected in the laboratory using the newly developed PCR marker. One of the two populations was a hybrid F1 population of the resistant male parent Huashu No. 1 (Rrrr) containing the Rx1 gene and the susceptible female parent Huacai No. 1 (rrrr) without the resistance gene. The other was a hybrid F1 population of the resistant female parent Huashu No. 16 (Rrrr) containing the Rx2 gene and the susceptible male parent Huacai No. 3 (rrrr) without the resistance gene.

[0076] 2) Extraction of genomic DNA

[0077] The CTAB method was used to extract genomic DNA from potato varieties and population progeny materials.

[0078] 3) Competitive allele-specific PCR and product fluorescence detection

[0079] Competitive allele-specific PCR amplification of genomic DNA was performed using primer sets Rx1-KASPF1, Rx1-KASPR1, and Rx1-KASPR2. Alternatively, competitive allele-specific PCR amplification of genomic DNA was performed using primer sets Rx2-KASPF2, Rx2-KASPR3, and Rx2-KASPR4. Fluorescence detection was performed on the competitive allele-specific PCR amplification products of these genomic DNAs.

[0080] The KASP reaction system (10 μL) included: 2.5 μL of 20 ng / μL genomic DNA template, 0.15 μL of KASP primer mixture (containing 30 μM KASP universal forward primer and 12 μM two allele-specific reverse primers), 5 μL of 2×KASP Master mix (LGC Biosearch Technologies), and 2.35 μL of ddH2O.

[0081] The KASP reaction program includes I: KASP thermal cycle: 94℃ pre-denaturation for 15min; 94℃ denaturation for 20s; 61-55℃ annealing and extension for 60s, 10 cycles (0.6℃ lowered for each cycle); 94℃ denaturation for 20s; 55℃ annealing and extension for 60s, 26 cycles; 37℃ reading for 1min. II: KASP recovery: 94℃ denaturation for 20s; 57℃ extension for 60s; 37℃ reading for 1min. If the detection results of different alleles are not separated well on the two-dimensional map, repeat step II twice (3 times in total) and read at 37℃ for 1min; after the reaction, the sample allele typing is judged according to the two fluorescent signals.

[0082] 4) Test results

[0083] In the KASP molecular marker detection of the Rx1 gene, if only the FAM fluorescence signal is detected, the SNP-1 site of the test material is judged to be a homozygous favorable allele (GG), which theoretically exhibits disease resistance. If only the HEX fluorescence signal is detected, the SNP-1 site of the test material is judged to be a homozygous unfavorable allele (CC), which theoretically exhibits disease susceptibility. If both the FAM and HEX fluorescence signals are detected, the SNP-1 site of the test material is judged to be a heterozygous allele GC, which theoretically exhibits disease resistance. Similarly, in the KASP molecular marker detection of the Rx2 gene, if only the FAM fluorescence signal is detected, the SNP-2 site of the test material is judged to be a homozygous favorable allele (CC), which theoretically exhibits disease resistance. If only the HEX fluorescence signal is detected, the SNP-2 site of the test material is judged to be a homozygous unfavorable allele (GG), which theoretically exhibits disease susceptibility. If both the FAM and HEX fluorescence signals are detected, the SNP-2 site of the test material is judged to be a heterozygous allele (CG), which theoretically exhibits disease resistance ( Figure 4 ).

[0084] In the example of using KASP molecular markers to detect 58 known resistant varieties Rx1 and Rx2, the detection results were completely consistent with the PCR marker results ( Figure 5 ), that is, the accuracy of primers Rx1-KASPF1, Rx1-KASPR1, and Rx1-KASPR2 in detecting the Rx1 gene is 98.3%, with a false positive rate of 1.7%, and the accuracy of primers Rx2-KASPF2, Rx2-KASPR3, and Rx2-KASPR4 in detecting the Rx2 gene is also 100.0%, both of which are significantly higher than the detection accuracy of other molecular markers in the prior art. The reported Rx1 gene molecular markers PVX-Rx1230, 1Rx1, and 5Rx1, the accuracy of the detection results of 58 potato varieties were 70.7%, 74.1%, and 75.9%, respectively; the reported Rx2 gene molecular markers 10Rx2 and 106Rx2, the accuracy of the detection results of 58 potato varieties were 72.4% and 75.9%, respectively. Figure 4 and Figure 5 In addition, the two F1 populations were tested using KASP detection primers for the Rx1 and Rx2 genes, and the marker detection results were completely consistent with the resistance identification results ( Figure 5 ), and KSAP marker detection does not require electrophoresis and is more efficient. These results indicate that the newly developed KASP molecular marker can accurately and efficiently identify PVX resistance.

[0085] The above is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. Molecular markers associated with the potato PVX virus resistance gene Rx1, including a single nucleotide polymorphism site (SNP) at 14,363bp of the Rx1 reference gene (AJ011801.1) where G mutates to C, and a three-base (TCC) deletion mutation site (InDel) at 14,025bp.

2. Molecular markers associated with the potato PVX virus resistance gene Rx2, including a single nucleotide polymorphism site (SNP) at 2,482bp of the Rx2 reference gene (AJ249448.1) where C mutates to G, and a three-base insertion mutation site (InDel) at 2,215bp.

3. A primer set for detecting potato PVX resistance gene Rx1, comprising a PCR primer set, such as the DNA molecules described in SEQ ID NOs: 1 and 2; and a KASP primer set, such as the DNA molecules described in SEQ ID NOs: 3, 4 and 5.

4. A potato PVX resistance gene Rx2 detection primer set, comprising a PCR detection primer set, such as the DNA molecules described in SEQ ID NOs: 6 and 7; and a KASP detection primer set, such as the DNA molecules shown in SEQ ID NOs: 8, 9 and 10.

5. PCR detection method for potato PVX resistance gene, including: Extracting potato genomic DNA; Performing PCR amplification on the genomic DNA using the PCR primer set described in claims 3 and 4; The PCR amplification product is subjected to electrophoresis detection; and according to the electrophoresis detection result, it is determined whether the potato contains the resistance gene, and whether the contained resistance gene is Rx1 or Rx2.

6. KASP detection method for potato PVX resistance gene, including: Extracting potato genomic DNA; Performing competitive allele-specific PCR amplification on the genomic DNA using the KASP primer set described in claims 3 and 4; The competitive allele-specific PCR amplification product is subjected to fluorescence detection; and whether the potato still has the resistance gene is determined based on the fluorescence signal of the amplification product.

7. Use of the molecular marker according to claim 1 or 2, or the primer set according to claim 3 or 4, in the preparation of a kit for detecting potato PVX resistance genes and / or in potato PVX resistance molecular marker-assisted breeding.

Images