A multiplex detection kit for respiratory pathogens
By using specific primers and probe sequences on the general fluorescence quantitative PCR instrument on the market, the rapid and accurate detection of respiratory pathogens is achieved, and the problems of slow detection speed and dependence on specific instruments in the prior art are solved, which is suitable for a variety of detection scenarios.
Patent Information
- Application Number
- CN202311617734.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2023-09-27
- Filing Date
- 2023-11-29
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2043-11-29
AI Technical Summary
In the detection of respiratory pathogens, especially adenovirus, parainfluenza virus and rhinovirus, the prior art has the problem of slow detection speed and dependent on specific instruments and reagents for accuracy, making it difficult to achieve fast and accurate detection on the general instrument platform of the market.
It provides a respiratory pathogen multiplex detection kit containing specific primers and probe sequences, which can be quickly detected on commonly used fluorescence quantitative PCR instruments on the market, and the actual detection time only takes 24-35 minutes.
It realizes rapid, accurate and sensitive detection of adenovirus, rhinovirus and parainfluenza viruses (including types I, II, and III), reduces detection costs, avoids false positives and environmental pollution, and is suitable for POC testing and emergency scenarios.
Smart Images

Figure CN119710079B_ABST
Abstract
Description
[0001] This application claims the priority of the Chinese invention patent application CN 2023112650391, "A multiplex detection kit for respiratory pathogens", filed on September 27, 2023, and the entire content of the priority invention patent application is incorporated herein by reference. Technical Field
[0002] The present invention relates to the field of pathogen detection, and particularly to a multiplex detection kit for respiratory pathogens. Background Art
[0003] The respiratory tract is one of the three pipelines in the human body that communicate with the outside world, and many pathogens from the outside can easily enter the respiratory tract and cause various diseases. Respiratory tract infection refers to the infection of the nasal cavity, pharynx, larynx, trachea, and bronchi of the human body by pathogens, and is divided into upper respiratory tract infection and lower respiratory tract infection. Data from the World Health Organization before the COVID-19 pandemic showed that respiratory tract infections and other diseases caused by them ranked third among the causes of human death.
[0004] Respiratory tract infection is a common cause of illness and death, and the clinical symptoms and signs caused by most respiratory pathogens are relatively similar (mostly manifested as fever, cough, or headache, etc.), which makes it very difficult to accurately predict the cause based only on clinical symptoms and signs. In fact, different causes often correspond to completely different treatment plans. For example, if it is caused by bacteria, then antibiotics need to be used; if it is caused by viruses, then antiviral drugs need to be used. If the infection is caused by rhinovirus, using antibiotics will not only not produce a therapeutic effect, but will instead destroy the normal microbial flora in the patient's body.
[0005] Adenovirus (ADV) belongs to the Adenoviridae family and is a class of non-enveloped double-stranded DNA virus particles with an icosahedral symmetry structure. Human adenovirus (hAdV) infection is easy to spread and can infect all age groups, especially infants, the elderly, and immunocompromised and organ transplant patients. Adenovirus infection can cause various diseases, such as: common cold, acute tonsillitis, otitis media, bronchiolitis, pneumonia, conjunctivitis, diarrhea, hepatitis, myocarditis, viral myositis, etc. The clinical symptoms after adenovirus infection are usually fever, sore throat, runny nose, cough, earache, "red eyes", diarrhea, etc. Adenovirus pneumonia is one of the more severe types of community-acquired pneumonia in children and mostly occurs in children aged 6 months to 5 years.
[0006] Parainfluenza virus (PIV) is a group of enveloped single-stranded negative-sense RNA viruses, divided into types I to IV. Among them, types I to III are common pathogens causing acute respiratory infections in children (especially infants and young children). The clinical symptoms of parainfluenza virus infection are usually fever, nasal congestion, sore throat, wheezing, and even respiratory obstruction. Parainfluenza virus type I / parainfluenza virus type II is the most prominent pathogen associated with croup (inflammation of the pharynx, larynx, glottis, and tracheal surface, causing glottic stenosis), and the age of onset is 6 months to 3 years. Parainfluenza virus type III often causes bronchiolitis and pneumonia in infants and young children under 1 year old, with an incidence second only to respiratory syncytial virus, ranking second. Parainfluenza virus type IV causes mild upper respiratory tract infections and does not cause serious diseases.
[0007] Rhinovirus (RV) is a type of RNA virus belonging to the genus Enterovirus in the family Picornaviridae, with an icosahedral symmetric capsid. Rhinovirus is the most common cause of respiratory tract infections in children and adults. It mainly causes upper respiratory tract infections such as the common cold in adults; in infants and young children and patients with chronic respiratory diseases, in addition to upper respiratory tract infections, it can also cause bronchitis and bronchopneumonia.
[0008] Respiratory tract infections are characterized by strong susceptibility, fast transmission speed, and being relatively difficult to control. As mentioned above, the clinical symptoms and signs caused by different pathogens (especially the adenovirus, parainfluenza virus, and rhinovirus mentioned above) are relatively similar and even have a certain degree of misleading nature. This makes it difficult for medical practitioners to distinguish pathogens without reliable laboratory analysis, which in turn leads to serious consequences such as misdiagnosis, unnecessary tests, overuse of antibiotics and the acceleration of the emergence of antimicrobial-resistant infections, as well as the outbreak and spread of respiratory tract infections. Therefore, rapid and accurate detection and identification of pathogens are of great significance clinically.
[0009] Current virus detection methods include virus antigen detection, virus antibody detection, virus culture isolation, and virus nucleic acid detection. Rapid detection of virus antigens in respiratory samples is one of the main methods for early diagnosis of virus infections. This method is simple and requires low equipment, making it suitable for early and rapid diagnosis of virus infections in clinical settings. However, the test results are easily affected by multiple factors such as sample source and quality, and the timing of sample collection. Moreover, negative results have no clinical guiding significance. After the body is infected with a virus, IgM appears first, followed by an increase in IgG antibodies. Therefore, an increase in IgM levels has certain value for the early diagnosis of virus infections. For IgG, only when the comparison of paired sera from the acute and convalescent phases shows a more than four-fold increase is it diagnostically significant. However, it is difficult to collect paired sera clinically, and the feasibility is poor. In cases of virus infections in immunocompromised individuals / those using immunosuppressants such as glucocorticoids and infants, antibodies are often not produced or are produced delayed, resulting in false-negative results in virus antibody detection. Culturing and isolating the virus from samples is the gold standard for diagnosing virus infections. It can confirm the presence of live viruses that can be successfully replicated in vitro in the tested specimens and can isolate most common respiratory viruses. However, the test cycle for this method is about 3 - 21 days, the culture conditions are demanding, and it is prone to failure, which is not conducive to early disease diagnosis. Molecular diagnostic techniques extract virus nucleic acids from respiratory samples and then use primers and heat-stable polymerases to exponentially amplify the target nucleic acid fragments of the virus under appropriate conditions, thereby achieving virus nucleic acid detection. It has high sensitivity and specificity in virus detection and has value for early diagnosis. Among them, real-time fluorescence quantitative PCR has great advantages in the early detection of viruses due to its rapid reaction, strong specificity, high sensitivity, etc. However, the COVID-19 pandemic has exposed the weaknesses of the molecular diagnostic industry, such as slow speed and low automation.Without including the time for sample extraction and system configuration, a single PCR amplification often takes 1 to 2 hours. For example, the actual running time of the fluorescence quantitative PCR program disclosed in Patent CN113943836A is 96 minutes; although Patent CN113789412A claims that it only takes 35 minutes to complete the amplification, the actual running time of the fluorescence quantitative PCR program it discloses is 56 minutes; the actual running time of the PCR program disclosed in the literature "Respiratory Virus Multiplex RT-PCR Assay Sensitivities and Influence Factors in Hospitalized Children with Lower Respiratory Tract Infections" is 93 minutes; while the entire pathogen detection process in the literature "Increased Detection of Viruses in Children with Respiratory Tract Infection Using PCR" takes 5 to 6 hours. That is to say, the existing technologies using PCR to detect respiratory viruses often sacrifice the detection speed in order to achieve the accuracy of the detection results.
[0010] The nucleic acid detection speed has to race against the virus. A faster detection speed can cut off the virus transmission chain earlier and minimize the scope of virus transmission. If sensitive and rapid diagnostic tests cannot be obtained (for example, due to the long turnaround time of laboratory PCR results, etc.), medical practitioners usually make immediate treatment decisions based only on signs and clinical symptoms, which may misdiagnose patients and expand the spread of the virus. It should be emphasized that respiratory viruses (especially the adenovirus, parainfluenza virus, and rhinovirus mentioned above) often induce more severe symptoms (such as bronchitis and pneumonia) in groups such as infants and young children. Coupled with their lack of language ability, they often show severe symptoms before being taken to a medical facility for treatment. At this time, if they need to wait at least 1 to 2 hours for the PCR results, it may seriously exacerbate the patient's condition (for example, the occurrence of complications), and even pose a threat of death.
[0011] Currently, rapid PCR is mainly achieved through the following aspects: 1) Based on specific instruments, such as a PCR instrument with an improved temperature control module (such as increasing the temperature change speed); 2) Based on specific consumables, such as improved PCR tubes (such as reducing the PCR reaction volume to increase the temperature change speed); 3) Based on optimized reagents, such as selected rapid Taq enzymes, and optimizing the reaction system into a system that can facilitate the realization of rapid PCR.
[0012] In other words, the implementation of rapid PCR in the prior art requires specific enzymes, as well as specific instruments and supporting consumables. How to shorten the detection time of respiratory pathogen nucleic acids on a general-purpose instrument platform in the market (such as based on existing fluorescence quantitative PCR instruments) without changing the instrument hardware parameters, consumables, and reaction reagents has become an urgent issue to be solved. Summary of the Invention
[0013] In a first aspect, the present invention provides a kit for detecting respiratory pathogen nucleic acids, characterized in that the kit includes:
[0014] An upstream primer for adenovirus, whose nucleotide sequence is as shown in SEQ ID NO: 1; a downstream primer for adenovirus, whose nucleotide sequence is as shown in SEQ ID NO: 2; a probe for adenovirus, whose nucleotide sequence is as shown in SEQ ID NO: 3;
[0015] An upstream primer for rhinovirus, whose nucleotide sequence is as shown in SEQ ID NO: 4; a downstream primer for rhinovirus, whose nucleotide sequence is as shown in SEQ ID NO: 5; a probe for rhinovirus, whose nucleotide sequence is as shown in SEQ ID NO: 6;
[0016] An upstream primer for parainfluenza virus type I, whose nucleotide sequence is as shown in SEQ ID NO: 7; a downstream primer for parainfluenza virus type I, whose nucleotide sequence is as shown in SEQ ID NO: 8; a probe for parainfluenza virus type I, whose nucleotide sequence is as shown in SEQ ID NO: 9; an upstream primer for parainfluenza virus type II, whose nucleotide sequence is as shown in SEQ ID NO: 10; a downstream primer for parainfluenza virus type II, whose nucleotide sequence is as shown in SEQ ID NO: 11; a probe for parainfluenza virus type II, whose nucleotide sequence is as shown in SEQ ID NO: 12; an upstream primer for parainfluenza virus type III, whose nucleotide sequence is as shown in SEQ ID NO: 13; a downstream primer for parainfluenza virus type III, whose nucleotide sequence is as shown in SEQ ID NO: 14; a probe for parainfluenza virus type III, whose nucleotide sequence is as shown in SEQ ID NO: 15.
[0017] In some embodiments, the kit further includes: an internal reference upstream primer, whose nucleotide sequence is as shown in SEQ ID NO: 16; an internal reference downstream primer, whose nucleotide sequence is as shown in SEQ ID NO: 17; an internal reference probe, whose nucleotide sequence is as shown in SEQ ID NO: 18.
[0018] Under the design and exploration of the present invention, the primer sequences (and probe sequences) in the kit provided by the present invention not only ensure the conservativeness of the design (conservativeness is crucial for the accuracy of detection), but also have a relatively high annealing temperature. In combination with the corresponding PCR amplification program, it actually only takes about 24 - 35 minutes to achieve specific, accurate, and sensitive rapid qualitative detection of the above-mentioned respiratory pathogens.
[0019] Although the number of primers and probes in the kit provided by the present invention is relatively large, due to its relatively high annealing temperature, the formation of dimers between primers and (or) probes can be avoided to a certain extent in actual detection. Therefore, the kit provided by the present invention can simultaneously detect three pathogens causing respiratory infections (i.e., adenovirus, rhinovirus, and parainfluenza virus (including types I, II, and III)) in one tube and in one test, with low cost, high accuracy and sensitivity, and short time consumption. The actual detection time only takes about 24 - 35 minutes, and the detection result can be determined through the Ct value. In addition, the whole detection process is carried out under single-tube closed conditions, avoiding false positives and environmental pollution caused by cross-contamination between samples.
[0020] In some embodiments, the 5' end of the probe sequence is labeled with a fluorescent group, and the fluorescent group includes ROX, VIC, FAM, or CY5. In some embodiments, the fluorescent groups of each probe sequence should be different from each other and do not interfere with each other, that is, the fluorescent group used for each probe sequence is different and will not affect the detection of each other, that is, detection can be carried out using different channels.
[0021] In some embodiments, the 3' end of the probe sequence is labeled with a quenching group, and the quenching group includes BHQ1, BHQ2, or MGB.
[0022] In some embodiments, the 5' end of the adenovirus probe is labeled with an ROX fluorescent group, and the 3' end is labeled with a BHQ2 quenching group; the 5' end of the rhinovirus probe is labeled with a VIC fluorescent group, and the 3' end is labeled with a BHQ1 quenching group; the 5' end of the internal reference probe is labeled with a CY5 fluorescent group, and the 3' end is labeled with a BHQ2 quenching group; the 5' end of the parainfluenza virus type I probe, the parainfluenza virus type II probe, and the parainfluenza virus type III probe is labeled with a FAM fluorescent group, and the 3' end is labeled with an MGB quenching group. The above settings of the fluorescent group and quenching group of the probe sequence of the present invention can further ensure that the detection intensity of each channel remains balanced, that is, the fluorescence intensity of individual channels will not be too high or too low in each detection channel, further avoiding the interference problem between channels.
[0023] In some embodiments, the kit further includes: DNA polymerase, reverse transcriptase, RNase inhibitor, dNTP, UNG enzyme.
[0024] In some embodiments, the kit further comprises: a PCR buffer.
[0025] In some embodiments, the kit is for fluorescence quantitative PCR, and the fluorescence quantitative PCR comprises a first amplification stage and a second amplification stage. The first amplification conditions of the first amplification stage include that the denaturation temperature in each cycle is 90 - 99°C, the annealing temperature is 55 - 65°C, and the number of cycles is 3 - 15; the second amplification conditions of the second amplification stage include that the denaturation temperature in each cycle is at least 85°C, the annealing temperature is 66 - 82°C, and the number of cycles is 15 - 50.
[0026] In some embodiments, the specific conditions of the fluorescence quantitative PCR include: the first amplification conditions include 92 - 95°C for 1 - 10 s, 56 - 62°C for 10 - 15 s, and 3 - 10 cycles; the second amplification conditions include 92 - 95°C for 1 - 10 s, 68 - 72°C for 10 - 15 s, and 35 - 45 cycles.
[0027] When the nucleic acid concentration in the sample is relatively high and / or there are more stringent requirements for the detection speed, the specific conditions of the fluorescence quantitative PCR can be set as follows: the first amplification conditions include 92°C for 1 s, 62°C for 10 s, and 3 cycles; the second amplification conditions include 92°C for 1 s, 72°C for 10 s, and 35 cycles. After testing, under the above condition settings, the kit provided by the present invention can actually achieve rapid and accurate detection of the above-mentioned respiratory pathogens in only 24 min (including the reverse transcription and DNA polymerase activation steps, with reverse transcription set at 50°C for 2 min and DNA polymerase activation set at 98°C for 30 s).
[0028] In some embodiments, the specific conditions of the fluorescence quantitative PCR can be set as follows: the first amplification conditions include 92°C for 1 s, 60°C for 12 s, and 5 cycles; the second amplification conditions include 92°C for 1 s, 70°C for 12 s, and 40 cycles.
[0029] In some embodiments, the actual detection time of the kit is 24 - 35 min. Those skilled in the art should understand that the specific conditions of the fluorescence quantitative PCR can be adjusted according to the actual detection requirements and actual detection scenarios (for example, by extending the denaturation / annealing time, etc.).
[0030] In a second aspect, the present invention also provides a method for detecting respiratory pathogens for non-diagnostic purposes, which is characterized by comprising:
[0031] 1) Extracting viral nucleic acid from the sample;
[0032] 2) Performing fluorescence quantitative PCR on the viral nucleic acid using the above-mentioned kit;
[0033] 3) Obtain and analyze the results;
[0034] Wherein the fluorescence quantitative PCR includes a first amplification stage and a second amplification stage. The first amplification conditions of the first amplification stage include a denaturation temperature of 90 - 99°C, an annealing temperature of 55 - 65°C, and a cycle number of 3 - 15 in each cycle; the second amplification conditions of the second amplification stage include a denaturation temperature of at least 85°C, an annealing temperature of 66 - 82°C, and a cycle number of 15 - 50 in each cycle.
[0035] In some embodiments, the specific conditions of the fluorescence quantitative PCR include: the first amplification conditions include 92 - 95°C for 1 - 10 s, 56 - 62°C for 10 - 15 s, and 3 - 10 cycles; the second amplification conditions include 92 - 95°C for 1 - 10 s, 68 - 72°C for 10 - 15 s, and 35 - 45 cycles.
[0036] In some embodiments, the fluorescence quantitative PCR further includes steps of reverse transcription and DNA polymerase activation. The specific conditions of the reverse transcription and DNA polymerase activation include 50 - 55°C for 2 - 5 min, 95 - 98°C for 30 - 120 s.
[0037] In some embodiments, the sample includes one or more of throat swabs, sputum, bronchoalveolar lavage fluid, and blood.
[0038] In some embodiments, the virus concentration includes 250 - 10 5 copies / mL.
[0039] In some embodiments, when an amplification curve (i.e., a typical S-shaped curve) appears in the detection channel and the Ct value of the amplification curve ≤ 36, it indicates that the sample contains the corresponding viral nucleic acid, and the sample is evaluated as a positive result; when there is no amplification curve in the detection channel or the Ct value > 36, and the internal reference channel is positive (Ct value ≤ 36), it indicates that the corresponding viral nucleic acid is not detected in the sample, and the sample is evaluated as a negative result.
[0040] Beneficial effects:
[0041] Compared with the existing kits for detecting respiratory pathogens, the kit provided by the present invention can rapidly and accurately detect and distinguish adenovirus, rhinovirus and parainfluenza virus (including types I, II, and III) on a commonly used fluorescence quantitative PCR instrument on the market without modifying the probes and primers and without adding specific enzymes and specific reagents to the reaction system. The actual detection time is only 24 - 35 minutes, which is much lower than that of other kits based on qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) technology.
[0042] Timely diagnosis is the key to preventing cross-infection and outbreaks of respiratory pathogens. The kit provided by the present invention can simultaneously, rapidly and accurately detect common respiratory pathogens clinically (i.e., adenovirus, rhinovirus and parainfluenza virus (including types I, II, and III)), and the actual detection time is only 24 - 35 minutes, which is particularly suitable for scenarios such as POC testing (Point-of-Care Testing), outpatient clinics, and emergency departments that require rapid test results. Compared with the existing kits, the kit provided by the present invention helps medical practitioners quickly determine appropriate treatment strategies, and to a certain extent avoids serious consequences such as misdiagnosis, unnecessary tests, accelerated emergence of antimicrobial-resistant infections due to overuse of antibiotics, and outbreaks and spread of respiratory infections. The kit provided by the present invention also helps patients take effective preventive measures and receive appropriate antiviral treatment according to the test results, which not only avoids overcrowding of medical resources but also reduces the risk of transmitting the virus to others. BRIEF DESCRIPTION OF THE DRAWINGS
[0043] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.
[0044] Figure 1 It is the nucleic acid amplification curve of adenovirus (sensitivity detection);
[0045] Figure 2 It is the nucleic acid amplification curve of rhinovirus (sensitivity detection);
[0046] Figure 3 It is the nucleic acid amplification curve of parainfluenza virus type I (sensitivity detection);
[0047] Figure 4 It is the nucleic acid amplification curve of parainfluenza virus type II (sensitivity detection);
[0048] Figure 5 For the nucleic acid amplification curve of parainfluenza virus type III (sensitivity detection);
[0049] Figure 6 For the nucleic acid amplification curves of other pathogens (specificity detection);
[0050] Figure 7 For the nucleic acid amplification curve of adenovirus (repeatability detection);
[0051] Figure 8 For the nucleic acid amplification curve of rhinovirus (repeatability detection);
[0052] Figure 9 For the nucleic acid amplification curve of parainfluenza virus type I (repeatability detection);
[0053] Figure 10 For the nucleic acid amplification curve of parainfluenza virus type II (repeatability detection);
[0054] Figure 11 For the nucleic acid amplification curve of parainfluenza virus type III (repeatability detection);
[0055] Figure 12 For the amplification curves corresponding to 10 detected adenovirus positive samples (clinical sample detection);
[0056] Figure 13 For the amplification curves corresponding to 17 detected rhinovirus positive samples (clinical sample detection);
[0057] Figure 14 For the amplification curves corresponding to 7 detected parainfluenza positive samples (clinical sample detection);
[0058] Figure 15 For the structural schematic diagram of the primer of the present invention. Detailed implementation manners
[0059] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention.
[0060] As used herein, "and / or" includes any and all combinations of one or more of the listed related items.
[0061] As used herein, "a plurality" means two or more, that is, it includes two, three, four, five, etc.
[0062] It should be noted that in this text, the term "comprising", "including" or any other variant thereof is intended to cover non-exclusive inclusion, such that a process, method, article or apparatus comprising a series of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article or apparatus. Without further limitation, an element defined by the statement "comprising an..." does not exclude the presence of additional identical elements in the process, method, article or apparatus comprising that element.
[0063] As used in this specification, the term "about" typically means + / - 5% of the stated value, more typically + / - 4% of the stated value, more typically + / - 3% of the stated value, more typically + / - 2% of the stated value, even more typically + / - 1% of the stated value, and even more typically + / - 0.5% of the stated value.
[0064] In this specification, certain embodiments may be disclosed in a format that is within a certain range. It should be understood that such a description of "within a certain range" is merely for convenience and brevity and should not be construed as a rigid limitation on the disclosed range. Therefore, the description of a range should be considered to have specifically disclosed all possible sub-ranges and individual numerical values within that range. For example, the description of the range 1 - 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as the individual numbers within that range, such as 1, 2, 3, 4, 5, and 6. The above rules apply regardless of the breadth of the range.
[0065] Example 1
[0066] Primer and probe information
[0067] The primer and probe sequences designed in the present invention are shown in Table 1. The schematic structural diagram of the primer is as Figure 15 shown.
[0068] Table 1
[0069]
[0070]
[0071] Note: In Table 1, A represents adenovirus, R represents rhinovirus, P represents parainfluenza virus, and RP represents RNaseP. The underlines indicate the interface sequences.
[0072] The sequence of the target nucleic acid is as follows:
[0073] Adenovirus: CCTCGTCAGGCTGTGCTAACTTTGGAGAGTTCGTCTTCGCAGCCCCGCTCAGGCGGCATTGGAACTCTCCAGTTTGTGGAGGAGTTTACTCCCTCTGTCTACTTTAACCCCTTCTCCGGC(SEQ ID NO:19)
[0074] Rhinovirus: CACTCTTGCGAGTGCGAAGCCATATATTTGACAAGGTGTGAAGAGCCCCGTGTGCTCACTTTGAGTCCTCCGGCCCCTGAATGTGGCTAACCTTAACCCTGCAG(SEQ ID NO:20)
[0075] Parainfluenza virus type I: ATACAAAGTTCAGTACAAAGCGGGATCCCAATATTGTTAAACAAGCAAAGCAGAGATCTCACACAATTAATAGAGAAGTCATGCAACAGACAGG(SEQ ID NO:21)
[0076] Parainfluenza virus type II: CCACCCATCAGAGTTCCATATATTGGGTCTAGAACAGAGGAAAGAAGAGTTGCATCAATGGCATATATTAAAGGTGCCACACACAGTTTGAAGGCTGCTCTTAGGG(SEQ ID NO:22)
[0077] Parainfluenza virus type III: TGGAAAGGAAAGGAAGGATACAGAAGAGAGCAATCGATTTACAGAAAGGGCAATTACTCTATTGCAGAATCTTGGTGTAATTCAATCCACATCAAAA(SEQ ID NO:23)
[0078] RNaseP: CTGCGCGGACTTGTGGAGACAGCCGCTCACCTTGGCTATTCAGTTGTTGCTATCAATCATATCGTTGACTTTAAGGAAAAGAAACAGGAAATTGAAAAACCAGTAGCTGTTTCTGAACTCTT(SEQ ID NO:24)
[0079] Amplification system:
[0080]
[0081]
[0082] PCR instrument: Bioer FQD-96C Real-Time Fluorescent Quantitative PCR Analyzer
[0083] Amplification program:
[0084] The first amplification stage: 50°C for 2 min, 98°C for 30 s, 1 cycle (reverse transcription and DNA enzyme activation); 92°C for 1 s, 60°C for 12 s, 5 cycles;
[0085] The second amplification stage: 92°C for 1 s, 70°C for 12 s (fluorescence collection), 40 cycles.
[0086] After testing, the actual amplification time of the amplification program in this example is approximately 31 min.
[0087] Example 2
[0088] Sensitivity detection
[0089] The adenovirus culture solution, rhinovirus culture solution, parainfluenza virus type I culture solution, parainfluenza virus type II culture solution, and parainfluenza virus type III culture solution were diluted to 5×10 4 copies / mL, 5×10 3 copies / mL, 5×10 2 copies / mL with normal saline. After nucleic acid extraction, PCR amplification detection was performed according to the amplification system and amplification program of Example 1, and 2 replicates were detected for each concentration. The results are as Figures 1 - 5 shown. The primer-probe combination of the present invention can accurately detect 500 copies / mL of adenovirus, rhinovirus, parainfluenza virus type I, parainfluenza virus type II, and parainfluenza virus type III, that is, the sensitivity of the primer-probe combination of the present invention is not less than 500 copies / mL.
[0090] Specifically, Figure 1 In, there are 6 amplification curves from left to right. The two closest ones are the amplification curves of 2 replicates of the same concentration adenovirus sample, and the concentrations corresponding to the amplification curves are 5×10 4 copies / mL, 5×10 3 copies / mL, 5×10 2 copies / mL. Figure 2 In, there are 6 amplification curves from left to right. The two closest ones are the amplification curves of 2 replicates of the same concentration rhinovirus sample, and the concentrations corresponding to the amplification curves are 5×10 4 copies / mL, 5×10 3 copies / mL, 5×10 2 copies / mL.Figure 3 There are 6 amplification curves from left to right. The two closest ones are the amplification curves of 2 replicates of the same concentration of parainfluenza virus type I samples, and the corresponding concentrations of the amplification curves are 5×10 4 copies / mL, 5×10 3 copies / mL, 5×10 2 copies / mL. Figure 4 There are 6 amplification curves from left to right. The two closest ones are the amplification curves of 2 replicates of the same concentration of parainfluenza virus type II samples, and the concentrations are 5×10 4 copies / mL, 5×10 3 copies / mL, 5×10 2 copies / mL. Figure 5 There are 6 amplification curves from left to right. The two closest ones are the amplification curves of 2 replicates of the same concentration of parainfluenza virus type III samples, and the concentrations are 5×10 4 copies / mL, 5×10 3 copies / mL, 5×10 2 copies / mL.
[0091] Example 3
[0092] Specific detection
[0093] Detect 1×10 5 copies / mL of influenza A virus H1N1 (2009), 1×10 5 copies / mL of influenza B virus B / Yamgata, 1×10 6 copies / mL of respiratory syncytial virus type A, 1×10 5 copies / mL of respiratory syncytial virus type B, 1×10 6 copies / mL of human metapneumovirus, 1×10 5 copies / mL of mumps virus, 1×10 5 copies / mL of cytomegalovirus, 1×10 5 copies / mL of enterovirus EV71, 1×10 6 copies / mL of Chlamydia pneumoniae and 1×10 7 copies / mL of Streptococcus pneumoniae. The test results are all negative, as Figure 6 shown. The above results indicate that the primer-probe combination of the present invention has excellent specificity.
[0094] Example 4
[0095] Repeatability test
[0096] The culture solutions of adenovirus, rhinovirus, parainfluenza virus type I, parainfluenza virus type II, and parainfluenza virus type III were diluted with physiological saline to 1×10 5 copies / mL and 1×10 3 copies / mL. After nucleic acid extraction, PCR amplification detection was carried out according to the amplification system and amplification procedure of Example 1, and 10 replicate wells were detected for each concentration. The results are shown in Table 2 - Table 6 and Figures 7 - 11 as shown. The coefficient of variation (CV) of the Ct values detected for different concentration templates was less than 5% (even less than 1.5%). Thus, it can be clearly seen that the primer - probe combination of the present invention has excellent repeatability.
[0097] Specifically, Figure 7 in, the 10 amplification curves on the left correspond to the repeatability test results of the adenovirus concentration of 1×10 5 copies / mL, and the 10 amplification curves on the right correspond to the repeatability test results of the adenovirus concentration of 1×10 3 copies / mL. Figure 8 in, the 10 amplification curves on the left correspond to the repeatability test results of the rhinovirus concentration of 1×10 5 copies / mL, and the 10 amplification curves on the right correspond to the repeatability test results of the rhinovirus concentration of 1×10 3 copies / mL. Figure 9 in, the 10 amplification curves on the left correspond to the repeatability test results of the parainfluenza virus type I concentration of 1×10 5 copies / mL, and the 10 amplification curves on the right correspond to the repeatability test results of the parainfluenza virus type I concentration of 1×10 3 copies / mL. Figure 10 in, the 10 amplification curves on the left correspond to the repeatability test results of the parainfluenza virus type II concentration of 1×10 5 copies / mL, and the 10 amplification curves on the right correspond to the repeatability test results of the parainfluenza virus type II concentration of 1×10 3 copies / mL. Figure 11 in, the 10 amplification curves on the left correspond to the repeatability test results of the parainfluenza virus type III concentration of 1×10 5 copies / mL, and the 10 amplification curves on the right correspond to the repeatability test results of the parainfluenza virus type III concentration of 1×10 3 copies / mL.
[0098] Table 2 Adenovirus Repeatability Detection Results (Ct values)
[0099]
[0100] Table 3 Rhinovirus Repeatability Detection Results (Ct values)
[0101]
[0102] Table 4 Parainfluenza Virus Type I Repeatability Detection Results (Ct values)
[0103]
[0104] Table 5 Parainfluenza Virus Type II Repeatability Detection Results (Ct values)
[0105]
[0106]
[0107] Table 6 Parainfluenza Virus Type III Repeatability Detection Results (Ct values)
[0108]
[0109] Example Five
[0110] Clinical Sample Detection
[0111] Extract the nucleic acids of 60 clinical throat swab samples and detect them using the amplification system and amplification program of Example 1. The results are as Figures 12 - 14 shown. Among the 60 samples, 10 adenovirus-positive samples ( Figure 12 ), 17 rhinovirus-positive samples ( Figure 13 ), and 7 parainfluenza-positive samples ( Figure 14 ) were detected, all of which were consistent with the expectations.
[0112] The embodiments of the present invention have been described above in conjunction with the accompanying drawings. However, the present invention is not limited to the above specific embodiments. The above specific embodiments are merely illustrative and not restrictive. Under the inspiration of the present invention, those of ordinary skill in the art can also make many forms without departing from the spirit and scope protected by the present invention's claims. These all fall within the protection scope of the present invention.
Claims
1. A nucleic acid detection kit for respiratory pathogens, characterized in that, The kit includes: An adenovirus upstream primer, the nucleotide sequence of which is shown in SEQ ID NO:1; an adenovirus downstream primer, the nucleotide sequence of which is shown in SEQ ID NO:2; an adenovirus probe, the nucleotide sequence of which is shown in SEQ ID NO:3; A rhinovirus upstream primer, the nucleotide sequence of which is shown in SEQ ID NO:4; a rhinovirus downstream primer, the nucleotide sequence of which is shown in SEQ ID NO:5; a rhinovirus probe, the nucleotide sequence of which is shown in SEQ ID NO:6; A parainfluenza virus type I upstream primer, the nucleotide sequence of which is shown in SEQ ID NO:7; a parainfluenza virus type I downstream primer, the nucleotide sequence of which is shown in SEQ ID NO:8; a parainfluenza virus type I probe, the nucleotide sequence of which is shown in SEQ ID NO:9; a parainfluenza virus type II upstream primer, the nucleotide sequence of which is shown in SEQ ID NO:10; a parainfluenza virus type II downstream primer, the nucleotide sequence of which is shown in SEQ ID NO:11; a parainfluenza virus type II probe, the nucleotide sequence of which is shown in SEQ ID NO:12; a parainfluenza virus type III upstream primer, the nucleotide sequence of which is shown in SEQ ID NO:13; a parainfluenza virus type III downstream primer, the nucleotide sequence of which is shown in SEQ ID NO:14; a parainfluenza virus type III probe, the nucleotide sequence of which is shown in SEQ ID NO:
15.
2. The kit according to claim 1, characterized in that, The kit further includes: an internal reference upstream primer, the nucleotide sequence of which is shown in SEQ ID NO:16; an internal reference downstream primer, the nucleotide sequence of which is shown in SEQ ID NO:17; an internal reference probe, the nucleotide sequence of which is shown in SEQ ID NO:
18.
3. The kit according to claim 2, characterized in that, The 5'-end of the probe sequence is labeled with a fluorophore, and the fluorophore includes ROX, VIC, FAM or CY5.
4. The kit according to claim 2, characterized in that, The 3'-end of the probe sequence is labeled with a quencher group, and the quencher group includes BHQ1, BHQ2 or MGB.
5. The kit according to claim 3, characterized in that, The 5'-end of the adenovirus probe is labeled with a ROX fluorophore and the 3'-end is labeled with a BHQ2 quencher group; the 5'-end of the rhinovirus probe is labeled with a VIC fluorophore and the 3'-end is labeled with a BHQ1 quencher group; the 5'-end of the internal reference probe is labeled with a CY5 fluorophore and the 3'-end is labeled with a BHQ2 quencher group; the 5'-ends of the parainfluenza virus type I probe, the parainfluenza virus type II probe and the parainfluenza virus type III probe are labeled with a FAM fluorophore and the 3'-ends are labeled with an MGB quencher group.
6. The kit according to claim 1, characterized in that, The kit further includes: DNA polymerase, reverse transcriptase, RNase inhibitor, dNTP.
7. A method for detecting respiratory pathogens for non-diagnostic purposes, characterized in that, It includes: 1) Extract viral nucleic acid from the sample; 2) Perform fluorescence quantitative PCR on the viral nucleic acid using the kit according to any one of claims 1-6; 3) Obtain and analyze the results; The fluorescence quantitative PCR includes a first amplification stage and a second amplification stage. The first amplification conditions in the first amplification stage include a denaturation temperature of 90 - 99°C, an annealing temperature of 55 - 65°C, and a cycle number of 3 - 15 in each cycle; the second amplification conditions in the second amplification stage include a denaturation temperature of at least 85°C, an annealing temperature of 66 - 82°C, and a cycle number of 15 - 50 in each cycle.
8. The method according to claim 7, wherein The specific conditions of the fluorescence quantitative PCR include: the first amplification conditions include 92 - 95°C for 1 - 10 s, 56 - 62°C for 10 - 15 s, and 3 - 10 cycles; the second amplification conditions include 92 - 95°C for 1 - 10 s, 68 - 72°C for 10 - 15 s, and 35 - 45 cycles.
9. The method according to claim 7, wherein The fluorescence quantitative PCR further includes steps for activating reverse transcriptase and DNA polymerase, where the conditions for activating reverse transcriptase and DNA polymerase are 50 - 55°C for 2 - 5 min and 95 - 98°C for 30 - 120 s, respectively.
Citation Information
Patent Citations
Real-time fluorescence multiplex PCR primer probe for seven common respiratory system influenza virus pathogens and kit
CN107937613A
Primer and probe composition and real-time fluorescent quantitative PCR (polymerase chain reaction) kit for para-influenza virus typing detection
CN113278738A