Nest type MIRA primer combination for Oropercutting virus detection

Abstract

The invention discloses a nested MIRA primer combination for detecting an Oropercut virus, the nested MIRA primer combination comprises a peripheral primer, an inner primer and a probe for detecting the Oropercut virus, the peripheral primer is as shown in SEQ ID NO: 1 and SEQ ID NO: 2, the inner primer is as shown in SEQ ID NO: 3 and SEQ ID NO: 4, and the probe is as shown in SEQ ID NO: 5; the primer combination disclosed by the invention has the following advantages: (1) the primer combination is rapid, amplification is completed within 30 minutes at 39 DEG C, the screening efficiency is remarkably improved, and the burden of medical staff is relieved; (2) the method is simple and convenient, is simple and convenient to operate, has low requirements on instruments, equipment and professional skills of operators, is beneficial to development of on-site rapid detection, and is beneficial to pathogen screening of cross-border crowds by departments such as customs and the like; (3) the specificity is strong, and cross reaction with common dengue virus, Zika virus and other arthroviruses is avoided; and (4) the sensitivity is high, and the lower limit of detection can reach 1.42 copies / mu L.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological gene detection, and in particular relates to a nested MIRA primer-probe combination for rapid detection of Oropouche virus. Background Art

[0002] Oropouche virus (OROV) is an arbovirus transmitted by arthropods, belonging to the Bunyaviridae family and the genus Orthobunyavirus. OROV is mainly transmitted through the bites of Culicoides, and in some cases can also be transmitted by mosquitoes, and can cause Oropouche fever in humans. Oropouche fever is an acute febrile disease with clinical symptoms including fever, headache, muscle and joint pain, rash, etc. In severe cases, it can cause meningitis and encephalitis. Its clinical symptoms are very similar to those of dengue fever. In addition, it has a tendency to spread to other regions in recent years and has become a public health threat that cannot be ignored.

[0003] At present, the diagnosis of OROV mainly relies on virus isolation, serological testing and molecular biology methods. Virus isolation is time-consuming and complicated to operate, making it difficult to use for early diagnosis. Serological tests, such as enzyme-linked immunosorbent assay (ELISA), have a window period and may cross-react with other related viruses, affecting the accuracy of diagnosis. Traditional molecular biological methods, such as reverse transcription polymerase chain reaction (RT-PCR), although highly sensitive and specific, rely on expensive instruments and professional technicians, making them difficult to be widely used in primary medical institutions and field environments. Therefore, the existing OROV diagnostic methods have the defects of long detection time, complex operation, strong equipment dependence, and difficulty in field application. There is an urgent need to develop a fast, simple and accurate OROV detection method.

[0004] Multiple-enzyme Isothermal Rapid Amplification (MIRA) is a new type of nucleic acid amplification technology that uses the synergistic effect of multiple enzymes to rapidly amplify target nucleic acid sequences under constant temperature conditions (37-42°C). The entire process takes only 5-20 minutes. This technology has the advantages of being fast, simple, sensitive, and specific, and has low dependence on instruments and equipment, making it very suitable for point-of-care testing (POCT). Applying MIRA technology to the detection of OROV is expected to overcome the shortcomings of traditional detection methods and achieve early, rapid, and accurate diagnosis of OROV infection, which is of great significance for the prevention and control of OROV epidemics and clinical diagnosis and treatment. Especially in primary medical institutions in remote areas with limited resources, as well as institutions such as customs health care centers, MIRA technology can greatly enhance the detection capabilities of OROV, help to promptly detect cases, and control the cross-border spread of the epidemic, which is of great significance for preventing the import of Oropouche virus into my country. Summary of the invention

[0005] In order to solve the problems existing in the current detection of Oropouche virus, the present invention provides a nested MIRA primer-probe combination for rapid detection of Oropouche virus.

[0006] The nested MIRA primer combination for rapid detection of Oropouche virus of the present invention comprises peripheral primers, inner primers and a probe, wherein the peripheral primers are shown in SEQ ID NO:1 and SEQ ID NO:2; the inner primers are shown in SEQ ID NO:3 and SEQ ID NO:4; and the probe is shown in SEQ ID NO:5.

[0007] The probe is modified with a FAM fluorescent group (6FAM) at the 31 bp base T of the 5' end, the 32 bp base T is replaced by tetrahydrofuran (THF), the 33 bp base T is modified with a BHQ1 group, and the 3' end of the probe is modified with a C3 Spacer group, namely:

[0008] AGGCTGGTTCAAAAACACAATAACAAACAA / i6FAMdT / / THF / / iBHQ1dT / GGAACACACATGCGAACATGT-C3 Spacer.

[0009] The nested MIRA assay using the above primer combination is as follows:

[0010] (1) Extracting genomic DNA from the sample to be tested;

[0011] (2) Preparation of Nest MIRA reaction system;

[0012] The nested MIRA amplification reaction is a two-step process. The first step reaction system is 29.4 μL A buffer, 2 μL 10 μmol / L outer forward primer, 2 μL 10 μmol / L outer reverse primer, 5 μL Oropouche virus DNA template, 9.1 μL ddH2O, and 2.5 μL B buffer; the second step reaction system is 29.4 μL A buffer, 2 μL 10 μmol / L inner forward primer, 2 μL 10 μmol / L inner reverse primer, 0.6 μL 10 μmol / L probe, 5 μL of the first step reaction product as a template, 8.5 μL ddH2O, and 2.5 μL B buffer; the reagents used in the above reaction systems are all conventional commercially available reagents for nested MIRA amplification.

[0013] (3) Nested MIRA amplification reaction

[0014] The first step of nested MIRA amplification reaction temperature was 39°C for 10 min; the second step of amplification reaction temperature was 39°C for 20 min.

[0015] (4) Interpretation of results: Using the Oropouche virus plasmid as the positive control and distilled water as the negative control, observe the amplification results of the sample to be tested and judge whether the sample to be tested is positive or negative based on the presence or absence of an amplification curve. If an amplification curve is present, the sample is positive; if no amplification curve is present, the sample is negative.

[0016] Compared with the prior art, the nested MIRA primer-probe combination for rapid detection of Oropouche virus in the present invention can complete effective amplification and detection of Oropouche virus within 30 minutes at 39°C, and obtain the detection result by real-time fluorescence reading through a convenient fluorescence reader or fluorescence quantification, with high detection sensitivity, which can reach 1.42 copies / μL, high specificity, and no cross reaction with insect-borne pathogens such as dengue fever, chikungunya virus, Zika virus, yellow fever virus, Tahina virus, and Bate virus. The present invention provides a fast, convenient, and reliable detection method for the early diagnosis of Oropouche virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the result of screening inner primers for the Oropouche virus nested MIRA rapid detection method;

[0018] Figure 2 The peripheral primer screening results of this Oropouche virus nested MIRA rapid detection method;

[0019] Figure 3 Temperature optimization results for the Oropouche virus nested MIRA rapid test method;

[0020] Figure 4The results of the specificity evaluation of the Oropouche virus nested MIRA rapid detection method are presented;

[0021] Figure 5 Results of sensitivity evaluation of the Oropouche virus nested MIRA rapid detection method. DETAILED DESCRIPTION

[0022] The technical scheme of the present invention is further described in detail below through examples, but the content of the present invention is not limited thereto. The methods in the present examples are conventional methods unless otherwise specified, and the materials and reagents used are obtained from commercial channels or prepared according to conventional methods unless otherwise specified;

[0023] Example 1: Design of a nested MIRA primer-probe combination for targeted detection of Oropouche virus M fragment

[0024] 1. Primer probe design and synthesis

[0025] According to the gene sequence of the Oropouche virus M segment published by GeneBank (Gene ID: PQ168406.1), the Oropouche virus nested MIRA primers and detection probe were designed using the biological software Blast for its relatively conservative region.

[0026] It should be noted that the design of MIRA primers and probes follows the following principles:

[0027] (1) The length of MIRA primer sequences is within the range of 30-35 bp, following the principle of random distribution of the four bases in the primers to avoid palindromic sequences;

[0028] (2) In the middle of the upstream and downstream primers, a sequence of 46-52 nt in length is used as a fluorescent probe. The probe sequence does not overlap with the specific primer recognition site, and the sequence avoids a palindromic structure and an internal secondary structure. The probe has a total of 4 modification sites: a THF (tetrahydrofuran) is marked in the middle position 30-35 nt away from the 5' end as a recognition site for the exonuclease (any base, no special requirements); a fluorescent group (such as FAM) is marked on the T base at the 5' end of the THF site, and a quenching group (such as BHQ1) is marked on the T base in the 3' direction, and the distance between the two groups is 2-4 nt; THF is about 15 nt away from the 3' end, and a modification group, such as C3-spacer, is marked at the 3' end. The primer probe sequences involved in this embodiment are shown in Table 1:

[0029] Table 1

[0030]

[0031]

[0032] 2. Positive plasmid synthesis

[0033] A vector containing an OROV characteristic sequence whose nucleotide sequence is shown in SEQ ID NO: 6 was synthesized by Anhui General Biotechnology; the synthesized vector DNA containing an OROV characteristic sequence was used to synthesize an RNA template containing an OROV characteristic sequence by in vitro transcription, and the concentration was measured by an ultraviolet spectrophotometer. The copy number of the plasmid was calculated according to the plasmid length and concentration. The calculation formula is as follows:

[0034]

[0035] Example 2: Establishment of the Oropouche virus MIIRA detection method

[0036] The RNA isothermal rapid amplification kit (fluorescence type) used in this example was purchased from AMP Future Biotechnology Co., Ltd. to establish the Oropouche virus nested MIRA detection method, and optimize the inner primers, outer primers and reaction temperature;

[0037] 1. Screening of inner primer sets

[0038] (1) In Example 1, 3 inner upstream primers and 3 inner downstream primers were designed for Oropouche virus, and they were tested in combination, with a total of 9 combinations: ①OROV-F1+OROV-R1, ②OROV-F1+OROV-R2, ③OROV-F1+OROV-R3, ④OROV-F2+OROV-R1, ⑤OROV-F2+OROV-R2, ⑥OROV-F2+OROV-R3, ⑦OROV-F3+OROV-R1, ⑧OROV-F3+OROV-R2, ⑨OROV-F3+OROV-R3;

[0039] (2) According to the instructions of the RNA Constant Temperature Rapid Amplification Kit (Fluorescence Type), the MIRA reaction system shown in Table 2 was prepared, with a concentration of 1.42×10 5 copies / μL of plasmid standards were used as templates to test each combination of primer set and probe;

[0040] Table 2

[0041]

[0042]

[0043] (3) MIRA amplification reaction and result interpretation: The reaction was carried out at 39°C for 20 min, during which the fluorescence was collected every 30 s. The result was judged based on the presence or absence of the amplified model.

[0044] The results of the inner primer screening test are as follows Figure 1As shown, the combination OROV-F1+OROV-R1 has a stronger fluorescence signal than other combinations. Therefore, the combination OROV-F1+OROV-R1 is preferred as the best inner primer.

[0045] 2. Screening of peripheral primer sets

[0046] (1) In Example 1, 3 inner upstream primers and 3 inner downstream primers were designed for Oropouche virus, and they were tested in combination, with a total of 9 combinations: ①OROV-WF1+OROV-WR1, ②OROV-WF1+OROV-WR2, ③OROV-WF1+OROV-WR3, ④OROV-WF2+OROV-WR1, ⑤OROV-WF2+OROV-WR2, ⑥OROV-WF2+OROV-WR3, ⑦OROV-WF3+OROV-WR1, ⑧OROV-WF3+OROV-WR2, ⑨OROV-WF3+OROV-WR3;

[0047] (2) After the best inner primer combination was selected, it was tested with the nine outer primer combinations. According to the instructions of the RNA Constant Temperature Rapid Amplification Kit (Fluorescence Type), the Nested MIRA reaction system was configured as follows:

[0048]

[0049]

[0050] The Nested MIRA test is divided into two steps. The first step is to use peripheral primers to pre-amplify the target sequence. The reaction time is 10 minutes. After the reaction is completed, the first-step product is added to the second-step reaction system, and the target sequence is amplified for the second time by internal primers. During this period, a fluorescence quantification instrument or a convenient fluorescence reader is used to collect signals.

[0051] (3) Interpretation of results: The results are determined based on the presence or absence of the amplified model. Figure 2 As shown, the peripheral primer combination OROV-WF2+OROV-WR2 has a stronger fluorescence value than other combinations. Therefore, the combination OROV-WF2+OROV-WR2 is selected as the best peripheral primer combination.

[0052] 3. Temperature optimization

[0053] The concentration was 1.42×10 5The plasmid standard with 1000 copies / μL was used as a template, and 5 temperature gradients (35°C, 37°C, 39°C, 41°C, and 43°C) were set. The experiment was carried out according to the above-mentioned Nested MIRA reaction system. The corresponding parameters were set by real-time fluorescence quantitative PCR using a fluorescence detection device. The fluorescence value of the FAM channel was collected every 30 seconds, and the obtained real-time fluorescence data was analyzed. The results are as follows: Figure 3 The optimal temperature for nested MIRA amplification is 39°C.

[0054] Example 3: Nested MIRA specificity assessment experiment

[0055] This example uses the Oropouche virus nested MIRA detection method established in Example 2 for specificity verification, and the verification process is as follows:

[0056] OROV RNA synthesized by in vitro transcription (positive control), dengue virus, chikungunya virus, Zika virus, yellow fever virus, Tahina virus, and Bate virus samples were selected to extract their viral RNA as the test samples (specific detection control group), and enzyme-free water (blank control) was used for nested MIRA amplification reactions;

[0057] Test results such as Figure 4 As shown, in the OROV nested MIRA test, the positive control group (PC), the blank control group (BC, using enzyme-free water as the test sample) and the specific detection control group (dengue virus, chikungunya virus, Zika virus, yellow fever virus, Tahina virus, and Bate virus) were all normal, and only the positive control group OROV had significant fluorescence, while the other virus groups had no fluorescence, indicating that the detection method established by the present invention has good specificity, has no cross-reaction with common insect-borne viruses, and can be used for real sample detection.

[0058] Example 4: Nested MIRA sensitivity evaluation experiment

[0059] The in vitro transcribed OROV RNA sample was diluted in series to prepare seven RNA templates with different concentrations (1.42×10 5 copies / μL-0.142 copies / μL); according to the Oropouche virus nested MIRA detection method established in Example 2, the reaction system was prepared, and the nested MIRA amplification reaction was performed at 39°C.

[0060] Test results such as Figure 5 As shown, the minimum detection limit of nested MIRA is 1.42 copies / μL, indicating that the method of the present invention has a high sensitivity in detecting Oropouche virus.

[0061] In summary, the present invention has developed a nested MIRA detection method for rapid detection of Oropouche virus based on the nested MIRA technology. The technical advantages of the present invention include: (1) simple, rapid and convenient operation, greatly shortening the detection time, and completing the amplification reaction in only 30 minutes; (2) the method has strong specificity, and the detection sensitivity can reach 1.42 copies / μL; (3) the detection method does not require complex and expensive large equipment, overcomes the limitation of RT-qPCR's dependence on detection equipment, and can be applied to on-site detection.

Claims

1. A nested MIRA primer combination for Oropouche virus detection, characterized in that: It comprises peripheral primers, inner primers and probes for detecting Oropouche virus, wherein the peripheral primers are shown as SEQ ID NO:1 and SEQ ID NO:2, the inner primers are shown as SEQ ID NO:3 and SEQ ID NO:4, and the probe is shown as SEQ ID NO:

5.

2. The primer-probe combination according to claim 1, characterized in that: The 31 bp base T of the probe at its 5' end is modified with a FAM fluorescent group, the 32 bp base T is replaced with tetrahydrofuran, the 33 bp base T is modified with a BHQ1 group, and the 3' end of the probe is modified with a C3 Spacer group.

Images