Application of small nucleic acid drug based on lipid droplet coated protein in prevention and treatment of flavivirus infection

Abstract

The invention relates to the technical field of biomedicine, and provides a new target, a new small nucleic acid drug and application of the new small nucleic acid drug in preparation of drugs for prevention or treatment for resisting infection of three viruses of Zika virus (ZIKV), dengue virus (DENV) and hepatitis C virus (HCV). According to the invention, the specific nucleotide sequences of the target lipid droplet coating protein (Perilipin), which are shown as SEQ ID NO.1 to SEQ ID NO.3, are obtained through screening. Experiments discover that Perilipin plays an important role in flavivirus infected target cells, expression and replication of the three virus proteins and genome RNA in the target cells can be effectively blocked by down-regulating expression of Perilipin, and therefore it is proved that Perilipin can serve as a new target spot for resisting infection of the three flaviviruses, and the application of Perilipin in resisting flavivirus infection is proven to be a new target spot for resisting infection of the three flaviviruses. Specific small nucleic acid can be used as an antiviral drug for the three flaviviruses.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to new targets for resisting infection by three flaviviruses (ZIKV, DENV, HCV) and potential medical applications thereof. Background Art

[0002] my country has promulgated the "Biosafety Law of the People's Republic of China", which reflects the national will and top-level design of the importance of biosafety. However, due to the diversity of biological pathogens and the rapid development of biological research and biotechnology development and application capabilities, the biological threats faced by my country will exist for a long time.

[0003] Among biosafety risks, the top one is major emerging infectious disease outbreaks. Since 1998, at least 40 major infectious disease outbreaks have occurred around the world. The hazards of zoonotic diseases and imported infectious diseases have increased significantly, and the frequency and speed of their occurrence are also getting faster and faster. Viral infectious diseases, in particular, have become one of the major biosafety risks threatening human health. So far, most viral infections still lack effective antiviral drugs, and the medical treatment of emerging infectious diseases has always been a difficult problem for the medical community.

[0004] Most members of the Flaviviridae family are pathogens that seriously endanger human health, such as Zika virus (ZIKV), dengue virus (DENV), hepatitis C virus (HCV), yellow fever virus (YFV), West Nile virus (WNV), etc. (van Leur SW, Heunis T, Munnur D, et al. Pathogenesis and virulence of flavivirus infections. Virulence. 2021, 12 (1): 2814-2838.). Flaviviruses are mainly transmitted by arthropods (such as mosquitoes, ticks, etc.) and blood, but they can also be transmitted through direct contact, sexual contact, mother-to-child transmission, and other ways. Flavivirus infection can cause various types of diseases with diverse clinical manifestations, especially fever, rash, hemorrhagic fever and viral encephalitis. ZIKV infection can also cause serious neurological complications, such as microcephaly in newborns and Guillain-Barré syndrome (GBS); DENV infection can cause dengue fever, dengue hemorrhagic fever and dengue shock syndrome; HCV infection can cause hepatitis, cirrhosis and even liver cancer.

[0005] Both ZIKV and DENV infections are mosquito-borne infectious diseases. DENV and HCV infections are more common in my country, while ZIKV infections are mostly imported cases. However, since its transmission medium (Aedes mosquito) also exists in my country, the possibility of imported infection and subsequent localized transmission and epidemic cannot be ruled out. ZIKV, DENV and HCV are key global prevention and control targets, and are also public health threats and challenges that countries around the world are paying close attention to. It is necessary to prepare for long-term mechanism responses. At present, there are no preventive vaccines and therapeutic drugs for the above three flaviviruses. Because they have the characteristics of mosquito-borne transmission and pathogenicity, they pose a great potential threat in the military field, especially in future wars or biological terrorist attacks. With the continuous advancement of the transformation and construction of the Navy, its functions and tasks have been continuously expanded. Overseas missions, long-distance training, ship formation visits, and ocean escort activities have gradually become normalized, and the risk of naval officers and soldiers facing the threat of mosquito-borne infectious diseases and viral hepatitis is also increasing. Therefore, research on prevention and control strategies and therapeutic drugs against flavivirus infections has attracted much attention; it is particularly urgent to find highly effective flavivirus prevention and control drugs with independent intellectual property rights as soon as possible, which plays an important role in improving our military's biological defense and biological threat response capabilities.

[0006] Compared with existing small molecule and antibody drugs, small nucleic acid drugs have many advantages, such as multiple targets and fast screening, high R&D success rate, and low resistance. For diseases that have no therapeutic drugs, they are expected to break through their therapeutic targets, so the range of indications is wider and the development potential is greater. With the continuous innovation in the field of technology, the application field of small nucleic acid drugs will continue to expand, becoming the third wave of development of modern new drugs.

[0007] The morphological structure and physicochemical properties of different flaviviruses are basically very similar. They are all spherical, enveloped RNA viruses with a diameter of 40-60 nanometers. The surface of the virus particle is a lipid bilayer envelope with viral protein protrusions embedded on the membrane. The inside is a nucleocapsid composed of viral genome RNA and capsid protein. The viral genome is a single positive-strand RNA with a large open reading frame that encodes three structural proteins and seven non-structural proteins. Flaviviruses enter host cells through receptor-mediated endocytosis, which depends on the acidification of the endosomal environment, thereby triggering the fusion between the viral envelope and the endosomal membrane, and then uncoating the genome into the cytoplasm. Viral replication occurs in a highly organized cytoplasmic viral replication complex. The viral genome, as messenger RNA, can directly translate viral polyproteins; the endoplasmic reticulum (ER) and its derived lipid droplets (LD) can be used as an assembly platform for progeny virus particles, and then the virus buds into the endoplasmic reticulum cavity and matures, and is transported to the cell surface through the host's typical endoplasmic reticulum-Golgi secretion pathway, and finally releases infectious progeny virus particles. Therefore, the endoplasmic reticulum and its derived lipid droplet structures in host cells are key sites for viral replication to successfully establish infection and have become the primary targets for the development of antiviral drugs.

[0008] Studies have found that the intracellular replication of flaviviruses is closely related to the ER and its derived membrane network structures. Viral infection induces swelling and structural remodeling of the ER, forming multiple vesicle clusters that are closely connected to it, and viral replication complexes are observed in them. Most of the structural and non-structural proteins encoded by the virus are also directly or indirectly associated with the ER, such as E, prM and NS2A can be located in the ER; C is mainly located in the LD; although NS4A is related to the Golgi apparatus, it can induce ER stress and membrane changes, indicating that the ER plays an important role in flavivirus replication. In addition to the viral replication site adjacent to the ER, viral assembly and budding also occur in the adjacent area of ​​the ER. Although it is not clear how flaviviruses use the membrane lipid remodeling process to induce host membrane rearrangement to promote the formation of viral replication complexes, assembly and release of viral particles, etc., the lipid composition often changes significantly during viral infection, suggesting that the ER and vesicle-like structures (such as LD) derived from membrane lipid remodeling are involved in the intracellular replication, assembly and even release of the virus.

[0009] LD is a highly conserved organelle that is ubiquitous in animals, plants, fungi and even bacteria. It is a storage depot for neutral lipids in cells. Its size, number and lipid composition are dynamically adjusted according to the cell state and its environment. LD has a unique structure. Mature LD is mainly composed of a hydrophobic core of neutral lipids and a phospholipid monolayer on the surface. The latest lipidomics data show that the hydrophobic core of LD can contain more than 100 different types of neutral lipids. In many types of cells, including adipocytes and hepatocytes, the neutral lipids in the hydrophobic core mainly include triacylglycerols (TAGs) and cholesterol esters / sterol esters (SEs) (Qin ZL, Yao QF, Ren H, et al. Lipid Droplets and Their Participation in Zika Virus Infection. International journal of molecular sciences. 2022; 23(20).). The phospholipid monolayer surrounding the hydrophobic core also has a unique fatty acid composition. For LDs in mammalian cells, the main component of the phospholipid monolayer is phosphatidylcholine, accounting for about 60%. Changes in the phospholipid ratio in the membrane can affect the synthesis, maturation and degradation of LDs.

[0010] As flaviviruses gradually spread around the world, more and more evidence shows that different flaviviruses such as ZIKV, DENV, and HCV widely use LD to hijack host lipid metabolism to obtain energy during infection, thereby promoting viral replication and assembly (Cloherty APM, Olmstead AD, Ribeiro CMS, et al. Hijacking of Lipid Droplets by Hepatitis C, Dengue and Zika Viruses-From Viral Protein Moonlighting to Extracellular Release. International journal of molecular sciences. 2020; 21(21).). On the one hand, viruses promote viral replication by increasing the biogenesis of LD. HCV, DENV, ZIKV and other flaviviruses can hijack LD for viral replication and progeny virus production through the sterol regulatory element binding protein (SREBP) pathway, a master regulator of host cholesterol and lipid homeostasis. Both viral C and NS5A proteins co-localize with LD; the LD surface is also considered to be the starting site for HCV particle assembly; the lipid virus particles formed are rich in cholesterol, triglycerides and apolipoproteins, of which triglycerides are likely to come mainly from LD. Blocking the activation of the SREBP pathway with the PF-429242 inhibitor can inhibit the infection of both DENV and ZIKV viruses. On the other hand, flaviviruses can promote viral replication by inducing a reduction in LD. Studies have found that DENV infection causes the ancient ubiquitous protein 1 (AUP1) in cells to deubiquitinate, and then binds to it through NS4A and NS4B proteins, transporting AUP1 from LD to autophagosomes, activating the acyltransferase activity of AUP1, upregulating lipophagy, and promoting the production of progeny viruses; knocking out AUP1 using genome editing CRISPR technology can eliminate the production of DENV and ZIKV progeny viruses. It can be seen that LD is essential for flavivirus infection. In a sense, changes in lipid metabolism can affect the replication of the flavivirus genome and the production of virions, thus providing a key antiviral strategy breakthrough for the prevention and treatment of viral infections.

[0011] Cellular lipid metabolism is a complex and highly regulated process. Neutral lipids stored in LDs can be broken down by lipolysis or lysosome-mediated autophagy. Various proteins and lipases on the surface of LDs play an important role in regulating LD catabolism. The surface of LDs has a variety of integral and peripheral proteins, mainly from the PAT (Perilipin / ADRP / TIP47) family, which is a family of five proteins (perilipin 1 to 5). These lipid droplet coating proteins not only stabilize the structure of LDs, but also may regulate the access of lipases and other enzymes to neutral lipids in LDs. Other lipid droplet proteins include various enzymes involved in triacylglycerol and phospholipid synthesis or lipid transport.

[0012] Perilipin belongs to the PAT family and can regulate cellular lipid homeostasis by regulating the accessibility of lipases to neutral lipids in LDs. At basal levels, Perilipin is generally inactive in a state bound to CGI-58. Under starvation conditions, Perilipin is phosphorylated by protein kinase A, resulting in the release of CGI-58 bound to it and binding to triglyceride lipase (ATGL), thereby initiating TG hydrolysis. Phosphorylated Perilipin can also phosphorylate hormone-sensitive lipase (HSL) and transfer to LDs. HSL hydrolyzes diacylglycerol (DG) to monoacylglycerol (MG). Finally, monoacylglycerol lipase (MGL) hydrolyzes MG into free fatty acids (FFA) and glycerol. FFA released from the breakdown of neutral lipids can be β-oxidized by mitochondria or peroxisomes to produce energy. Therefore, LD can respond to the cell's balance of lipogenesis and lipolysis, thereby playing a key role in maintaining cellular homeostasis. This homeostatic effect is essential for normal cell and organismal function and is closely related to human health. LD imbalance can cause many human diseases, such as viral infection, fatty liver, obesity, diabetes, cardiovascular disease, and cancer.

[0013] In summary, the lipid droplet coating protein Perilipin plays an important role in the pathogenic mechanism of flavivirus and is closely related to processes such as viral replication and the production of progeny viral particles. However, its interaction with the virus, especially the spatiotemporal mechanism of how the virus uses this protein to manipulate the host LD, remains unclear and requires further study. Revealing the interaction between the two will help to clarify the viral replication mechanism and provide new targets and new ideas for antiviral treatment.

[0014] At present, there is no clear conclusion on the specific role of Perilipin in flavivirus infection of human hepatoma cell line (Huh7). Further in-depth research on small nucleic acid drugs specific to Perilipin molecules will not only help to enhance the understanding of flavivirus infection and pathogenic mechanisms, but also provide new ideas and targets for the prevention and treatment of flavivirus infection, so as to develop new, broad-spectrum and highly effective antiviral drugs. Summary of the invention

[0015] In view of this, the present invention provides the use of lipid droplet coating protein Perilipin gene in the preparation of drugs for preventing or treating three flavivirus infections: Zika virus (ZIKV), dengue virus (DENV), and hepatitis C virus (HCV).

[0016] Furthermore, the drug is a small nucleic acid drug targeting the lipid droplet coating protein Perilipin gene.

[0017] Furthermore, the drug refers to an agent that can inhibit or downregulate the expression of the lipid droplet coating protein Perilipin.

[0018] Furthermore, the reagent capable of inhibiting or down-regulating the expression of the lipid droplet coating protein Perilipin is Perilipin's siRNA, shRNA or a recombinant vector containing siRNA or shRNA.

[0019] Furthermore, the drug is an interfering RNA of the lipid droplet coating protein Perilipin, and the sequence of the interfering RNA is selected from any one of the following:

[0020] SEQ ID NO.1:GCGUUAGAGAACGUAAGCA

[0021] SEQ ID NO.2: GCCGAUUAUGCUCGCAACU

[0022] SEQ ID NO. 3: GAGUACUGGAGACGAAGCA.

[0023] The present invention also provides the use of lipid droplet coating protein Perilipin gene in the preparation of drugs for preventing or treating three flavivirus-related diseases, namely, Zika virus (ZIKV), dengue virus (DENV), and hepatitis C virus (HCV).

[0024] Furthermore, the drug is a small nucleic acid drug targeting the lipid droplet coating protein Perilipin gene.

[0025] Furthermore, the drug refers to an agent that can inhibit or downregulate the expression of the lipid droplet coating protein Perilipin.

[0026] Furthermore, the reagent capable of inhibiting or down-regulating the expression of the lipid droplet coating protein Perilipin is Perilipin's siRNA, shRNA or a recombinant vector containing siRNA or shRNA.

[0027] Furthermore, the drug is an interfering RNA of the lipid droplet coating protein Perilipin, and the sequence of the interfering RNA is selected from any one of the following:

[0028] SEQ ID NO.1:GCGUUAGAGAACGUAAGCA

[0029] SEQ ID NO.2: GCCGAUUAUGCUCGCAACU

[0030] SEQ ID NO. 3: GAGUACUGGAGACGAAGCA.

[0031] The present invention provides a self-designed siRNA, which is confirmed by experiments to be able to inhibit the infection of three flaviviruses (ZIKV, DENV, HCV) to target cells, and can effectively block the expression and replication of viral proteins and genomic RNA in target cells, thereby confirming that the siRNA of the present invention has the ability to effectively block the infection of three flaviviruses to host cells and has certain broad-spectrum antiviral activity. In addition, through cytotoxicity experiments, the siRNA concentration used in the present invention will not have any effect on the normal physiological function of cells, and has high safety. Therefore, the present invention provides a new idea for the prevention and treatment of the above three flavivirus diseases, and has potential good clinical application value.

[0032] The present invention screened out a new host cell factor Perilipin that can inhibit the above three flaviviruses from infecting Huh7 cells. After the Perilipin gene is downregulated, it does not affect the normal physiological function of the cells, but significantly blocks the infection of the three flaviviruses to Huh7 cells. Therefore, the present invention provides a new target and treatment scheme for the clinical prevention and treatment of various diseases caused by flavivirus infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The figure is a graph showing the mRNA level of the Perilipin gene, i.e., the interference efficiency, after different interference sequences of the Perilipin gene are transfected using the real-time PCR method of the present invention;

[0034] Figure 2 This is a diagram showing the effect of different interference sequences of the Perilipin gene transfected with the present invention on cytotoxicity;

[0035] Figure 3 This is a diagram showing the effect of down-regulation of the host cell factor Perilipin on the infection activity of three flaviviruses (ZIKV, DENV, and HCV) detected by the immunofluorescence method of the present invention;

[0036] Figure 4 This is a diagram showing the effect of down-regulation of Perilipin on infection of three flaviviruses (ZIKV, DENV, HCV) in cultured cells detected by the Western blot method of the present invention;

[0037] Figure 5 This is a diagram showing the effect of down-regulation of Perilipin on the replication ability of three flaviviruses (ZIKV, DENV, and HCV) in cultured cells detected by the fluorescent quantitative PCR (real-time PCR) method of the present invention. DETAILED DESCRIPTION

[0038] The following examples and experimental examples further illustrate the present invention and should not be construed as limiting the present invention. The examples do not include a detailed description of conventional methods, such as PCR methods, methods for constructing vectors and plasmids, methods for inserting protein-encoding genes into such vectors and plasmids, or methods for introducing plasmids into host cells. Such methods are well known to those skilled in the art and are described in many publications, including Sambrook, J., Fritsch, E. F. and Maniais, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edition, Cold spring Harbor Laboratory Press.

[0039] Unless otherwise specified, percentages and parts are calculated by weight. Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to skilled operators in the art. In addition, any methods and materials similar or equivalent to those described herein can be applied to the present invention, and the preferred implementation methods and materials described in the specific implementation methods are for demonstration purposes only.

[0040] Example 1: Design and synthesis of specific siRNA sequences for host factors

[0041] 1.1 For the target gene Perilipin, we searched NCBI GeneBank to obtain the full sequence and mRNA sequence, used existing network resources and common molecular biology software to perform biological analysis on the target gene, and selected the coding region as the target sequence for siRNA design. Referring to the siRNA design principles, we compared the designed sequence with the human genome sequence through the blast function of the GeneBank database to ensure that the designed sequence had no homology; excluded potential siRNAs with 8 consecutive bases at the 5' end of the antisense chain that paired with other genes; excluded any potential siRNAs with 14 consecutive bases that paired with other genes. Then, we used the design software for preliminary evaluation and determination, and selected the 3 best kinetic parameter targets to enter the subsequent experimental process. A total of 3 interference sequences were synthesized, see SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 for details:

[0042] GCGUUAGAGAACGUAAGCA(SEQ ID NO.1)

[0043] GCCGAUUAUGCUCGCAACU(SEQ ID NO.2)

[0044] GAGUACUGGAGACGAAGCA(SEQ ID NO.3)

[0045] 1.2 The synthesis and purification of siRNA were completed by RiboBio.

[0046] Example 2: Identification of siRNA sequence interference effect

[0047] 2.1 siRNA transfection

[0048] The transfection steps were referred to the instruction manual of Lipofectamine 3000.

[0049] 1) One day before transfection, Huh7 cells were seeded at 2×105 cells / well in a 24-well cell culture plate and cultured overnight in a 37°C, 5% CO2 incubator to ensure that the cell density reached 80-90% when transfected the next day.

[0050] 2) Take 1 μL Lipofectamine 3000 and add it to 25 μL opti-MEM, mix gently, and incubate at room temperature for 5 minutes; take another 5 μL of 5 μM interfering RNA and mix it with 25 μL opti-MEM. After the incubation, add the diluted Lipofectamine 3000 transfection reagent to the diluted RNA, mix gently, incubate at room temperature for 15 minutes, add Huh7 cells, and add 450 μL opti-MEM to make the final RNA concentration 50 nM.

[0051] 3) 6-8 hours after transfection, replace the culture medium with fresh culture medium containing dual antibodies.

[0052] 2.2 Detection of host factor mRNA levels by real-time PCR

[0053] 2.2.1 Preparation of total RNA extraction

[0054] Purchase experimental materials without nuclease (such as test tubes, tip heads and Eppendorf tubes), or soak the experimental materials in sterilized 0.1% DEPC water for more than two hours, then rinse them with sterile deionized water to remove as little DEPC as possible, sterilize the materials under high pressure, and store them at room temperature for later use.

[0055] 2.2.2 Extraction of total RNA from cells

[0056] The total RNA in the cells was extracted using the total RNA extraction kit from Invitrogen using the conventional guanidine isothiocyanate method. The method is as follows:

[0057] For the above-mentioned Huh7 cells that have been treated differently, first aspirate and discard the old culture medium, add 1mL of TRIzol to each well to dissolve the cells, repeatedly blow and beat several times, and after the cells are fully dissolved, use a pipette to transfer the cell lysate to an Ep tube without nuclease. Incubate the cell lysate sample at 15-30℃ for 5 minutes to completely decompose the ribosomes. Add 0.2mL of chloroform for every 1mL of TRIzol, cover the tube tightly, shake vigorously for 15sec to mix thoroughly, and let stand at room temperature for 5min to stratify. Centrifuge at 2-8℃ and 12000rpm for 15min. Transfer the upper colorless aqueous layer to a new Ep tube without nuclease. Add 0.5mL of isopropanol for every 1mL of TRIzol to precipitate RNA. Mix by inversion, let stand at room temperature for 10 minutes, then centrifuge at 2-8℃ 12000rpm for 10 minutes, discard the supernatant, add 75% ethanol to wash the RNA precipitate, centrifuge at 2-8℃ 7500rpm for 5 minutes, discard the supernatant, air dry the RNA precipitate for 5-10 minutes, and add 50μL of sterile ultrapure water without RNase to dissolve the RNA sample. Change gloves frequently during the whole process to prevent RNase contamination.

[0058] 2.2.3 Reverse transcription to prepare cDNA

[0059] The TaKaRa reverse transcription kit was used to obtain cDNA of cells in the control group and the experimental group. The specific steps are as follows:

[0060] Add the following reaction system into the PCR tube:

[0061]

[0062] Mix gently, incubate at 37°C for 15 minutes, and then heat at 85°C for 5 seconds to inactivate the reverse transcriptase.

[0063] 2.2.4 Fluorescence quantitative PCR detection

[0064] Design primers to detect the mRNA level of host factors. GAPDH is used as an internal reference for detection. The primer sequences are as follows:

[0065] Perilipin-F:

[0066] AAGGAAGAGTCAGCCCCTG(SEQ ID NO:4)

[0067] Perilipin-R:

[0068] CACGGTGTATCGAGAGAGG(SEQ ID NO:5)

[0069] GAPDH-F:

[0070] TGGGCTACACTGAGCACCAG(SEQ ID NO:6)

[0071] GAPDH-R:

[0072] AAGTGGTCGTTGAGGGCAAT(SEQ ID NO:7)

[0073] Then, TaKaRa's SYBR Premix Ex Taq kit was used for detection, and the reaction system was as follows:

[0074]

[0075] The two-step amplification was performed using a Rotor Gene 3000A instrument, with the program set as 95°C pre-denaturation for 2 min, 40 PCR cycles, 95°C for 5 sec, and 60°C for 30 sec.

[0076] Experimental data analysis: The change in the amount of PCR products was relatively quantified using the comparative Ct value method. The premise of this method is that the amount of product doubles in each cycle, and the Ct value obtained in the exponential phase of the PCR reaction reflects the amount of the starting template. The difference in one cycle (Ct = 1) is equivalent to a 2-fold difference in the number of starting templates.

[0077] Definition: ΔCt = Ct target gene - Ct internal standard

[0078] ΔΔCt = (Ct target gene - Ct internal standard) treated - (Ct target gene - Ct internal standard) untreated

[0079] RQ=2-ΔΔCt

[0080] The statistical analysis tools in Excel or Prism were used to calculate the mean and standard deviation of each group. T test was used between the two groups. P < 0.05 was considered statistically significant, and P < 0.01 was considered a significant difference. T test analysis was performed to compare the siPerilipin transfection group with the siNC control group.

[0081] 2.2.5 Experimental results

[0082] 50nM siRNA was transfected into Huh7 cells, and the cell group without siRNA transfection was used as the positive control group (Ctrl); the cell group transfected with siNC was used as the negative control group (siNC). 48h after transfection, the mRNA level of the target gene was detected by fluorescence quantitative PCR to confirm the interference effect.

[0083] The results are as follows Figure 1 As shown, the cell group not transfected with any siRNA was used as the control group (Ctrl); the cell group transfected with non-targeting siRNA, i.e., siNC, was used as the negative control group (siNC); the cell group transfected with siRNA (SEQ ID NO: 1) targeting the Perilipin gene (siRNA-1); the cell group transfected with siRNA (SEQ ID NO: 2) targeting the Perilipin gene (siRNA-2); the cell group transfected with siRNA (SEQ ID NO: 3) targeting the Perilipin gene (siRNA-3). Compared with the control group, **, P<0.01; ***, P<0.001. That is, compared with the control (Ctrl and siNC) groups, after adding 50nM siRNA targeting the Perilipin gene to the transfection system, the mRNA level of the Perilipin gene in the cell was significantly reduced (**, P<0.01; ***, P<0.001).

[0084] Example 3: Cytotoxicity Experiment

[0085] The CCK-8 method was used to detect the effect of adding siRNA on the proliferation of Huh7 cells. The specific steps are as follows:

[0086] Huh7 cells in the logarithmic growth phase were collected and plated at approximately 3 × 10 cells per well. 4The cells were inoculated in a 96-well plate at a density of . After the cells grew overnight, siRNAs of various concentrations in Example 1 were added, and the culture was continued for 48 hours, and then the cell proliferation was detected by CCK-8 method. The specific detection method is: discard the original culture medium in the cells, add 110 μL of fresh culture medium containing 10 μL CCK-8 to each well, place it in a 37°C incubator and continue to culture for 3 hours, and then use a multifunctional microplate reader to detect the absorbance value of each well at a wavelength of 450 nm. The experiment was repeated 3 times independently, and the average value and standard error were calculated.

[0087] The experimental results are as follows Figure 2 As shown, A is the cell activity in each siRNA transfection group detected by CCK-8 method; B is the cytopathic effect diagram of each experimental group observed by optical microscope. The cell group without any siRNA transfection was used as the positive control group (Ctrl); the cell group transfected with siNC was used as the negative control group (siNC); the cell group transfected with siRNA targeting the Perilipin gene (SEQ ID NO: 1) (siRNA). Compared with the control group, P>0.05. That is: after the siRNA of different sequences in each group was added to the cells, there was no obvious cytotoxicity to the cells (P>0.05), and no effect of siRNA on cell morphology was observed under the light microscope, indicating that the siRNA of each sequence had no effect on the normal physiological function of the cells and could be used for subsequent experiments.

[0088] Example 4: Inhibition experiment of specific siRNA on infection of three flaviviruses (ZIKV, DENV, HCV)

[0089] 4.1 Flavivirus infection of Huh7 cells

[0090] Normal Huh7 cells were cultured in DMEM medium containing 10% fetal bovine serum at 37°C in an incubator with 5% CO2 saturated humidity, and the cell culture medium was supplemented with 2 mM L-glutamine, 0.1 mM non-essential amino acids, 100 μg / mL streptomycin and 100 U / mL penicillin.

[0091] One day before transfection, Huh7 cells were seeded in 96-well cell culture plates at 3×104 cells / well and cultured in a 37°C, 5% CO2 incubator overnight. The next day, siRNA was transfected using the same method as in 2.1. After 72 hours, three flavivirus (ZIKV, DENV, HCV) infection experiments were performed. First, the culture supernatant was aspirated, rinsed twice with pre-warmed PBS, and ZIKV, DENV, and HCV were inoculated with a virus amount of MOI=1. The cells were infected at 37°C for 2 hours, the virus solution was discarded, and the cells were rinsed three times with pre-warmed PBS. Fresh culture medium was replaced and cultured at 37°C for 24 hours (ZIKV, DENV) or 48 hours (HCV). Immunofluorescence was used to detect positive cells infected with ZIKV, DENV, and HCV.

[0092] 4.2 Immunofluorescence staining to detect three flavivirus (ZIKV, DENV, HCV) infections

[0093] The expression of viral antigens in the Huh7 cells of each group treated as above was detected by immunofluorescence method, and the specific steps were as follows:

[0094] 1) Cell fixation: Remove the culture medium in the 96-well plate, add PBS to wash the cells twice, add 100 μL of pre-cooled methanol to each well, fix at -20°C for 20 min, and wash the cells three times with pre-cooled PBS.

[0095] 2) Permeabilization: Add 100 μl of 0.1% TritonX-100 to each well of the fixed cells, incubate at room temperature for 15 min, and wash the cells three times with pre-cooled PBS.

[0096] 3) Blocking: Add 100 μL 3% BSA to each well and incubate at room temperature for 1 h.

[0097] 4) Primary antibody incubation: 100 μL of diluted ZIKV Capsid, DENV Capsid, and HCV Core antibodies (1:100, diluted in 3% BSA) was added to each well, incubated at room temperature for 1 h, and the cells were washed 3 times with pre-cooled PBS.

[0098] 5) Secondary antibody incubation: Add 100 μL of AF488 fluorescently labeled anti-rabbit IgG (1:1000, diluted in 3% BSA) to each well, incubate at room temperature in the dark for 1 h, and wash the cells twice with pre-cooled PBS in the dark.

[0099] 6) Labeling cell nuclei: Add the nuclear fluorescent dye DAPI (1:5000, diluted in PBS) to each well, incubate at room temperature in the dark for 15 min, and wash the cells three times with pre-cooled PBS in the dark.

[0100] 7) Detect, photograph and count the number of green AF488-positive cell clones under a fluorescence microscope.

[0101] 4.2.1 Experimental Results

[0102] 50nM siRNA was transfected into Huh7 cells, and 72h later, ZIKV, DENV, and HCV were infected. The cell group infected with the same amount of virus without siRNA transfection was used as the positive control group (Ctrl); the cell group infected with the same amount of virus transfected with siNC was used as the negative control group (siNC); the cell group infected with the same amount of virus transfected with siPerilipin was used as the experimental group (siRNA). 24h (ZIKV, DENV) or 48h (HCV) after infection, the inhibition of viral infection by interfering RNA was detected by cell immunofluorescence staining.

[0103] The results are as follows Figure 3 As shown, A is the inhibition rate graph and fluorescence detection graph of Zika virus infection after down-regulating Perilipin (the primary antibody used is ZIKV Capsid antibody); B is the inhibition rate graph and fluorescence detection graph of dengue virus infection after down-regulating Perilipin (the primary antibody used is DENV Capsid antibody); C is the inhibition rate graph and fluorescence detection graph of hepatitis C virus infection after down-regulating Perilipin (the primary antibody used is HCV Core antibody). The cell group infected with the same amount of virus without any siRNA transfection was used as the virus infection positive control group (Ctrl); the cell group infected with the same amount of virus transfected with siNC was used as the negative control group (siNC); the cell group infected with the same amount of virus transfected with siRNA (SEQ ID NO: 1) against the Perilipin gene was used as the experimental group (siRNA). Compared with the control group, **, P<0.01; ***, P<0.001. That is, compared with the control (Ctrl and siNC) groups, the addition of 50 nM siRNA targeting the Perilipin gene to the system can significantly inhibit the infection ability of ZIKV, DENV, and HCV viruses, with inhibition efficiencies reaching approximately 88%, 71.6%, and 89.2%, respectively (**, P<0.01; ***, P<0.001).

[0104] 4.3 Detection of the expression of three flavivirus (ZIKV, DENV, HCV) proteins by immunoblotting

[0105] 4.3.1 Inhibition of ZIKV, DENV, and HCV Infection by Specific siRNA

[0106] One day before transfection, Huh7 cells were seeded in 24-well cell culture plates at 2×105 cells / well and cultured overnight in a 37°C, 5% CO2 incubator. The next day, siRNA was transfected for 72 hours, and ZIKV, DENV, and HCV virus infection experiments were performed. First, the culture supernatant was discarded, and the cells were rinsed twice with pre-warmed PBS. ZIKV, DENV, and HCV were inoculated with a virus amount of MOI=1, and infected at 37°C for 2 hours. The virus solution was discarded, and the cells were rinsed 3 times with pre-warmed PBS, replaced with fresh culture medium, and cultured at 37°C for 24 hours (ZIKV, DENV) or 48 hours (HCV).

[0107] 4.3.2 Preparation of cell samples

[0108] After discarding the culture medium from the cells in each control group and siRNA transfection group, wash them 2 to 3 times with pre-warmed PBS, add 100 μL of protein lysis buffer to each well, repeatedly blow the cells to promote their lysis, transfer them to Ep tubes, add 25 μL of 5× Loading buffer, boil at 100°C for about 10 min, centrifuge at 12000 rpm for 2 min, discard the precipitate, and take the supernatant (containing total cell protein) for SDS-PAGE electrophoresis.

[0109] 4.3.3 Western blot detection

[0110] (1) Solution preparation

[0111] 30% Acr / Bis: 29.2% Acr, 0.8% Bis, filtered and stored at 4°C;

[0112] 4× separation gel buffer: 36.3 g Tris, 4 mL 10% SDS, add about 180 mL H2O, adjust pH to 8.8 with concentrated HCl, and make up to 200 mL;

[0113] 4× stacking gel buffer: 6.55 g Tris, 4 mL 10% SDS, add about 80 mL H2O, adjust pH to 6.8 with concentrated HCl, and make up to 100 mL;

[0114] Electrophoresis buffer: 3.03 g Tris, 14.41 g Gly, 1 g SDS, add H2O to dissolve, and make up to 1000 mL;

[0115] Loading buffer: 1M Tris-HCl (pH 6.8) 1.2 mL, 10% SDS 4 mL, mercaptoethanol 1 mL, glycerol 2 mL, bromophenol blue 0.2 mg, add H2O to 20 mL;

[0116] SDS-PAGE stacking gel (upper gel): 2.4 mL water, 1.0 mL 4 stacking gel buffer, 0.6 ml 30% Acr / Bis, 50 μL 10% ammonium persulfate solution, 10 μL TEMED;

[0117] SDS-PAGE separation gel (12.5% ​​lower gel): 4.2 mL water, 3.0 mL 4 separation gel buffer, 4.8 ml 30% Acr / Bis, 100 μL 10% ammonium persulfate solution, 10 μL TEMED.

[0118] (2) SDS-PAGE protein electrophoresis

[0119] 1) Preparation of polyacrylamide gel - Install the polyacrylamide gel plate according to the product instructions, first add 2mL of separation gel solution, cover the gel surface with water, and after the gel solidifies, pour off the covering solution, wipe it dry and add concentrated gel, insert a comb of appropriate size, and perform electrophoresis after it solidifies.

[0120] 2) 12.5% ​​polyacrylamide gel electrophoresis - add the prepared cell samples and pre-stained protein molecular weight markers into the sample wells, and perform electrophoresis at a voltage of 80-100 V / cm until bromophenol blue reaches the bottom of the separation gel. Stop the electrophoresis, remove the gel, and cut off the concentrated gel.

[0121] (3) Western blot detection

[0122] From the lower gel separated by 12.5% ​​SDS-PAGE for total protein, the target band of corresponding size was cut according to the size of the pre-stained protein molecular weight marker band, and the protein was transferred to a PVDF membrane by an electrotransfer instrument.

[0123] The non-specific binding sites on the membrane were blocked with a blocking solution containing 5% skim milk, and then incubated with appropriate primary antibodies (mouse monoclonal antibodies against ZIKV / DENV Capsid and HCV Core and rabbit polyclonal antibodies against GAPDH, all diluted 1:1000) at 4°C with gentle shaking overnight. After washing the membrane three times with TBST buffer, incubated with horseradish peroxidase (HRP)-labeled secondary antibodies (goat anti-mouse or anti-rabbit IgG, both diluted 1:1000) at room temperature for 2 hours, the membrane was washed three times with TBST buffer, and then the substrate was developed using the HRP-ECL luminescence method, and photographed for analysis.

[0124] 4.4 Real-time PCR detection of mRNA replication of three flaviviruses (ZIKV, DENV, HCV)

[0125] The method is basically the same as 4.3.1. After Huh7 cells transfected with siRNA were infected with ZIKV, DENV, and HCV, they were cultured for 24h (ZIKV, DENV) or 48h (HCV). Total RNA of cells in the control group and interference group was extracted by TRIzol and reversely transcribed into cDNA. Primers were designed and the replication of Zika virus, dengue virus, and hepatitis C virus genomic RNA was detected by fluorescence quantitative PCR. The specific steps are the same as those shown in 2.2.

[0126] The primer sequences are as follows:

[0127] ZIKV-F:

[0128] CGGCAATCAAGCCATCACT(SEQ ID NO:8)

[0129] ZIKV-R:

[0130] GCCTCGTCTCTTCTTCTCCTT(SEQ ID NO:9)

[0131] DENV-F:

[0132] AATCCGCTCAGTAACAAG(SEQ ID NO:10)

[0133] DENV-R:

[0134] GTTTCGGGACCATCAATA(SEQ ID NO:11)

[0135] HCV-F:

[0136] CTTCACGCAGAAAGCGTCTA(SEQ ID NO:12)

[0137] HCV-R:

[0138] CAAGCACCCTATCAGGCAGT(SEQ ID NO:13)

[0139] 4.6 Experimental Results

[0140] 50nM siRNA was transfected into Huh7 cells, and ZIKV, DENV, and HCV were infected 72h later. The cell group without siRNA transfection and virus infection was used as the blank control group (Mock); the cell group without siRNA transfection and virus infection was used as the positive control group (Ctrl); the cell group with siNC transfection and virus infection was used as the negative control group (siNC); the cell group with siPerilipin transfection and virus infection was used as the experimental group (siRNA). 24h (ZIKV, DENV) or 48h (HCV) after infection, the effect of interfering RNA on the expression of each viral protein or genomic RNA was detected by Western blot.

[0141] Compared with the control (Ctrl and siNC) groups, the expression of Zika virus, dengue virus nucleocapsid protein Capsid and hepatitis C virus core protein Core was significantly reduced after adding 50nM siRNA targeting Perilipin gene to the system (see Figure 4 A, 4B, and 4C) (***, P < 0.001).

[0142] The results are as follows Figure 4As shown, A is the expression diagram of ZIKV nucleocapsid protein Capsid after Perilipin downregulation (the primary antibody used is ZIKV Capsid, the internal reference GAPDH antibody); B is the expression diagram of dengue virus nucleocapsid protein Capsid after Perilipin downregulation (the primary antibody used is DENV Capsid, the internal reference GAPDH antibody); C is the expression diagram of hepatitis C virus core protein Core after Perilipin downregulation (the primary antibody used is HCV Core, the internal reference GAPDH antibody). Cells without virus infection were used as the experimental blank control group (Mock); cells infected with the same amount of virus without any siRNA transfection were used as the virus infection positive control group (Ctrl); cells infected with the same amount of virus transfected with siNC were used as the negative control group (siNC); cells infected with the same amount of virus transfected with siRNA targeting the Perilipin gene (SEQ ID NO: 1) were used as the experimental group (siRNA). Compared with the control group, ***, P<0.001. That is, compared with the control (Ctrl and siNC) groups, after adding 50nM siRNA targeting the Perilipin gene to the system, the expression of Zika virus, dengue virus nucleocapsid protein Capsid and hepatitis C virus core protein Core were significantly reduced (see Figure 4 (A, B, and C) (***, P < 0.001).

[0143] The results are as follows Figure 5 As shown, A, B, and C are the relative change detection graphs of the genomic RNA levels of Zika virus, dengue virus, and hepatitis C virus after Perilipin was downregulated in each experimental group relative to the experimental control group. The group of cells infected with equal amounts of virus without transfection of any siRNA was used as the virus infection positive control group (Ctrl); the group of cells infected with equal amounts of virus transfected with siNC was used as the negative control group (siNC); the group of cells infected with equal amounts of virus transfected with siRNA targeting the Perilipin gene (SEQ ID NO:1) was used as the experimental group (siRNA). Compared with the control group, **, P<0.01; ***, P<0.001. That is, compared with the control (Ctrl and siNC) groups, after adding 50nM siRNA targeting the Perilipin gene to the system, the replication levels of the genomic RNA of Zika virus, dengue virus, and hepatitis C virus were significantly reduced (see Figure 5 (A, B, and C) (**, P < 0.01; ***, P < 0.001).

[0144] The above examples are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the best embodiment, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. Application of lipid droplet coating protein Perilipin gene in the preparation of drugs for preventing or treating three flavivirus infections: Zika virus (ZIKV), dengue virus (DENV), and hepatitis C virus (HCV).

2. The use according to claim 1, characterized in that: The drug is a small nucleic acid drug that takes the lipid droplet coating protein Perilipin gene as a target.

3. The use according to claim 1, characterized in that: The drug refers to an agent that can inhibit or downregulate the expression of the lipid droplet coating protein Perilipin.

4. The use according to claim 3, characterized in that: The reagent capable of inhibiting or down-regulating the expression of the lipid droplet coating protein Perilipin is siRNA, shRNA of Perilipin or a recombinant vector containing siRNA or shRNA.

5. The use according to any one of claims 1 to 4, characterized in that: The drug is an interfering RNA of the lipid droplet coating protein Perilipin, and the sequence of the interfering RNA is selected from any one of the following: SEQ ID NO.1:GCGUUAGAGAACGUAAGCA SEQ ID NO.2: GCCGAUUAUGCUCGCAACU SEQ ID NO. 3: GAGUACUGGAGACGAAGCA.

6. Application of lipid droplet coating protein Perilipin gene in the preparation of drugs for preventing or treating three flavivirus-related diseases: Zika virus (ZIKV), dengue virus (DENV), and hepatitis C virus (HCV).

7. The use according to claim 6, characterized in that: The drug is a small nucleic acid drug that takes the lipid droplet coating protein Perilipin gene as a target.

8. The use according to claim 6, characterized in that: The drug refers to an agent that can inhibit or downregulate the expression of the lipid droplet coating protein Perilipin.

9. The use according to claim 8, characterized in that: The reagent capable of inhibiting or down-regulating the expression of the lipid droplet coating protein Perilipin is siRNA, shRNA of Perilipin or a recombinant vector containing siRNA or shRNA.

10. The use according to any one of claims 6 to 9, characterized in that: The drug is an interfering RNA of the lipid droplet coating protein Perilipin, and the sequence of the interfering RNA is selected from any one of the following: SEQ ID NO.1:GCGUUAGAGAACGUAAGCA SEQ ID NO.2: GCCGAUUAUGCUCGCAACUSEQ ID NO.3: GAGUACUGGAGACGAAGCA.

Images