Composition, kit and method for detecting HPV genotype

Abstract

The invention provides a composition, a kit and a method for detecting HPV (human papillomavirus) genotypes. The invention respectively optimizes urine extraction and PCR sensitivity, develops a method for extracting high-quality DNA from 40 mL of whole urine, and optimizes and screens a set of high-sensitivity probe primer combination. By adopting the extraction method and combining the screened probe primer combination, in urine with low HPV content, 15 HPV types including HPV53 type can be accurately and effectively detected and HPV16 / 18 can be subjected to typing only through one-tube multiple PCR reaction, the lower detection limit LOD in a urine sample reaches 10-50 copy / mL, and good sensitivity and specificity are achieved.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biological detection, and specifically relates to a composition, a kit and a method for detecting HPV genotype. Background Art

[0002] Human papillomavirus (HPV) is a common epithelial cell virus. Its genome is a double-stranded circular DNA with a length of 8000bp. It mainly encodes 8 open reading frames. The genome can be divided into three regions, namely the early region (E region), the late region (L region) and the non-coding region (NCR). The E region can be further divided into 7 open reading frames (E1-E7), which mainly encode proteins involved in viral replication, transcription, regulation and cell transformation. The L region can be divided into L1 and L2 regions, and L1 region encodes major capsid protein and minor capsid protein respectively. A total of more than 200 HPV subtypes have been discovered. Among them, high-risk HPV is closely related to the occurrence of tumors such as cervical cancer, anal canal cancer, penile cancer, and oropharyngeal cancer; while low-risk HPV infection can induce skin and mucosal system diseases such as common warts and genital warts. HPV-16 and HPV-18 have been found to be the most common subtypes that cause cervical cancer, and their typing detection is also an important basis for diversion during cervical cancer screening. Studies have shown that 99% of cervical cancer patients can detect HPV. Therefore, regular HPV testing can effectively prevent the occurrence of related cancers.

[0003] At present, the most commonly used method for clinical detection of HPV infection in my country is the liquid phase hybridization capture method. Hybridization capture has high sensitivity and can fully type the infected HPV, which is conducive to doctors to give the most reasonable follow-up treatment plan in a targeted manner. It is widely welcomed by doctors in hospitals. However, due to its long operation cycle, easy contamination, and relatively high cost, its scope of application is also limited. The HPV mRNA detection method is a new detection method. The HPV mRNA detection method has good specificity for the detection of cervical lesions after CIN2 (cervical intraepithelial neoplasia stage 2), but the detection method uses mRNA as the detection target and has high requirements for clinical specimen collection and preservation, nucleic acid extraction, etc. Fluorescence real-time PCR technology has become a major trend in today's detection methods due to its advantages such as low cost, high sensitivity, simple operation and low pollution. It is currently widely used in the field of HPV detection.

[0004] At present, fluorescent real-time PCR products are relatively mature. Companies such as Cape Bio and Shengxiang Bio have already launched a variety of products on the market, including 12+2, 13+2, 16+2 and other partial typing multiple PCR products. However, the clinical test samples used in such marketed products are usually cervical exfoliated cell samples collected by swabs or sampling brushes. Although the samples collected by cervical swabs have high sensitivity, this sampling method is invasive and may cause pain and discomfort. Due to cultural and / or religious reasons, the above invasive sampling methods are not accepted by women, especially unmarried women. This greatly reduces the willingness of women to participate in HPV testing, thereby limiting the participation rate of HPV testing. At the same time, men can also carry HPV, so detecting HPV in the male population has a positive effect on preventing the occurrence of cervical cancer in the female population. However, the sampling method commonly used by men (i.e., urethral swabs) can cause pain and discomfort, and currently listed products rarely test HPV in men, limiting the scope of application of HPV screening.

[0005] In this regard, the use of urine samples to detect HPV is an idea with broad application prospects, and many companies have begun to actively study it. The 4800HPV test is based on fluorescent real-time PCR technology and was approved by the FDA for cervical cancer screening in 2014. When Bernal et al. (Journal of Clinical Virology 61:548-552 (2014)) used 4800HPV to detect urine samples and cervical samples from the same patient, the total coincidence rate of HPV test results in urine and cervical samples was only 88%, indicating that it is feasible to use urine samples, but the sensitivity needs to be further improved. Chinese patent CN 111936641 A discloses a primer-probe combination that can detect 12+2, a total of 14 HPV high-risk types in urine samples, and its effect is basically the same as the microfluidic chip method detection using cervical exfoliated cell samples. However, although this method can achieve a similar detection effect using cervical exfoliated cells as samples, it can only detect 12+2, a total of 14 high-risk types. There are currently 18 recognized high-risk types, especially HPV53. Recent studies have shown that its importance in the occurrence of cervical cancer has been underestimated. Studies in recent years have found that the incidence and carcinogenicity of HPV53 rank very high. In 2023, a study on the incidence of HPV infection and cervical cancer in nearly 200,000 women in Guangzhou, China (Cervical HPV infection in Guangzhou, China: an epidemiological study of 198,111 women from 2015 to 2021, Emerging Microbes & Infections 2023, VOL. 12, e2176009) reported that the incidence and carcinogenicity of HPV53 ranked fifth among all HPV types.The literature Human papillomavirus genotype specific risk in cervical carcinogenesis, J Gynecol Oncol. 2019 Jul; 30(4): e52 and Prevalence characteristics of cervical human papillomavirus (HPV) infection in the Zhoupu District, Shanghai City, China, Li et al. Virology Journal (2020) 17: 84) also reported on the incidence and carcinogenicity of HPV53, and the conclusions were consistent. As can be seen from the above, previous product development obviously did not take into account the importance of HPV53 and could not meet future market demand.

[0006] Therefore, it is necessary to develop an HPV multi-type detection product that can use urine as a sample and include HPV53 type detection. Summary of the invention

[0007] In order to solve the problem that the existing technology cannot detect HPV53 from urine samples, the present invention provides a detection composition, kit and method that can use urine as a sample to type HPV16 / 18 and simultaneously detect HPV31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, and 68, a total of 13+2 HPV genotypes.

[0008] The technical solution adopted by the present invention is: a composition for detecting and / or identifying HPV genotypes, the composition comprising: An HPV 16 type probe having a base sequence as shown in any one of SEQ ID NOs. 1 to 2, an HPV 16 type upstream primer as shown in any one of SEQ ID NOs. 3 to 5, and an HPV 16 type downstream primer as shown in any one of SEQ ID NOs. 6 to 8; An HPV 18 type probe having a base sequence as shown in any one of SEQ ID NOs. 9 to 10, an HPV 18 type upstream primer as shown in any one of SEQ ID NOs. 11 to 12, and an HPV 18 type downstream primer as shown in any one of SEQ ID NOs. 13 to 14; An HPV 31 type probe having a base sequence as shown in any one of SEQ ID NOs. 15 to 16, an HPV 31 type upstream primer as shown in any one of SEQ ID NOs. 17 to 18, and an HPV 31 type downstream primer as shown in any one of SEQ ID NOs. 19 to 20; An HPV 33 type probe having a base sequence as shown in any one of SEQ ID NOs. 21 to 22, an HPV 33 type upstream primer as shown in any one of SEQ ID NOs. 23 to 24, and an HPV 33 type downstream primer as shown in any one of SEQ ID NOs. 25 to 26; An HPV 35 type probe having a base sequence as shown in any one of SEQ ID NOs. 27 to 28, an HPV 35 type upstream primer as shown in any one of SEQ ID NOs. 29 to 30, and an HPV 35 type downstream primer as shown in any one of SEQ ID NOs. 31 to 32; An HPV 39 type probe having a base sequence as shown in any one of SEQ ID NOs. 33 to 35, an HPV 39 type upstream primer as shown in any one of SEQ ID NOs. 36 to 38, and an HPV 39 type downstream primer as shown in any one of SEQ ID NOs. 39 to 40; An HPV 45 type probe having a base sequence as shown in any one of SEQ ID NOs. 41 to 43, an HPV 45 type upstream primer as shown in any one of SEQ ID NOs. 44 to 47, and an HPV 45 type downstream primer as shown in any one of SEQ ID NOs. 48 to 50; An HPV 51 type probe having a base sequence as shown in any one of SEQ ID NOs. 51 to 52, an HPV 51 type upstream primer as shown in any one of SEQ ID NOs. 53 to 54, and an HPV 51 type downstream primer as shown in any one of SEQ ID NOs. 55 to 56; An HPV 52 type probe having a base sequence as shown in any one of SEQ ID NOs. 57 to 58, an HPV 52 type upstream primer as shown in any one of SEQ ID NOs. 59 to 62, and an HPV 52 type downstream primer as shown in any one of SEQ ID NOs. 63 to 65; An HPV 53 type probe having a base sequence as shown in any one of SEQ ID NOs. 66 to 67, an HPV 53 type upstream primer as shown in any one of SEQ ID NOs. 68 to 69, and an HPV 53 type downstream primer as shown in any one of SEQ ID NOs. 70 to 71; An HPV 56 type probe having a base sequence as shown in SEQ ID NO. 72, an HPV 56 type upstream primer as shown in SEQ ID NO. 73, and an HPV 56 type downstream primer as shown in SEQ ID NO. 74; An HPV 58 type probe having a base sequence as shown in any one of SEQ ID NOs. 75 to 76, an HPV 58 type upstream primer as shown in any one of SEQ ID NOs. 77 to 78, and an HPV 58 type downstream primer as shown in any one of SEQ ID NOs. 79 to 80; An HPV 59 type probe having a base sequence as shown in any one of SEQ ID NOs. 81 to 83, an HPV 59 type upstream primer as shown in any one of SEQ ID NOs. 84 to 85, and an HPV 59 type downstream primer as shown in any one of SEQ ID NOs. 86 to 87; An HPV 66 type probe having a base sequence as shown in SEQ ID NO. 88, an HPV 66 type upstream primer as shown in SEQ ID NO. 89, and an HPV 66 type downstream primer as shown in SEQ ID NO. 90; An HPV 68 type probe having a base sequence as shown in any one of SEQ ID NOs. 91 to 94, an HPV 68 type upstream primer as shown in any one of SEQ ID NOs. 95 to 97, and an HPV 68 type downstream primer as shown in any one of SEQ ID NOs. 98 to 100; The two ends of the base sequence of the probe are respectively connected to a fluorescent reporter group and a fluorescent quencher group; wherein, the fluorescent reporter groups of the HPV 16 probe and the HPV 18 probe are different, and the fluorescent reporter groups of the HPV 16 probe and the HPV 18 probe are also different from those of the other HPV probes.

[0009] Preferably, the composition is selected from any one of combination 1, combination 2, and combination 3, and combination 1 is more preferred.

[0010] The combination 1 comprises: An HPV 16 type probe having a base sequence as shown in SEQ ID NO. 1, an HPV 16 type upstream primer as shown in SEQ ID NO. 4, and an HPV 16 type downstream primer as shown in SEQ ID NO. 8; The base sequence of the HPV 18 type probe is shown in SEQ ID NO. 9, the HPV 18 type upstream primer is shown in SEQ ID NO. 11, and the HPV 18 type downstream primer is shown in SEQ ID NO. 13; An HPV 31 type probe having a base sequence as shown in SEQ ID NO. 15, an HPV 31 type upstream primer as shown in SEQ ID NO. 17, and an HPV 31 type downstream primer as shown in SEQ ID NO. 19; An HPV 33 type probe having a base sequence as shown in SEQ ID NO. 21, an HPV 33 type upstream primer as shown in SEQ ID NO. 23, and an HPV 33 type downstream primer as shown in SEQ ID NO. 25; An HPV 35 type probe having a base sequence as shown in SEQ ID NO. 27, an HPV 35 type upstream primer as shown in SEQ ID NO. 29, and an HPV 35 type downstream primer as shown in SEQ ID NO. 31; An HPV 39 type probe having a base sequence as shown in SEQ ID NO. 35, an HPV 39 type upstream primer as shown in SEQ ID NO. 38, and an HPV 39 type downstream primer as shown in SEQ ID NO. 39; An HPV 45 type probe having a base sequence as shown in SEQ ID NO. 43, an HPV 45 type upstream primer as shown in SEQ ID NO. 45, and an HPV 45 type downstream primer as shown in SEQ ID NO. 48; An HPV 51 type probe having a base sequence as shown in SEQ ID NO. 51, an HPV 51 type upstream primer as shown in SEQ ID NO. 53, and an HPV 51 type downstream primer as shown in SEQ ID NO. 55; An HPV 52 type probe having a base sequence as shown in SEQ ID NO. 58, an HPV 52 type upstream primer as shown in SEQ ID NO. 62, and an HPV 52 type downstream primer as shown in SEQ ID NO. 64; An HPV 53 type probe having a base sequence as shown in SEQ ID NO. 66, an HPV 53 type upstream primer as shown in SEQ ID NO. 68, and an HPV 53 type downstream primer as shown in SEQ ID NO. 70; An HPV 56 type probe having a base sequence as shown in SEQ ID NO. 72, an HPV 56 type upstream primer as shown in SEQ ID NO. 73, and an HPV 56 type downstream primer as shown in SEQ ID NO. 74; An HPV 58 type probe having a base sequence as shown in SEQ ID NO. 75, an HPV 58 type upstream primer as shown in SEQ ID NO. 77, and an HPV 58 type downstream primer as shown in SEQ ID NO. 79; An HPV 59 type probe having a base sequence as shown in SEQ ID NO. 82, an HPV 59 type upstream primer as shown in SEQ ID NO. 84, and an HPV 59 type downstream primer as shown in SEQ ID NO. 86; An HPV 66 type probe having a base sequence as shown in SEQ ID NO. 88, an HPV 66 type upstream primer as shown in SEQ ID NO. 89, and an HPV 66 type downstream primer as shown in SEQ ID NO. 90; The base sequence is the HPV 68 type probe shown in SEQ ID NO. 93, the HPV 68 type upstream primer shown in SEQ ID NO. 95, and the HPV 68 type downstream primer shown in SEQ ID NO. 98.

[0011] The combination 2 comprises: The base sequence of the HPV 16 type probe is shown in SEQ ID NO. 2, the HPV 16 type upstream primer is shown in SEQ ID NO. 5, and the HPV 16 type downstream primer is shown in SEQ ID NO. 8; The base sequence of the HPV 18 type probe is shown in SEQ ID NO. 9, the HPV 18 type upstream primer is shown in SEQ ID NO. 11, and the HPV 18 type downstream primer is shown in SEQ ID NO. 13; The base sequence of the HPV 31 type probe is shown in SEQ ID NO. 15, the HPV 31 type upstream primer is shown in SEQ ID NO. 18, and the HPV 31 type downstream primer is shown in SEQ ID NO. 19; An HPV 33 type probe having a base sequence as shown in SEQ ID NO. 21, an HPV 33 type upstream primer as shown in SEQ ID NO. 24, and an HPV 33 type downstream primer as shown in SEQ ID NO. 26; An HPV 35 type probe having a base sequence as shown in SEQ ID NO. 27, an HPV 35 type upstream primer as shown in SEQ ID NO. 29, and an HPV 35 type downstream primer as shown in SEQ ID NO. 31; An HPV 39 type probe having a base sequence as shown in SEQ ID NO. 34, an HPV 39 type upstream primer as shown in SEQ ID NO. 38, and an HPV 39 type downstream primer as shown in SEQ ID NO. 39; An HPV 45 type probe having a base sequence as shown in SEQ ID NO. 43, an HPV 45 type upstream primer as shown in SEQ ID NO. 45, and an HPV 45 type downstream primer as shown in SEQ ID NO. 48; An HPV 51 type probe having a base sequence as shown in SEQ ID NO. 51, an HPV 51 type upstream primer as shown in SEQ ID NO. 53, and an HPV 51 type downstream primer as shown in SEQ ID NO. 55; An HPV 52 type probe having a base sequence as shown in SEQ ID NO. 57, an HPV 52 type upstream primer as shown in SEQ ID NO. 59, and an HPV 52 type downstream primer as shown in SEQ ID NO. 63; An HPV 53 type probe having a base sequence as shown in SEQ ID NO. 66, an HPV 53 type upstream primer as shown in SEQ ID NO. 68, and an HPV 53 type downstream primer as shown in SEQ ID NO. 70; An HPV 56 type probe having a base sequence as shown in SEQ ID NO. 72, an HPV 56 type upstream primer as shown in SEQ ID NO. 73, and an HPV 56 type downstream primer as shown in SEQ ID NO. 74; An HPV 58 type probe having a base sequence as shown in SEQ ID NO. 75, an HPV 58 type upstream primer as shown in SEQ ID NO. 77, and an HPV 58 type downstream primer as shown in SEQ ID NO. 79; An HPV 59 type probe having a base sequence as shown in SEQ ID NO. 82, an HPV 59 type upstream primer as shown in SEQ ID NO. 85, and an HPV 59 type downstream primer as shown in SEQ ID NO. 87; An HPV 66 type probe having a base sequence as shown in SEQ ID NO. 88, an HPV 66 type upstream primer as shown in SEQ ID NO. 89, and an HPV 66 type downstream primer as shown in SEQ ID NO. 90; The base sequence is the HPV 68 type probe shown in SEQ ID NO. 93, the HPV 68 type upstream primer shown in SEQ ID NO. 96, and the HPV 68 type downstream primer shown in SEQ ID NO. 99.

[0012] The combination 3 comprises: An HPV 16 type probe having a base sequence as shown in SEQ ID NO. 1, an HPV 16 type upstream primer as shown in SEQ ID NO. 5, and an HPV 16 type downstream primer as shown in SEQ ID NO. 8; An HPV 18 type probe having a base sequence as shown in SEQ ID NO. 10, an HPV 18 type upstream primer as shown in SEQ ID NO. 12, and an HPV 18 type downstream primer as shown in SEQ ID NO. 14; The base sequence of the HPV 31 type probe is shown in SEQ ID NO. 15, the HPV 31 type upstream primer is shown in SEQ ID NO. 18, and the HPV 31 type downstream primer is shown in SEQ ID NO. 20; An HPV 33 type probe having a base sequence as shown in SEQ ID NO. 21, an HPV 33 type upstream primer as shown in SEQ ID NO. 23, and an HPV 33 type downstream primer as shown in SEQ ID NO. 26; An HPV 35 type probe having a base sequence as shown in SEQ ID NO. 27, an HPV 35 type upstream primer as shown in SEQ ID NO. 27, and an HPV 35 type downstream primer as shown in SEQ ID NO. 31; An HPV 39 type probe having a base sequence as shown in SEQ ID NO. 35, an HPV 39 type upstream primer as shown in SEQ ID NO. 36, and an HPV 39 type downstream primer as shown in SEQ ID NO. 39; An HPV 45 type probe having a base sequence as shown in SEQ ID NO. 43, an HPV 45 type upstream primer as shown in SEQ ID NO. 44, and an HPV 45 type downstream primer as shown in SEQ ID NO. 49; An HPV 51 type probe having a base sequence as shown in SEQ ID NO. 52, an HPV 51 type upstream primer as shown in SEQ ID NO. 54, and an HPV 51 type downstream primer as shown in SEQ ID NO. 55; An HPV 52 type probe having a base sequence as shown in SEQ ID NO. 58, an HPV 52 type upstream primer as shown in SEQ ID NO. 62, and an HPV 52 type downstream primer as shown in SEQ ID NO. 63; An HPV 53 type probe having a base sequence as shown in SEQ ID NO. 67, an HPV 53 type upstream primer as shown in SEQ ID NO. 69, and an HPV 53 type downstream primer as shown in SEQ ID NO. 71; An HPV 56 type probe having a base sequence as shown in SEQ ID NO. 72, an HPV 56 type upstream primer as shown in SEQ ID NO. 73, and an HPV 56 type downstream primer as shown in SEQ ID NO. 74; An HPV 58 type probe having a base sequence as shown in SEQ ID NO. 76, an HPV 58 type upstream primer as shown in SEQ ID NO. 78, and an HPV 58 type downstream primer as shown in SEQ ID NO. 80; An HPV 59 type probe having a base sequence as shown in SEQ ID NO. 81, an HPV 59 type upstream primer as shown in SEQ ID NO. 84, and an HPV 59 type downstream primer as shown in SEQ ID NO. 86; An HPV 66 type probe having a base sequence as shown in SEQ ID NO. 88, an HPV 66 type upstream primer as shown in SEQ ID NO. 89, and an HPV 66 type downstream primer as shown in SEQ ID NO. 90; The base sequence is the HPV 68 type probe shown in SEQ ID NO. 91, the HPV 68 type upstream primer shown in SEQ ID NO. 95, and the HPV 68 type downstream primer shown in SEQ ID NO. 100.

[0013] Referring to Table 1, compared with the most commonly used 12+2 detection reagents, the composition provided by the present invention adds primers and probes that can detect HPV53 types with higher incidence and carcinogenicity, thereby improving the effectiveness of HPV detection in preventing cervical cancer. Furthermore, in response to the problem that the sensitivity of HPV detection using urine as a sample is lower than that of cervical exfoliated cells, the present invention has carried out adaptive screening and optimization in the design of primers and probes, and also considered the effect of combining primers and probes of 13+2 HPV types. It is necessary not only to ensure the specificity and sensitivity of each detection type of probe and primer, but also to avoid mutual influence between primers and probes of different detection types (such as the formation of dimers or non-specific products, etc.), so that the composition can accurately and effectively detect a total of 15 HPV types (HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68) including HPV53 and type HPV16 / 18 in urine with low HPV content with only one tube of multiplex PCR reaction. Taking CV < 5% as the standard, a preferred 13+2 type composition (combination 1) provided by the present invention has a detection limit LOD of 10~30 copies / reaction and 5~40 copies / mL for 13+2 type HPV standards and urine samples. The detection limit LOD effect obtained by the preferred 13+2 type composition in urine samples was unexpected. In summary, obtaining the preferred 13+2 type primer-probe composition with good specificity and sensitivity of the present application and combining it with a fluorescent labeling system with good reporting effect, and then obtaining the composition with an extremely low detection limit in urine samples for which protection is requested by the present invention is not obtained solely through logical analysis, reasoning or limited experiments based on the prior art.

[0014] Preferably, the composition further comprises: an internal reference ACTB probe as shown in SEQ ID NO. 101, an internal reference ACTB upstream primer as shown in SEQ ID NO. 102, and an internal reference ACTB downstream primer as shown in SEQ ID NO. 103; wherein the fluorescent reporter group of the internal reference ACTB probe is different from that of the HPV probe. The internal reference gene is Actin (ACTB). That is, the composition of the present invention may further comprise an internal standard primer and an internal standard probe, which may be used in conjunction with other primers and probes in the composition of the present invention without affecting each other. The use of the internal standard primer and the probe can determine whether the detection is effective, and further ensure the detection accuracy of the composition.

[0015] Table 1. Composition for detecting HPV genotypes SEQ ID NO. name Sequence information (5' to 3') 1 Probe HPV16-P1 CAACATATTCATCCGTGCTTACAACCT 2 Probe HPV16-P2 CCAGGAGGCACACTAGAAGATACT 3 Primer HPV16-F1 GGACTGGAATTTTGGTC 4 Primer HPV16-F2 GTCTACTTGCCTCCTG 5 Primer HPV16-F3 ACTGGAATTTTGGTCTAC 6 Primer HPV16-R1 GGGATCATCTTCTTTAGG 7 Primer HPV16-R2 GTGCTGGAGGTGTATG 8 Primer HPV16-R3 CCTGCATGATAATATATGTTTG 9 Probe HPV18-P1 TGGCTCTATTGTTACCTCTGACTCC 10 Probe HPV18-P2 TTCTTCCTCTGAGTCGCTTAATTGCT 11 Primer HPV18-F1 GTGTGTATTCTCCCTCTC 12 Primer HPV18-F2 CGGTTGACCTTCTATGTC 13 Primer HPV18-R1 TGCCTTATGTAACCAATATG 14 Primer HPV18-R2 GCTGGTAAATGTTGATGATTA 15 Probe HPV31-P1 TGTGTTTGTTTATAATCCAT 16 Probe HPV31-P2 ATTATCAGTGCCAGGACCACCG 17 Primer HPV31-F1 GCACTGATAATAGGGAATG 18 Primer HPV31-F2 AGTGGTCATCCATTACTAA 19 Primer HPV31-R1 GCAACCAAGTAAACACAG 20 Primer HPV31-R2 GCTGTGTTTGTTTATAATCC 21 Probe HPV33-P1 TGTGTTTGTTTATAATCCAT 22 Probe HPV33-P2 CACCTGCCAATGATTGTCCACC 23 Primer HPV33-F1 TGCTGATAATAGGGAATGT 24 Primer HPV33-F2 AGGTGTTGCTTGTACTAA 25 Primer HPV33-R1 GCTTACATCCAAGTAAACATA 26 Primer HPV33-R2 TCACCATCCTCAATAATAGTA 27 Probe HPV35-P1 TGTGTTTGTTTATAATCCAT 28 Probe HPV35-P2 CACACCTTGTAATGCTAACCAGG 29 Primer HPV35-F1 GGTACAGATAACAGGGAAT 30 Primer HPV35-F2 CTCCTATAGGTGAACATTG 31 Primer HPV35-R1 CTACAACCTATTAAACACAAT 32 Primer HPV35-R2 CAGTGTTTAGTAACTCCAAA 33 Probe HPV39-P1 ACTGTCCTCCTTTGGAC 34 Probe HPV39-P2 CATGCAAGCCCAATAATG 35 Probe HPV39-P3 AGGTGTCTGCATATC 36 Primer HPV39-F1 TGGTGGTCGCAAGCAG 37 Primer HPV39-F2 GGCCAGCCATTGGGTGT 38 Primer HPV39-F3 AATGGTGGTCGCAAG 39 Primer HPV39-R1 ATACTGAATTTATTAGGATCGG 40 Primer HPV39-R2 ACCAACACCCAATGGCTGGCC 41 Probe HPV45-P1 CAAATGTCTGCTGATCC 42 Probe HPV45-P2 TCCATCTGTAAATATC 43 Probe HPV45-P3 TCATATTCCTCCACATG 44 Primer HPV45-F1 AATCCTGTGCCAAGTAC 45 Primer HPV45-F2 ATATGATCCTACTAAGTTTAAGC 46 Primer HPV45-F3 TATGTGCCTCTACACAA 47 Primer HPV45-F4 TCCTACTAAGTTTAAGCAATATAG 48 Primer HPV45-R1 ATATGATCCYACTAAGTTTAAGC 49 Primer HPV45-R2 CCTCTGCAGTTAAAGTAATAG 50 Primer HPV45-R3 CACAACTGAAAAATAAACTGTAA 51 Probe HPV51-P1 TAGGCTGTGCTCCA 52 Probe HPV51-P2 CATAACTGAGTCTG 53 Primer HPV51-F1 CAAACAGACTCAGTTATGTATA 54 Primer HPV51-F2 TTAGAGATAACACATCTGTTG 55 Primer HPV51-R1 GCATGTAGTGCCAATAC 56 Primer HPV51-R2 GGTCATCCCTTATTTAATAAATATG 57 Probe HPV52-P1 AACAGTAGGACATCC 58 Probe HPV52-P2 ACCACTCGTAGCACTAACATGACTT 59 Primer HPV52-F1 AGGGAATGTTTATCTATGGAT 60 Primer HPV52-F2 GCAGGCAGTTCTCG 61 Primer HPV52-F3 GGAATGTTTATCTATGGATTATAAG 62 Primer HPV52-F4 TTGTCACAGTTGTGGA 63 Primer HPV52-R1 CATTACCACTACTGGTGT 64 Primer HPV52-R2 CATGACGAAGGTATTCCT 65 Primer HPV52-R3 CCATGACGAAGGTATTCC 66 Probe HPV53-P1 ATTACAACGGATGCC 67 Probe HPV53-P2 CTAAACACCCTATACTGA 68 Primer HPV53-F1 CCTACCCCTGTATCAAAG 69 Primer HPV53-F2 ACATCCCTAAGGTGTCT 70 Primer HPV53-R1 AATATAGTGGTGCGTTTTAC 71 Primer HPV53-R2 ATCTGGGAGGCGTAC 72 Probe HPV56-P1 TCATATTCCTCCACATG 73 Primer HPV56-F1 CGAAAAATTAATCAGTACCTTAG 74 Primer HPV56-R1 GCATAATTGAAAAACAAATTGTAA 75 Probe HPV58-P1 TGTGTTTGTTTATAATCCAT 76 Probe HPV58-P2 CTGCTACTGATTGTCCTCCATTGG 77 Primer HPV58-F1 CTGATAACAGGGAATGC 78 Primer HPV58-F2 GTTCCTTGTAACAATAATGC 79 Primer HPV58-R1 GTTTACAGCCAATTAAACATAA 80 Primer HPV58-R2 GTCACCATCCTCAATAATAG 81 Probe HPV59-P1 CTTCTTACAGTTGGAC 82 Probe HPV59-P2 AGGTGTCTGCATATC 83 Probe HPV59-P3 ACGTGCCAACCCAGGCAGT 84 Primer HPV59-F1 GGTAGACAGGATGTTCC 85 Primer HPV59-F2 CTTCCTGAATCACTATATA 86 Primer HPV59-R1 GTAAMTTAACCCTAAATACTCTGT 87 Primer HPV59-R2 GCCAACCCAGGCAGTTATTCG 88 Probe HPV66-P1 TCATATTCCTCCACATG 89 Primer HPV66-F1 TGAAATCAATCAATACCTTCG 90 Primer HPV66-R1 AGTTGAAACACAAACTGTAG 91 Probe HPV68-P1 CACTGACATTCGTGAAAC 92 Probe HPV68-P2 ATCCTGACTATTTGCAAAT 93 Probe HPV68-P3 AGGTGTCTGCATATC 94 Probe HPV68-P4 ACAGAGTGTTTAGGGT 95 Primer HPV68-F1 CGCAAGCAGGRCATT 96 Primer HPV68-F2 AGGTYCCTATGTCTGG 97 Primer HPV68-F3 CGCAAGCAGGRCATT 98 Primer HPV68-R1 GRTTATATAATGTAGACTCAGG 99 Primer HPV68-R2 GGAAATCCTAAACACCCT 100 Primer HPV68-R3 GGATCAGGTAGGGAAATC 101 Internal reference probe ACTB-P CACTGGCATCGTGATGGACTCCG 102 Internal reference primer ACTB-F GCCATGTACGTTGCTATC 103 Internal reference primer ACTB-R GAGGTAGTCAGTCAGGTC Preferably, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, ROX, TAMRA, Cy3, Cy3.5, Cy5, Cy5.5, OregonGreenTM, CALRedTM, Red640, Texas Red, LighterCycler®Cyan500, LighterCycler®, Red610, biotin-binding material, Alexa 647, Alexa 555, 5-(2-aminoethyl)amino-1-naphthalenesulfonic acid, tetramethylrhodamine, tetramethylrhodamine isocyanate, fluorescein isocyanate, and χ-rhodamine.

[0016] Preferably, the fluorescence quenching group is selected from DDQ-I, DDQ-II, Dabcyl, Eclipse, Iowa BlackFQ, Iowa Black RQ, BHQ1, BHQ2, BHQ3, QSY7, QSY9, and QSY21.

[0017] Preferably, the fluorescent reporter group of the HPV 16 type probe is VIC, the fluorescent reporter group of the HPV 18 type probe is ROX, the fluorescent reporter groups of the remaining HPV probes are FAM, and the fluorescent reporter group of the internal reference ACTB probe is Cy5.

[0018] Preferably, the fluorescence quenching group of the HPV 16 and HPV 52 probes is BHQ1, the fluorescence quenching group of the HPV 18 probe is BHQ2, the fluorescence quenching group of the remaining HPV probes is MGB, and the fluorescence quenching group of the internal reference ACTB probe is BHQ3.

[0019] The present invention also provides the use of the composition in preparing a kit for detecting and / or identifying HPV genotypes.

[0020] The present invention also provides a kit for detecting and / or identifying HPV genotypes, the kit comprising the composition.

[0021] Preferably, the kit further comprises a reagent for isolating DNA from a sample. The reagent for isolating DNA from a urine sample comprises at least one of a stabilizer, purification beads, urine cell digestion solution, proteinase K, lysis solution, and ethanol.

[0022] Preferably, the lysate comprises: 2-5 M guanidine isothioate, 10-100 mM EDTA, 10-100 mMTris, 1%-12% Triton, 0.5%-2% SDS. More preferably, the lysate comprises: 4-5 M guanidine isothioate, 10-20 mM EDTA, 10-20 mM Tris, 2%-4% Triton, 1%-2% SDS.

[0023] Preferably, the urine cell digestion solution comprises: 100-150 mM EDTA, 3%-8% Triton, pH 5.5-6. More preferably, the urine cell digestion solution comprises: 100 mM EDTA, 3%-8% Triton, pH 5.5.

[0024] Preferably, the concentration of proteinase K is 20-50 mg / mL, more preferably 50 mg / mL.

[0025] The sample is selected from cervical smear, fresh tissue sample, fixed tissue sample, tissue sample section sample, urine sample, sample containing exfoliated cells, peripheral blood sample, penis swab, or other body fluids, more preferably a urine sample. The urine sample is selected from whole urine sample or urine supernatant sample.

[0026] The present invention also provides a method for detecting and / or identifying HPV genotypes in vitro for non-diagnostic purposes, the method comprising the following steps: Step 1: Extract DNA from the sample to be tested; Step 2: using the composition or the kit to perform fluorescent quantitative PCR on the DNA obtained in step 1; Step 3: Obtain and analyze the results.

[0027] Preferably, the sample is selected from cervical smear, fresh tissue sample, fixed tissue sample, tissue sample slice sample, urine sample, sample containing exfoliated cells, peripheral blood sample, penis swab, or other body fluids, more preferably a urine sample. The urine sample is selected from whole urine sample or urine supernatant sample.

[0028] Preferably, the step 1 comprises: Purification beads were added to the urine sample, vortexed, centrifuged, and the cell pellet was collected; After the cell pellet was mixed with urine cell digestion solution, 20-50 mg / mL proteinase K was added and incubated at 55°C for 0.5-1 h, vortexed, and incubated; After adding lysis solution and ethanol to the incubation system, the adsorption column is passed through, and the adsorption column after the addition of the sample is washed 3 to 4 times with a washing solution and centrifuged, and the washed adsorption column is eluted with water, and the solution containing DNA is collected after centrifugation; The lysate comprises: 2-5 M guanidine isothioate, 10-100 mM EDTA, 10-100 mM Tris, 1%-12% Triton, and 0.5%-2% SDS; The urine cell digestion solution includes: 100-150 mM EDTA, 3%-8% Triton, pH 5.5-6.

[0029] The present invention also provides a reagent for separating DNA from a urine sample, comprising at least one of a stabilizer, purification beads, urine cell digestion solution, proteinase K, lysis solution, and ethanol; the urine sample is selected from a whole urine sample or a urine supernatant sample.

[0030] Preferably, the lysate comprises: 2-5 M guanidine isothioate, 10-100 mM EDTA, 10-100 mMTris, 1%-12% Triton, 0.5%-2% SDS. More preferably, the lysate comprises: 4-5 M guanidine isothioate, 10-20 mM EDTA, 10-20 mM Tris, 2%-4% Triton, 1%-2% SDS.

[0031] Preferably, the urine cell digestion solution comprises: 100-150 mM EDTA, 3%-8% Triton, pH 5.5-6. More preferably, the urine cell digestion solution comprises: 100 mM EDTA, 3%-8% Triton, pH 5.5.

[0032] Preferably, the concentration of proteinase K is 20-50 mg / mL, more preferably 50 mg / mL.

[0033] The present invention also provides a method for separating DNA from a urine sample using the reagent for separating DNA from a urine sample, the method comprising the following steps: Purification beads were added to the urine sample, vortexed, centrifuged, and the cell pellet was collected; After the cell pellet was mixed with urine cell digestion solution, 20-50 mg / mL proteinase K was added and incubated at 55°C for 0.5-1 h, vortexed, and incubated; After adding lysis solution and ethanol to the incubation system, the adsorption column is passed through, and the adsorption column after the addition of the sample is washed 3 to 4 times with a washing solution and centrifuged. The washed adsorption column is eluted with water, and the solution containing DNA is collected after centrifugation.

[0034] In order to ensure that the DNA sample detected by PCR contains a higher concentration of HPV virus and improve the sensitivity of urine HPV detection, the present invention also improves the method of separating DNA from urine samples, through the method of magnetic bead purification combined with adsorption column, and specifically adjusts the lysate formula, adjusts the concentration and digestion time of cell digestion solution and proteinase K, the formula and washing method of washing solution, etc., while avoiding PCR inhibitory components, effectively increasing the amount of DNA extracted from urine. Therefore, the preferred 13+2 type primer probe composition with good specificity and sensitivity of the present invention is combined with a fluorescent labeling system with good reporting effect, and combined with the improved method of extracting high-quality whole urine DNA from urine samples, a total of 15 types of HPV, including HPV53, can be accurately and effectively detected and HPV16 / 18 can be typed in urine with low HPV content through a one-tube multiple PCR reaction, and the detection limit is extremely low in urine samples.

[0035] Beneficial effects of the present invention: According to existing research results and literature reports, the biggest drawback of urine sample detection of HPV is that the viral load is too low. Compared with traditional cervical swabs, the viral load may be only one-tenth or even one-hundredth of that, which is the fundamental reason for the low sensitivity of urine sample detection of HPV. To solve this problem, it is necessary to optimize and improve from two aspects: on the one hand, develop better urine extraction technology to ensure that more nucleic acids are extracted from urine; on the other hand, improve the detection sensitivity of HPV test kit PCR to ensure that HPV infection can be detected even with a lower HPV viral load. Therefore, the present invention optimizes urine extraction and PCR sensitivity respectively, develops a method that can extract high-quality DNA from 40 mL of whole urine, and optimizes and screens a set of highly sensitive probe primer combinations. By using this extraction method and combining it with the screened probe primer combination, a total of 15 HPV types (HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68) including HPV53 can be accurately and effectively detected in urine with low HPV content, and HPV16 / 18 can be typed. The detection limit in urine samples reaches 5~40 copies / mL, with good sensitivity and specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The amplification results of all types of combination 1 in Example 2 of the present invention were performed in the same tube.

[0037] Figure 2 This is the template-free result of the same-tube reaction of all types of combination 1 in Example 2 of the present invention.

[0038] Figure 3The amplification results of all types of combination 2 in Example 2 of the present invention were performed in the same tube.

[0039] Figure 4 This is the template-free result of the same-tube reaction of all types of combination 2 in Example 2 of the present invention.

[0040] Figure 5 The amplification results of all types of combination 3 in Example 2 of the present invention were performed in the same tube.

[0041] Figure 6 This is the template-free result of the same-tube reaction of all types of combination 3 in Example 2 of the present invention.

[0042] Figure 7 The results of fluorescence quantitative PCR detection of all types of combination 1 in Example 4 of the present invention are shown. DETAILED DESCRIPTION

[0043] The following is an explanation of the embodiments of the present invention by specific specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied by other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the absence of conflict, the features in the following embodiments and embodiments can be combined with each other. In the embodiments of the present invention, the methods used are all conventional methods unless otherwise specified, and the reagents used can be obtained from commercial sources.

[0044] Example 1: Extracting DNA from urine samples Experiment 1. Optimization of lysis buffer formula Collect 500 ml of urine in total, take a 50 mL centrifuge tube, add 40 mL of urine respectively, the whole urine is coded as C, and the supernatant is coded as S. S sample is: the whole urine sample is centrifuged at 3000 g for 15 minutes, the supernatant is collected, and the sediment is discarded. The subsequent S sample and C sample supernatant are extracted and processed simultaneously. Among them, the lysates used in the urine extraction scheme provided in this embodiment are lysate 1, lysate 2, lysate 3, lysate 4, and lysate 5, respectively. The core component of the lysate, guanidine isothioate, is optimized, and its auxiliary components, Triton and SDS, are verified and compared within the conventional use range, while conventional DNA enzyme inhibitors and buffers EDTA and Tris are verified within the appropriate use range.

[0045] Lysis buffer 1 components: 2 M guanidine isothioate, 10 mM EDTA, 10 mM Tris, 1% Triton, 0.5% SDS.

[0046] Lysis buffer 2 components: 3 M guanidine isothioate, 20 mM EDTA, 20 mM Tris, 2% Triton, 1% SDS.

[0047] Lysis buffer 3 components: 4 M guanidine isothioate, 20 mM EDTA, 20 mM Tris, 2% Triton, 1% SDS.

[0048] Lysis buffer 4 components: 4.5 M guanidine isothioate, 20 mM EDTA, 20 mM Tris, 2% Triton, 1% SDS.

[0049] Lysis buffer 5 components: 5 M guanidine isothioate, 20 mM EDTA, 20 mM Tris, 4% Triton, 2% SDS.

[0050] The specific steps of extracting the DNA to be tested from the urine sample provided in this embodiment include: 1. Add 10 μL of purified beads (Thermo Fisher Scientific 37002D) to the supernatant of S sample or C sample, vortex and centrifuge at 3000 g for 15 minutes to collect the cell pellet; 2. Remove the supernatant and keep 100 μL of cell pellet (if less than 100 μL, add water to 100 μL); add 100 μL of urine cell digestion solution (ZYMO, product number BJD3061-3-20) to the cell pellet; 3. Add 10 μL proteinase K (20 mg / mL, MCE), vortex and incubate at 55°C for 30 minutes; 4. Add 210 μL of lysis buffer and 420 μL of anhydrous ethanol, pass through an adsorption column (Tiangen Bio CA5), and centrifuge at 13000g for 2 min; 5. Add 700 μL of washing solution (70% ethanol, 50 mM hepes, 100 mM sodium chloride, pH=7.2) to the adsorption column, centrifuge at 13000 g for 2 min, and discard the washing solution; 6. Add 700 μL of 85% ethanol to the adsorption column and centrifuge at 13,000 g for 2 min, discarding the washing solution; 7. Add 700 μL of 85% ethanol to the adsorption column and centrifuge at 13,000 g for 3 min, discarding the washing solution; 8. Place the adsorption column in a 1.5 mL centrifuge tube, add 50 μL of water for elution, let stand at room temperature for 5 min, centrifuge at 12000 g for 2 min, collect the precipitate, and store at 4°C for later use.

[0051] The Qubit of the extracted DNA solution was measured and the average concentration was compared. The results are shown in Table 2.

[0052] Table 2. DNA concentrations (ng / μL) extracted from urine samples using different methods / lysis buffers sample volume Lysis buffer 1 Lysis buffer 2 Lysate 3 Lysis buffer 4 Lysis buffer 5 Supernatant 40 mL 1.5 2.5 6.2 7.5 7.3 Full urine 40 mL 3.8 5.8 15.9 23.3 24.1 Results and discussion: There is no significant difference between lysis buffer 4 and lysis buffer 5. Considering the reagent cost and preparation difficulty, a formula with a lower concentration but can achieve the expected effect is preferred as much as possible. The preferred formula of lysis buffer 4 of the present invention is: 4.5 M guanidine isothioate, 20 mM EDTA, 20 mM Tris, 2% Triton, and 1% SDS.

[0053] Experiment 2. Optimization of urine cell digestion solution Cell digestion solution formula: Digestion solution 1: 4 mM Tris, 6 mM EDTA (pH 8.0), 1 M guanidine bisulfate.

[0054] Digestion solution 2: 100 mM Tris (pH 8.0), 20 mM calcium chloride, 3% Triton.

[0055] Digestion solution 3: 150 mM Tris (pH 6.0), 150 mM acetic acid, 80 mM calcium chloride, 3% Triton.

[0056] Digestion solution 4: 100 mM EDTA (pH 5.5), 3% Triton.

[0057] Digestion solution 5: 100 mM EDTA (pH 5.5), 8% Triton.

[0058] The urine samples were processed and extracted according to the methods and steps of Experiment 1. The optimized lysis buffer 4 was used as the lysis buffer. The Qubit of the extracted DNA solution was measured and the average concentration was compared. The results are shown in Table 3.

[0059] Table 3. DNA solution concentrations (ng / μL) extracted from urine samples using different digestion solutions sample volume Digestive juice 1 Digestive juice 2 Digestive juice 3 Digestive juice 4 Digestive juice 5 Supernatant 40 mL 1.5 4.5 0.7 6.8 5.3 Full urine 40 mL 3.8 11.2 1.5 21.7 17.2 Results and discussion: Compared with digestion solutions 2-3 using Tris as buffer, digestion solutions 4-5 used pH 5.5 EDTA as buffer and supplemented with appropriate concentration of Triton, which had a better effect on the extraction of DNA from urine samples. The best urine cell digestion solution was digestion solution 4: 100 mM EDTA (pH 5.5), 3% Triton.

[0060] Experiment 3: Optimization of proteinase K dosage and reaction time Reaction condition 1: 20 mg / mL proteinase K, 55°C for half an hour.

[0061] Reaction condition 2: 20 mg / mL proteinase K, 55°C for 1 hour.

[0062] Reaction condition 3: 50 mg / mL proteinase K, 55°C for half an hour.

[0063] Reaction condition 4: 50 mg / mL proteinase K, 55°C for 1 hour.

[0064] The urine samples were processed and extracted according to the methods and steps of Experiment 1, wherein step 3 was adjusted according to the above reaction conditions 1 to 4, the optimized lysis solution 4 was used as the lysis solution, and the optimized digestion solution 4 was used as the digestion solution. The Qubit of the extracted DNA solution was measured and the average concentration was compared. The results are shown in Table 4.

[0065] Table 4. DNA solution concentration (ng / μL) extracted from urine samples using different proteinase K reaction conditions sample Reaction conditions 1 Reaction Condition 2 Reaction conditions 3 Reaction Conditions 4 Supernatant 40 mL 7.2 8.3 8.7 8.1 Full urine 40 mL 23.8 27.2 31.6 32.7 Results and discussion: Prolonging the proteinase K digestion time and increasing the proteinase K concentration can significantly increase the recovery concentration of total urine DNA, but prolonging the reaction time will significantly increase the labor cost, and long-term reaction will also affect the stability of DNA. Therefore, the preferred reaction condition 3: 50 mg / mL proteinase K, 55℃ for half an hour Experiment 4: Comparison of the optimized extraction scheme with the urine extraction using the ZYMO kit A total of 500 mL of urine was collected, and 40, 20, and 10 mL of urine were added to a 50 mL centrifuge tube, respectively. The whole urine sample was coded C, and the supernatant sample was coded S. The S sample was: the whole urine sample was centrifuged at 3000 g for 15 minutes, the supernatant was collected, and the sediment was discarded. Subsequently, the S sample and the C sample were extracted simultaneously, and the urine extraction scheme provided by the present invention and the ZYMO D3061 kit were used for extraction, respectively, and the difference in extraction effect between the two schemes was compared.

[0066] Table 5. DNA concentrations (ng / μL) extracted from urine samples using different extraction protocols sample volume The present invention ZYMO Supernatant 10 mL 4.43 1.41 Supernatant 20 mL 8.20 1.74 Supernatant 40 mL 9.35 3.74 Full urine 10 mL 11.20 5.50 Full urine 20 mL 19.45 11.70 Full urine 40 mL 39.35 29.70 Results and Discussion: In order to ensure that the DNA sample detected by PCR contains a higher concentration of HPV virus and improve the sensitivity of urine HPV detection, this embodiment improves the method of separating DNA from urine samples, through the method of magnetic bead purification combined with adsorption column, and specifically adjusts the lysate formula, the concentration and digestion time of cell digestion solution and proteinase K, the formula and washing method of washing solution, etc., while avoiding PCR inhibitory components, the extraction amount of DNA in urine is effectively increased. Using the extraction scheme provided by the present invention, a DNA solution with a concentration of nearly 40ng / μL can be extracted from 40 mL of whole urine sample, which is 32% higher than the prior art ZYMO, thereby helping the primer / probe combination provided by the present invention to accurately and effectively detect a total of 15 HPV types including HPV53 and type HPV16 / 18 through a one-tube multiple PCR reaction in urine with low HPV content, and has an extremely low detection limit in urine samples.

[0067] Example 2: Composition for detecting HPV genotype The present invention designs multiple pairs of probe primer combinations for each HPV type. These combinations have good effects on single type detection. However, the final reaction system of the present invention is that all probe primers of 15 types plus the internal reference ACT are all subjected to PCR reaction in the same tube. Unpredictable non-specific reactions may occur between the numerous probe primers, which requires different probe primers to be debugged and screened to find a 13+2 combination that meets the requirements. The probe primer combination that meets the requirements needs to meet 2 points: first, all 15 types can be detected normally and the signal intensity is good; second, the template-free control (NTC) must have no non-specific amplification signal. This embodiment screens out three sets of compositions for detecting HPV genotypes. The three sets of compositions are detailed in Table 6, and the specific sequence of each probe or primer is shown in Table 1.

[0068] Table 6. Three sets of compositions Type Combination 1 Combination 2 Combination 3 Type Combination 1 Combination 2 Combination 3 16 HPV16-P1 HPV16-P2 HPV16-P1 52 HPV52-P2 HPV52-P1 HPV52-P2 16 HPV16-F2 HPV16-F3 HPV16-F3 52 HPV52-F4 HPV52-F1 HPV52-F4 16 HPV16-R3 HPV16-R3 HPV16-R3 52 HPV52-R2 HPV52-R1 HPV52-R1 18 HPV18-P1 HPV18-P3 HPV18-P2 53 HPV53-P1 HPV53-P1 HPV53-P2 18 HPV18-F1 HPV18-F1 HPV18-F2 53 HPV53-F1 HPV53-F1 HPV53-F2 18 HPV18-R1 HPV18-R1 HPV18-R2 53 HPV53-R1 HPV53-R1 HPV53-R2 31 HPV31-P1 HPV31-P1 HPV31-P1 56 HPV56-P1 HPV56-P1 HPV56-P1 31 HPV31-F1 HPV31-F2 HPV31-F2 56 HPV56-F1 HPV56-F2 HPV56-F1 31 HPV31-R1 HPV31-R1 HPV31-R2 56 HPV56-R1 HPV56-R2 HPV56-R1 33 HPV33-P1 HPV33-P1 HPV33-P1 58 HPV58-P1 HPV58-P1 HPV58-P2 33 HPV33-F1 HPV33-F2 HPV33-F1 58 HPV58-F1 HPV58-F1 HPV58-F2 33 HPV33-R1 HPV33-R2 HPV33-R2 58 HPV58-R1 HPV58-R1 HPV58-R2 35 HPV35-P1 HPV35-P1 HPV35-P1 59 HPV59-P2 HPV59-P2 HPV59-P1 35 HPV35-F1 HPV35-F1 HPV35-F2 59 HPV59-F1 HPV59-F2 HPV59-F1 35 HPV35-R1 HPV35-R1 HPV35-R1 59 HPV59-R1 HPV59-R2 HPV59-R1 39 HPV39-P3 HPV39-P2 HPV39-P3 66 HPV66-P1 HPV66-P1 HPV66-P1 39 HPV39-F3 HPV39-F3 HPV39-F1 66 HPV66-F1 HPV66-F1 HPV66-F1 39 HPV39-R1 HPV39-R1 HPV39-R1 66 HPV66-R1 HPV66-R1 HPV66-R1 45 HPV45-P3 HPV45-P3 HPV45-P3 68 HPV68-P3 HPV68-P3 HPV68-P1 45 HPV45-F2 HPV45-F2 HPV45-F1 68 HPV68-F1 HPV68-F2 HPV68-F1 45 HPV45-R1 HPV45-R1 HPV45-R2 68 HPV68-R1 HPV68-R2 HPV68-R3 51 HPV51-P1 HPV51-P1 HPV51-P2 51 HPV51-F1 HPV51-F1 HPV51-F2 51 HPV51-R1 HPV51-R1 HPV51-R1 Among them, in each group of compositions, the fluorescence reporter group of the HPV 16 probe is VIC, the fluorescence reporter group of the HPV 18 probe is ROX, the fluorescence reporter groups of the other HPV probes are FAM, and the fluorescence reporter group of the internal reference ACTB probe is Cy5; the fluorescence quenching groups of the HPV 16 and HPV 52 probes are BHQ1, the fluorescence quenching group of the HPV 18 probe is BHQ2, the fluorescence quenching groups of the other HPV probes are MGB, and the fluorescence quenching group of the internal reference ACTB probe is BHQ3. Each group of compositions also includes an internal reference ACTB probe as shown in SEQ ID NO. 101, an internal reference ACTB upstream primer as shown in SEQ ID NO. 102, and an internal reference ACTB downstream primer as shown in SEQ ID NO. 103.

[0069] The above three combinations were used to perform amplification of all types in the same tube (2 parallel reactions for each type) and template-free amplification (8 parallel reactions). The results of amplification of all types and template-free amplification of combination 1 are shown in Figure 1 and Figure 2 The results of all types of combination 2 amplification and template-free amplification are shown in Figure 3 and Figure 4 The results of all types of combination 3 amplification and template-free amplification are shown in Figure 5 and Figure 6 According to the results, combinations 1 / 2 / 3 can detect 15 types normally with good signal intensity, and the no-template control (NTC) has no non-specific amplification signal, so it meets the requirements of the probe primer combination.

[0070] Example 3: HPV standard detection limit LOD test The present invention requires that all 15 types of 13+2 be detected normally by multiplex PCR in the same tube reaction, which requires studying the detection sensitivity of different combinations for each of the 15 types to ensure that in real clinical testing, none of the 15 types will be missed. Example 2 screened out probe primer combinations 1 to 3 that can meet multiplex PCR. Although each combination can detect all 15 types of HPV, a large number of probe primers inevitably interfere with each other, resulting in a decrease in detection sensitivity. In order to solve this problem, Example 3 also tested the lower limit of detection (LOD) of the three combinations screened in Example 2, and studied the LOD of 15 HPV types in each combination.

[0071] The standards of 15 HPV types (HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68) were diluted in a gradient to prepare low-concentration HPV standards. The concentrations were 2.5 copies / μL, 5 copies / μL, 7.5 copies / μL, 10 copies / μL, 12.5 copies / μL, 15 copies / μL, 17.5 copies / μL, 20 copies / μL, 22.5 copies / μL, and 25 copies / μL, respectively. 4 μL of template was added to each reaction, and the total number of copies in each reaction was: 10, 20, 30, 40, 50, 60, 70, 80, 90, and 100. The three sets of compositions provided in Example 2 were used to perform fluorescent quantitative PCR on the prepared low-concentration HPV standards. The PCR reaction system is shown in Table 7, and the PCR reaction program is shown in Table 8. Among them, since the probes HPV33-P1, HPV35-P1, HPV58-P1 are the same as HPV31-P1, HPV56-P1, HPV66-P1 are the same as HPV45-P3, and HPV68-P3, HPV59-P2 are the same as HPV39-P3, only 9 different probes need to be added.

[0072] Table 7. PCR reaction system Components Dosage For each 100 μM probe, add 0.05 μL Subtotal 0.45 μL For each 100 μM primer, add 0.1 μL Subtotal 3.2 μL PCRMIX 12.5 μL <![CDATA[ddH2O]]> 4.85 μL DNA solution 4 μL total 25 μL Table 8. PCR reaction program Temperature, time cycle 95℃, 5 min / (94℃, 20 s), (63℃, 60 s) 5 cycles, each cycle lowers 1℃ (94℃, 20 s), (58℃, 60 s) 40 cycles Ten parallel tests were performed for each type, and the CV value was calculated. CV < 5% was used as the qualification standard. The minimum number of template copies when CV < 5% for each type was the LOD value of the type. The LOD of each type in each set of compositions was recorded. The results are shown in Table 9.

[0073] Table 9. HPV standard detection limit LOD test Type The first group (copy) The second group (copy) Group 3 (Copy) Type The first group (copy) The second group (copy) Group 3 (Copy) 16 30 30 60 52 30 60 80 18 10 20 40 53 30 40 20 31 30 80 30 56 30 30 60 33 20 50 20 58 20 80 30 35 20 20 30 59 10 20 10 39 20 70 20 66 10 30 40 45 20 50 30 68 20 50 40 51 20 60 30 According to the LOD results of the three combinations, the first combination had the lowest LOD for most types, and a few types (such as HPV53) had lower LOD than other combinations. Combination 1 was selected as the preferred primer / probe combination of the present invention after comprehensive comparison.

[0074] Example 4: Testing urine simulated clinical samples A total of 3000 ml of female urine was collected, with 40 ml of urine per sample, for a total of 15 samples. 80,000 copies of 15 HPV types (HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68) were added to each urine sample, and the optimized extraction scheme provided in Example 1 of the present invention was used to extract the DNA to be tested from the urine sample. The obtained DNA solution was subjected to fluorescent quantitative PCR using Combination 1 provided in Example 3. The PCR reaction system is shown in Table 7, and the PCR reaction procedure is shown in Table 8. The results are shown in Figure 7 It can be seen that the urine DNA extraction scheme provided by the present invention, combined with the primer / probe combination 1 provided by the present invention, can accurately and effectively detect a total of 15 HPV types including HPV53 in urine with low HPV content.

[0075] Example 5: HPV detection limit LOD test in urine According to existing research results and literature reports, the biggest drawback of urine sample detection of HPV is that the viral load is too low. Compared with traditional cervical swabs, the viral load may be only one-tenth or even one-hundredth of that, which is the fundamental reason for the low sensitivity of urine sample detection of HPV. To solve this problem, it is necessary to optimize and improve from two aspects: on the one hand, develop better urine extraction technology to ensure that more nucleic acids are extracted from urine; on the other hand, improve the detection sensitivity of HPV test kit PCR to ensure that HPV infection can be detected even with a lower HPV viral load. The present invention optimizes urine extraction and PCR sensitivity respectively. Example 1 develops an extraction method that can extract 40 mL of urine, and Example 3 optimizes and screens a set of highly sensitive probe primer combinations.

[0076] The extraction method of Example 1 of the present invention and the probe primer combination 1 screened in Example 3 were used to study the lower limit of HPV detection in urine samples by this kit. 15 types of HPV standards with different concentration gradients were added to 40 mL of urine, and the addition amount of HPV standards was 100 copies-1600 copies. The concentration range after dilution to urine was: 2.5 copies / mL-40 copies / mL. The optimized extraction method in Example 1 of the present invention was used, and the urine was treated according to the method for extracting the DNA to be tested from the urine sample provided in Example 1, and the preferred combination 1 of Example 3 was used to perform fluorescent quantitative PCR on the DNA solution in the obtained urine. The PCR reaction system is shown in Table 7, and the PCR reaction procedure is shown in Table 8. 10 parallel PCRs were performed for each concentration, and the CV value was calculated. CV<5% was used as the qualified standard. The lowest concentration when CV<5% for each type was the detection lower limit of the type in urine. The results are shown in Table 10.

[0077] Table 10. LOD test of HPV standard in urine Type Concentration (copies / mL) CT CV% 16 2.5 31.02 33.05 30.82 32.14 40 29.82 31.54 31.73 34.14 34.09 8.31 16 5 30.26 29.82 31.05 29.64 32.31 31.37 30.99 31.18 31.24 30.11 2.54 16 7.5 30.42 31.27 30.95 30.13 30.21 33.13 30.33 30.51 31.74 30.51 2.85 18 2.5 31.46 35.46 34.42 34.37 32.68 31.21 30.96 38.3 35.92 31.36 7 18 5 32.7 30.61 32.92 31.61 33.32 31.3 31.81 31.26 31.99 30.05 3.06 18 7.5 30.43 34.32 30.54 30.69 31.99 32.46 30.85 32.12 33.3 31.37 3.85 31 10 28.03 27.15 27.14 27.67 37.09 26.88 27.03 26.85 27.71 27.06 10.5 31 20 28.8 26.57 26.38 26.53 26.48 27.22 26.29 26.34 26.84 26.34 2.71 31 40 27.19 27.04 26.08 25.7 25.96 25.86 25.91 25.87 25.6 25.86 1.99 33 10 38.28 39.14 38.73 38.51 32.26 33.2 38.53 32.67 33.14 32.15 8.41 33 20 39.22 32.06 32.45 31.77 32.57 31.63 31.79 31.28 33.25 33.22 6.55 33 40 30.41 30.2 30.3 30.9 31.22 30.58 30.4 31.01 30.25 29.54 1.49 35 10 45 38.36 26.98 29.21 29.11 29.65 29.05 29.69 28.6 28.26 17.22 35 20 28.3 45 45 28.51 28.61 29.09 28.65 28.36 28.63 28.46 20.63 35 40 27.31 26.87 26.47 26.35 26.84 26.62 26.81 26.59 27.23 26.76 1.08 39 7.5 31.49 31.54 30.32 29.71 29.25 30.02 40 29.64 28.74 29.7 10 39 10 33.97 29.53 30.37 28.99 29.74 29.25 28.81 29.3 29.3 29 4.84 39 15 30.19 31.05 29.94 29.17 30.06 30.12 29.08 28.38 29.45 28.77 2.55 45 5 29.44 31.91 30.5 32.15 29.78 29.44 29.79 31.49 33.23 29.84 4.14 45 10 29.08 29.88 30.42 29.91 30.54 31.03 30.22 29.63 28.51 26.47 4.2 45 15 29.85 31.01 29.26 29.14 29.32 28.94 29.24 29.63 31.36 28.93 2.72 51 5 33.69 30.98 30.71 30.12 30.13 29.56 40 30.7 39.64 29.12 11.87 51 10 30.02 30.01 28.38 28.09 28.14 28.83 29.37 27.21 28.73 29.17 2.92 51 20 28.01 29.01 28.62 28.28 27.69 28.03 27.13 27.96 27.94 27.21 1.94 52 10 38.37 38.91 38.16 32.45 32.52 32.75 32.53 38.1 32.37 32.49 8.27 52 20 32.23 38.17 31 31.47 31.78 31.2 31.94 32.31 39.46 31.72 8.71 52 40 32.17 29.24 29.88 30.21 29.45 31.37 29.63 28.1 32.36 29.18 4.36 53 10 40 39.42 40 31.21 38.84 31.3 29.3 29.35 29.47 29.88 13.87 53 20 40 33.35 38.54 28.8 28.83 29.26 28.84 28.62 28.07 28.02 13.7 53 40 30.92 28.72 28.81 27.62 28.35 28.83 28.29 27.27 27.3 28.04 3.53 56 20 27.46 27.68 28.82 28.45 28.74 31.71 29.04 27.72 28.39 27.82 4.07 56 40 26.94 28.48 29.37 27.81 27.13 27.08 27.11 27.26 26.92 26.95 2.82 56 80 28.59 27.83 26.97 26.31 27.22 26.92 26.91 27.09 26.51 26.55 2.37 58 5 40 40 31.25 31.38 30.28 30.02 30.61 29.16 31 31.48 11.69 58 10 32.92 30.5 30.37 30.26 29.93 29.51 29.93 29.19 29.98 29.01 3.42 58 20 31.49 30.77 30.8 29.54 29.18 30.69 30.16 30.45 29.01 31.76 2.88 66 7.5 26.72 27.66 26.98 26.52 27.13 27.66 27.25 29.67 29.32 27.33 3.62 66 10 26.47 29.96 28.74 28.41 26.79 26.91 26.65 26.62 27.11 27.2 4 66 20 26.44 26.42 26.38 26.32 26.5 26.06 26.42 26.35 25.94 26.54 0.69 68 10 32.18 37.6 29.44 30.24 29.56 29.88 29.26 29.23 29.57 29.12 8.1 68 20 31.99 27.37 27.18 27.18 27.52 26.91 27.6 27.15 27.05 25.56 5.72 68 40 27.11 26.67 26.72 26.45 26.61 26.39 26.48 26.5 26.66 26.54 0.73 According to the above results, the urine extraction scheme and HPV13+2 detection system of the present invention have the following detection limits for HPV in urine: HPV16: 5 copies / mL; HPV18: 5 copies / mL; HPV31: 20 copies / mL; HPV33: 40 copies / mL; HPV35: 40 copies / mL; HPV39: 10 copies / mL; HPV45: 5 copies / mL; HPV51: 10 copies / mL; HPV52: 40 copies / mL; HPV53: 40 copies / mL; HPV56: 20 copies / mL; HPV58: 10 copies / mL; HPV59: 10 copies / mL; HPV66: 7.5 copies / mL; HPV68: 10 copies / mL.

[0078] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope of the present invention.

Claims

1. A composition for detecting and / or identifying HPV genotypes, characterized in that: The composition comprises: An HPV 16 type probe having a base sequence as shown in any one of SEQ ID NOs. 1 to 2, an HPV 16 type upstream primer as shown in any one of SEQ ID NOs. 3 to 5, and an HPV 16 type downstream primer as shown in any one of SEQ ID NOs. 6 to 8; An HPV 18 type probe having a base sequence as shown in any one of SEQ ID NOs. 9 to 10, an HPV 18 type upstream primer as shown in any one of SEQ ID NOs. 11 to 12, and an HPV 18 type downstream primer as shown in any one of SEQ ID NOs. 13 to 14; An HPV 31 type probe having a base sequence as shown in any one of SEQ ID NOs. 15 to 16, an HPV 31 type upstream primer as shown in any one of SEQ ID NOs. 17 to 18, and an HPV 31 type downstream primer as shown in any one of SEQ ID NOs. 19 to 20; An HPV 33 type probe having a base sequence as shown in any one of SEQ ID NOs. 21 to 22, an HPV 33 type upstream primer as shown in any one of SEQ ID NOs. 23 to 24, and an HPV 33 type downstream primer as shown in any one of SEQ ID NOs. 25 to 26; An HPV 35 type probe having a base sequence as shown in any one of SEQ ID NOs. 27 to 28, an HPV 35 type upstream primer as shown in any one of SEQ ID NOs. 29 to 30, and an HPV 35 type downstream primer as shown in any one of SEQ ID NOs. 31 to 32; An HPV 39 type probe having a base sequence as shown in any one of SEQ ID NOs. 33 to 35, an HPV 39 type upstream primer as shown in any one of SEQ ID NOs. 36 to 38, and an HPV 39 type downstream primer as shown in any one of SEQ ID NOs. 39 to 40; An HPV 45 type probe having a base sequence as shown in any one of SEQ ID NOs. 41 to 43, an HPV 45 type upstream primer as shown in any one of SEQ ID NOs. 44 to 47, and an HPV 45 type downstream primer as shown in any one of SEQ ID NOs. 48 to 50; An HPV 51 type probe having a base sequence as shown in any one of SEQ ID NOs. 51 to 52, an HPV 51 type upstream primer as shown in any one of SEQ ID NOs. 53 to 54, and an HPV 51 type downstream primer as shown in any one of SEQ ID NOs. 55 to 56; An HPV 52 type probe having a base sequence as shown in any one of SEQ ID NOs. 57 to 58, an HPV 52 type upstream primer as shown in any one of SEQ ID NOs. 59 to 62, and an HPV 52 type downstream primer as shown in any one of SEQ ID NOs. 63 to 65; An HPV 53 type probe having a base sequence as shown in any one of SEQ ID NOs. 66 to 67, an HPV 53 type upstream primer as shown in any one of SEQ ID NOs. 68 to 69, and an HPV 53 type downstream primer as shown in any one of SEQ ID NOs. 70 to 71; An HPV 56 type probe having a base sequence as shown in SEQ ID NO. 72, an HPV 56 type upstream primer as shown in SEQ ID NO. 73, and an HPV 56 type downstream primer as shown in SEQ ID NO. 74; An HPV 58 type probe having a base sequence as shown in any one of SEQ ID NOs. 75 to 76, an HPV 58 type upstream primer as shown in any one of SEQ ID NOs. 77 to 78, and an HPV 58 type downstream primer as shown in any one of SEQ ID NOs. 79 to 80; An HPV 59 type probe having a base sequence as shown in any one of SEQ ID NOs. 81 to 83, an HPV 59 type upstream primer as shown in any one of SEQ ID NOs. 84 to 85, and an HPV 59 type downstream primer as shown in any one of SEQ ID NOs. 86 to 87; An HPV 66 type probe having a base sequence as shown in SEQ ID NO. 88, an HPV 66 type upstream primer as shown in SEQ ID NO. 89, and an HPV 66 type downstream primer as shown in SEQ ID NO. 90; The base sequence is an HPV 68 type probe as shown in any one of SEQ ID NOs. 91 to 94, an HPV 68 type upstream primer as shown in any one of SEQ ID NOs. 95 to 97, and an HPV 68 type downstream primer as shown in any one of SEQ ID NOs. 98 to 100.

2. The composition according to claim 1, characterized in that The composition is selected from any one of combination 1, combination 2, and combination 3; The combination 1 comprises: An HPV 16 type probe having a base sequence as shown in SEQ ID NO. 1, an HPV 16 type upstream primer as shown in SEQ ID NO. 4, and an HPV 16 type downstream primer as shown in SEQ ID NO. 8; The base sequence of the HPV 18 type probe is shown in SEQ ID NO. 9, the HPV 18 type upstream primer is shown in SEQ ID NO. 11, and the HPV 18 type downstream primer is shown in SEQ ID NO. 13; The base sequence of the HPV 31 type probe is shown in SEQ ID NO. 15, the HPV 31 type upstream primer is shown in SEQ ID NO. 17, and the HPV 31 type downstream primer is shown in SEQ ID NO. 19; An HPV 33 type probe having a base sequence as shown in SEQ ID NO. 21, an HPV 33 type upstream primer as shown in SEQ ID NO. 23, and an HPV 33 type downstream primer as shown in SEQ ID NO. 25; An HPV 35 type probe having a base sequence as shown in SEQ ID NO. 27, an HPV 35 type upstream primer as shown in SEQ ID NO. 29, and an HPV 35 type downstream primer as shown in SEQ ID NO. 31; An HPV 39 type probe having a base sequence as shown in SEQ ID NO. 35, an HPV 39 type upstream primer as shown in SEQ ID NO. 38, and an HPV 39 type downstream primer as shown in SEQ ID NO. 39; An HPV 45 type probe having a base sequence as shown in SEQ ID NO. 43, an HPV 45 type upstream primer as shown in SEQ ID NO. 45, and an HPV 45 type downstream primer as shown in SEQ ID NO. 48; An HPV 51 type probe having a base sequence as shown in SEQ ID NO. 51, an HPV 51 type upstream primer as shown in SEQ ID NO. 53, and an HPV 51 type downstream primer as shown in SEQ ID NO. 55; An HPV 52 type probe having a base sequence as shown in SEQ ID NO. 58, an HPV 52 type upstream primer as shown in SEQ ID NO. 62, and an HPV 52 type downstream primer as shown in SEQ ID NO. 64; An HPV 53 type probe having a base sequence as shown in SEQ ID NO. 66, an HPV 53 type upstream primer as shown in SEQ ID NO. 68, and an HPV 53 type downstream primer as shown in SEQ ID NO. 70; An HPV 56 type probe having a base sequence as shown in SEQ ID NO. 72, an HPV 56 type upstream primer as shown in SEQ ID NO. 73, and an HPV 56 type downstream primer as shown in SEQ ID NO. 74; An HPV 58 type probe having a base sequence as shown in SEQ ID NO. 75, an HPV 58 type upstream primer as shown in SEQ ID NO. 77, and an HPV 58 type downstream primer as shown in SEQ ID NO. 79; An HPV 59 type probe having a base sequence as shown in SEQ ID NO. 82, an HPV 59 type upstream primer as shown in SEQ ID NO. 84, and an HPV 59 type downstream primer as shown in SEQ ID NO. 86; An HPV 66 type probe having a base sequence as shown in SEQ ID NO. 88, an HPV 66 type upstream primer as shown in SEQ ID NO. 89, and an HPV 66 type downstream primer as shown in SEQ ID NO. 90; The base sequence of the HPV 68 type probe is shown in SEQ ID NO. 93, the HPV 68 type upstream primer is shown in SEQ ID NO. 95, and the HPV 68 type downstream primer is shown in SEQ ID NO. 98; The combination 2 comprises: The base sequence of the HPV 16 type probe is shown in SEQ ID NO. 2, the HPV 16 type upstream primer is shown in SEQ ID NO. 5, and the HPV 16 type downstream primer is shown in SEQ ID NO. 8; The base sequence of the HPV 18 type probe is shown in SEQ ID NO. 9, the HPV 18 type upstream primer is shown in SEQ ID NO. 11, and the HPV 18 type downstream primer is shown in SEQ ID NO. 13; The base sequence of the HPV 31 type probe is shown in SEQ ID NO. 15, the HPV 31 type upstream primer is shown in SEQ ID NO. 18, and the HPV 31 type downstream primer is shown in SEQ ID NO. 19; An HPV 33 type probe having a base sequence as shown in SEQ ID NO. 21, an HPV 33 type upstream primer as shown in SEQ ID NO. 24, and an HPV 33 type downstream primer as shown in SEQ ID NO. 26; An HPV 35 type probe having a base sequence as shown in SEQ ID NO. 27, an HPV 35 type upstream primer as shown in SEQ ID NO. 29, and an HPV 35 type downstream primer as shown in SEQ ID NO. 31; An HPV 39 type probe having a base sequence as shown in SEQ ID NO. 34, an HPV 39 type upstream primer as shown in SEQ ID NO. 38, and an HPV 39 type downstream primer as shown in SEQ ID NO. 39; An HPV 45 type probe having a base sequence as shown in SEQ ID NO. 43, an HPV 45 type upstream primer as shown in SEQ ID NO. 45, and an HPV 45 type downstream primer as shown in SEQ ID NO. 48; An HPV 51 type probe having a base sequence as shown in SEQ ID NO. 51, an HPV 51 type upstream primer as shown in SEQ ID NO. 53, and an HPV 51 type downstream primer as shown in SEQ ID NO. 55; An HPV 52 type probe having a base sequence as shown in SEQ ID NO. 57, an HPV 52 type upstream primer as shown in SEQ ID NO. 59, and an HPV 52 type downstream primer as shown in SEQ ID NO. 63; An HPV 53 type probe having a base sequence as shown in SEQ ID NO. 66, an HPV 53 type upstream primer as shown in SEQ ID NO. 68, and an HPV 53 type downstream primer as shown in SEQ ID NO. 70; An HPV 56 type probe having a base sequence as shown in SEQ ID NO. 72, an HPV 56 type upstream primer as shown in SEQ ID NO. 73, and an HPV 56 type downstream primer as shown in SEQ ID NO. 74; An HPV 58 type probe having a base sequence as shown in SEQ ID NO. 75, an HPV 58 type upstream primer as shown in SEQ ID NO. 77, and an HPV 58 type downstream primer as shown in SEQ ID NO. 79; An HPV 59 type probe having a base sequence as shown in SEQ ID NO. 82, an HPV 59 type upstream primer as shown in SEQ ID NO. 85, and an HPV 59 type downstream primer as shown in SEQ ID NO. 87; An HPV 66 type probe having a base sequence as shown in SEQ ID NO. 88, an HPV 66 type upstream primer as shown in SEQ ID NO. 89, and an HPV 66 type downstream primer as shown in SEQ ID NO. 90; The base sequence of the HPV 68 type probe is shown in SEQ ID NO. 93, the HPV 68 type upstream primer is shown in SEQ ID NO. 96, and the HPV 68 type downstream primer is shown in SEQ ID NO. 99; The combination 3 comprises: An HPV 16 type probe having a base sequence as shown in SEQ ID NO. 1, an HPV 16 type upstream primer as shown in SEQ ID NO. 5, and an HPV 16 type downstream primer as shown in SEQ ID NO. 8; An HPV 18 type probe having a base sequence as shown in SEQ ID NO. 10, an HPV 18 type upstream primer as shown in SEQ ID NO. 12, and an HPV 18 type downstream primer as shown in SEQ ID NO. 14; The base sequence of the HPV 31 type probe is shown in SEQ ID NO. 15, the HPV 31 type upstream primer is shown in SEQ ID NO. 18, and the HPV 31 type downstream primer is shown in SEQ ID NO. 20; An HPV 33 type probe having a base sequence as shown in SEQ ID NO. 21, an HPV 33 type upstream primer as shown in SEQ ID NO. 23, and an HPV 33 type downstream primer as shown in SEQ ID NO. 26; An HPV 35 type probe having a base sequence as shown in SEQ ID NO. 27, an HPV 35 type upstream primer as shown in SEQ ID NO. 27, and an HPV 35 type downstream primer as shown in SEQ ID NO. 31; An HPV 39 type probe having a base sequence as shown in SEQ ID NO. 35, an HPV 39 type upstream primer as shown in SEQ ID NO. 36, and an HPV 39 type downstream primer as shown in SEQ ID NO. 39; An HPV 45 type probe having a base sequence as shown in SEQ ID NO. 43, an HPV 45 type upstream primer as shown in SEQ ID NO. 44, and an HPV 45 type downstream primer as shown in SEQ ID NO. 49; An HPV 51 type probe having a base sequence as shown in SEQ ID NO. 52, an HPV 51 type upstream primer as shown in SEQ ID NO. 54, and an HPV 51 type downstream primer as shown in SEQ ID NO. 55; An HPV 52 type probe having a base sequence as shown in SEQ ID NO. 58, an HPV 52 type upstream primer as shown in SEQ ID NO. 62, and an HPV 52 type downstream primer as shown in SEQ ID NO. 63; An HPV 53 type probe having a base sequence as shown in SEQ ID NO. 67, an HPV 53 type upstream primer as shown in SEQ ID NO. 69, and an HPV 53 type downstream primer as shown in SEQ ID NO. 71; An HPV 56 type probe having a base sequence as shown in SEQ ID NO. 72, an HPV 56 type upstream primer as shown in SEQ ID NO. 73, and an HPV 56 type downstream primer as shown in SEQ ID NO. 74; An HPV 58 type probe having a base sequence as shown in SEQ ID NO. 76, an HPV 58 type upstream primer as shown in SEQ ID NO. 78, and an HPV 58 type downstream primer as shown in SEQ ID NO. 80; An HPV 59 type probe having a base sequence as shown in SEQ ID NO. 81, an HPV 59 type upstream primer as shown in SEQ ID NO. 84, and an HPV 59 type downstream primer as shown in SEQ ID NO. 86; An HPV 66 type probe having a base sequence as shown in SEQ ID NO. 88, an HPV 66 type upstream primer as shown in SEQ ID NO. 89, and an HPV 66 type downstream primer as shown in SEQ ID NO. 90; The base sequence is the HPV 68 type probe shown in SEQ ID NO. 91, the HPV 68 type upstream primer shown in SEQ ID NO. 95, and the HPV 68 type downstream primer shown in SEQ ID NO.

100.

3. The composition according to claim 1, characterized in that The composition further comprises: The base sequence is an internal reference ACTB probe as shown in SEQ ID NO. 101, an internal reference ACTB upstream primer as shown in SEQ ID NO. 102, and an internal reference ACTB downstream primer as shown in SEQ ID NO. 103; Among them, the fluorescent reporter group of the internal reference ACTB probe is different from that of the HPV probe.

4. The composition according to any one of claims 1 to 3, characterized in that The two ends of the base sequence of the probe are connected to a fluorescent reporter group and a fluorescent quencher group respectively; wherein the fluorescent reporter groups of the HPV 16 probe and the HPV 18 probe are different, and the fluorescent reporter groups of the HPV 16 probe and the HPV 18 probe are also different from those of the other HPV probes; The fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, ROX, TAMRA, Cy3, Cy3.5, Cy5, Cy5.5, OregonGreenTM, CALRedTM, Red640, Texas Red, LighterCycler ® Cyan500, LighterCycler ® , Red610, biotin-binding materials, Alexa 647, Alexa 555, 5-(2-aminoethyl)amino-1-naphthalenesulfonic acid, tetramethylrhodamine, tetramethylrhodamine isocyanate, fluorescein isocyanate, χ-rhodamine; The fluorescence quenching group is selected from DDQ-I, DDQ-II, Dabcyl, Eclipse, Iowa Black FQ, Iowa BlackRQ, BHQ1, BHQ2, BHQ3, QSY7, QSY9, and QSY21.

5. The composition according to claim 3, characterized in that The fluorescent reporter group of the HPV 16 probe is VIC, the fluorescent reporter group of the HPV 18 probe is ROX, the fluorescent reporter groups of the other HPV probes are FAM, and the fluorescent reporter group of the internal reference ACTB probe is Cy5; And / or, the fluorescence quenching group of the HPV 16 and HPV 52 probes is BHQ1, the fluorescence quenching group of the HPV 18 probe is BHQ2, the fluorescence quenching group of the remaining HPV probes is MGB, and the fluorescence quenching group of the internal reference ACTB probe is BHQ3.

6. Use of the composition according to any one of claims 1 to 5 in the preparation of a kit for detecting and / or identifying HPV genotypes.

7. A kit for detecting and / or identifying HPV genotypes, characterized in that: The kit comprises the composition according to any one of claims 1 to 5.

8. The kit according to claim 7, characterized in that The kit also includes reagents for isolating DNA from a urine sample; The urine sample is selected from a whole urine sample or a urine supernatant sample; The reagent includes at least one of a lysate, a urine cell digestion solution, and a proteinase K; The lysis buffer includes: 2-5 M guanidine isothioate, 10-100 mM EDTA, 10-100 mM Tris, 1%-12% Triton, and 0.5%-2% SDS; The urine cell digestion solution includes: 100-150 mM EDTA, 3%-8% Triton, pH 5.5-6; The concentration of the proteinase K is 20-50 mg / mL.

9. A method for detecting and / or identifying HPV genotypes in vitro for non-diagnostic purposes, characterized in that: The method comprises the following steps: Step 1: Extract DNA from the sample to be tested; Step 2: using the composition according to any one of claims 1 to 5 or the kit according to any one of claims 7 to 8 to perform fluorescent quantitative PCR on the DNA obtained in step 1; Step 3: Obtain and analyze the results; The sample is selected from cervical smear, fresh tissue sample, fixed tissue sample, tissue sample section sample, urine sample, sample containing exfoliated cells, peripheral blood sample, penis swab, or other body fluids.

10. The method according to claim 9, characterized in that The sample is a urine sample; The urine sample is selected from a whole urine sample or a urine supernatant sample; The step one comprises: Purification beads were added to the urine sample, vortexed, centrifuged, and the cell pellet was collected; After the cell pellet was mixed with urine cell digestion solution, 20-50 mg / mL proteinase K was added and incubated at 55°C for 0.5-1 h, vortexed, and incubated; After adding lysis solution and ethanol to the incubation system, the adsorption column is passed through, and the adsorption column after the addition of the sample is washed 3 to 4 times with a washing solution and centrifuged, and the washed adsorption column is eluted with water, and the solution containing DNA is collected after centrifugation; The lysis solution includes: 2-5 M guanidine isothioate, 10-100 mM EDTA, 10-100 mM Tris, 1%-12% Triton, and 0.5%-2% SDS; The urine cell digestion solution includes: 100-150 mM EDTA, 3%-8% Triton, pH 5.5-6; The concentration of the proteinase K is 20-50 mg / mL.

Images