Application of KLHL14 protein in preparation of reagent for assisting and / or early diagnosis of endometrial cancer

Abstract

The invention discloses an application of a KLHL14 protein in preparation of a reagent for assisting and / or early diagnosis of endometrial cancer, and is characterized in that up-regulation of KLHL14 expression can promote tumor formation in a mouse body, the amino acid sequence of the KLHL14 protein is shown as SQINO: 1, qRT-PCR quantitative amplification of a gene encoded by the KLHL14 protein comprises a KLHL14 forward amplification primer and a KLHL14 reverse amplification primer, and the KLHL14 forward amplification primer and the KLHL14 reverse amplification primer are used for quantitative detection of the gene encoded by the KLHL14 protein. Nucleotide sequences of the KLHL14 protein are respectively shown as SQI NO: 2 and SQI NO: 3, and the KLHL14 protein has the advantages that the KLHL14 protein is high in sensitivity and specificity, is positively correlated with the morbidity rate of the endometrial cancer and is beneficial to early diagnosis and treatment of the endometrial cancer, and the KLHL14 has the potential of becoming a novel biomarker and an effective treatment target in the endometrial cancer.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to an application of KLHL14 protein in preparing an agent for assisting and / or early diagnosis of endometrial cancer. Background Art

[0002] Endometrial cancer (EC) is a group of epithelial malignancies that occur in the endometrium. It is common in perimenopausal and postmenopausal women. Common clinical symptoms include vaginal bleeding, vaginal discharge, paroxysmal lower abdominal pain, abdominal mass, anemia, and fever. Endometrial cancer is the sixth most common cancer in women worldwide. The global incidence rate is on the rise, while the age of onset is on the decline. Although the diagnosis rate has increased in all age groups, the number of cases in women under 40 has doubled.

[0003] At present, the main treatments for endometrial cancer are surgery or radiotherapy, and the choice of treatment strategy depends on the clinical evaluation and analysis of the patient. In addition, the KRAS gene (Kirsten Rat Sarcoma Viral Oncogene Homolog) plays an important role in predicting the transition from proliferative endometrium to early well-differentiated endometrial cancer and the further invasive proliferation of tumors to advanced disease. Current evidence shows that KRAS gene mutations are associated with increased cell proliferation and apoptosis and upregulation of estrogen receptors in endometrial cells. Therefore, endocrine therapy also plays an important role in the efficacy of endometrial cancer. These treatments are effective in improving the survival rate of patients with endometrial cancer, but for patients with stage III and IV endometrial adenocarcinoma, traditional surgical treatment and adjuvant chemoradiotherapy cannot improve the survival rate of patients, but instead lead to poor prognosis. With the development of precision medicine, targeted therapy based on the characteristics of the patient's genetic spectrum has gradually become a research hotspot, and precision medicine has also become a new therapy with guiding significance and broad application prospects for the treatment of endometrial cancer. Therefore, it is necessary to find new targets for the treatment of endometrial cancer.

[0004] Kelch-like protein 14 (KLHL14) is a protein containing 628 amino acids. Its main function is to regulate the axon extension of corticospinal neurons to promote the development of the cortex. At present, there are no published studies on the use of KLHL14 as a diagnostic marker in endometrial cancer. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide an application of KLHL14 protein which has high sensitivity and specificity and is positively correlated with the prevalence of endometrial cancer in the preparation of an agent for assisting and / or early diagnosis of endometrial cancer.

[0006] The technical solution adopted by the present invention to solve the above technical problems is: application of KLHL14 protein in the preparation of reagents for assisting and / or early diagnosis of endometrial cancer, and up-regulation of KLHL14 expression can promote tumor formation in C57BL / 6 mice.

[0007] Furthermore, the amino acid sequence of the KLHL14 protein is shown in SQI NO: 1. Specifically, it is as follows: MSRSG. The protein KLHL14 consists of 628 amino acids and has a protein size of about 71 kDa.

[0008] Further, the qRT-PCR quantitative amplification of the gene encoding the KLHL14 protein includes a KLHL14 forward amplification primer and a KLHL14 reverse amplification primer, the nucleotide sequence of the KLHL14 forward amplification primer is shown in SQI NO: 2: GCAGTTCCTCAACGACCAGA, and the nucleotide sequence of the KLHL14 reverse amplification primer is shown in SQI NO: 3: GTTTTCCACCTCCACAACGC.

[0009] Compared with the prior art, the advantages of the present invention are: the present invention discloses for the first time a protein KLHL14 that can be used to detect endometrial cancer-related protein and its application in the preparation of an early diagnosis reagent for endometrial cancer or an auxiliary diagnosis reagent for endometrial cancer, mainly through immunohistochemistry analysis, to compare the expression of KLHL14 protein in endometrial cancer patient samples and normal samples, and to assist in the early diagnosis of endometrial cancer, the development of targeted anti-tumor drugs, the prognosis evaluation, etc., and has the characteristics of high sensitivity, strong specificity, short cycle, etc., which is beneficial to the early diagnosis and treatment of endometrial cancer, and KLHL14 has the potential to become a new biomarker and an effective therapeutic target in endometrial cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 is the expression level of KLHL14 mRNA in endometrial cancer, where A is the difference in mRNA expression between the normal group and the tumor group, B is the difference in mRNA expression between the tumor and adjacent normal tissue pairs selected from the same patient, and C is the survival rate curve of endometrial cancer patients with low and high expression of KLHL14 mRNA within 0-20 years;

[0011] Figure 2 is the expression level of KLHL14 protein in endometrial cancer, where A is the difference in protein expression between the normal group and the tumor group, B is the difference in protein expression between the normal group and tumor groups of different clinical stages, and C is the difference in protein expression between the normal group and tumor groups of different grades;

[0012] Figure 3 To verify the expression of KLHL14 in human endometrial cancer tissues by immunohistochemistry, A is three representative images of KLHL14 immunohistochemical staining in 75 pairs of human endometrial cancer tissues, n=75, scale bar is 10 μm; B is a stacked bar graph of immunohistochemical staining results of 75 pairs of human endometrial cancer tissues and paired adjacent cancer tissues, n=75, ****P<0.0001;

[0013] Figure 4 After constructing stable cell lines, qRT-PCR (A) and protein immunoblotting (B) were used to verify the results of KLHL14 overexpression and knockdown stable lines;

[0014] Figure 5 The results of in vivo xenograft experiments and dynamic calculation and weighing of tumor volume, where A is the effect of KLHL14 expression level on tumor growth, B is the effect of KLHL14 expression level on tumor mass, and C is the effect of KLHL14 expression level on tumor volume; DETAILED DESCRIPTION

[0015] The present invention is further described in detail below with reference to the accompanying drawings.

[0016] 1. Experimental Methods

[0017] 1. Collection of endometrial cancer tissue specimens: The 75 pairs of human endometrial cancer tissue slides included in the study were derived from endometrial cancer diagnosed by Ningbo Clinical Pathology Diagnosis Center and Ningbo University Affiliated People's Hospital from January 1, 2019 to December 31, 2022. Among them, 43 pairs of human endometrial cancer tissue slides were derived from Ningbo Clinical Pathology Diagnosis Center, and 32 pairs of human endometrial cancer tissue slides were derived from Ningbo University Affiliated People's Hospital. All human tissue specimens involved in this experiment were applied for by the research team and approved by the Human Ethics Committee of Ningbo University School of Medicine, and were limited to laboratory research.

[0018] 2. Immunohistochemical staining, the steps are as follows:

[0019] a. Baking: Place the slide with tissue on a preheated 65°C baking machine for at least 2 hours, or place in a 37°C oven overnight;

[0020] b. Dewaxing and rehydration: Soak the slide rack full of slices in xylene for 20 minutes; soak in anhydrous ethanol solution for 5 minutes × 2 times; soak in 95% ethanol solution for 5 minutes × 1 time; soak in 75% ethanol solution for 5 minutes × 1 time; finally, wash the slide rack in deionized water for 5 minutes;

[0021] c. Antigen repair: Dilute 50× EDTA antigen repair solution with pH 9.0 with deionized water to 1× EDTA antigen repair solution and shake evenly. Pour the 1× EDTA antigen repair solution into the pressure cooker, close the lid, wait for the liquid in the pot to boil, place the slide rack with the slices in the pressure cooker, make sure the EDTA antigen repair solution completely immerses the slices, tighten the lid, and start timing after the pressure cooker valve starts to emit steam evenly. After 9 minutes, turn off the power of the induction cooker to end heating. Place the pressure cooker under running tap water to cool down, open the lid, and let the paraffin slices cool to room temperature;

[0022] d. Washing: First, wash the sections thoroughly with deionized water for 5 minutes, then wash the sections with PBST buffer for 3 minutes, and repeat the washing three times;

[0023] e. Block endogenous peroxidase: dilute 30% hydrogen peroxide aqueous solution with deionized water to 3% concentration, prepare freshly for use each time, place paraffin sections in a humidified chamber, drop appropriate amount of 3% hydrogen peroxide aqueous solution on the position of the tissue on the slide, close the lid of the humidified chamber, and block at 37°C for 10-20 minutes;

[0024] f. Washing: Wash the sections with PBST buffer for 3 min × 3 times, and shake off the liquid on the slide;

[0025] g. Serum blocking: Place the washed slices in a wet box, add an appropriate amount of 10% donkey serum blocking solution to each slice, block at room temperature for 15 minutes, and then discard the blocking solution on the slices;

[0026] h. Primary antibody incubation: wipe off the blocking solution around the tissue, draw a circle around the tissue with a hydrophobic pen for immunohistochemical staining, place the slice in a wet box, add appropriate concentration of KLHL14 antibody diluent to immerse the tissue, close the wet box lid, and place in a 4°C refrigerator overnight;

[0027] i. Washing: Wash the sections with PBST buffer for 3 min × 3 times;

[0028] j. Secondary antibody incubation: wipe off the liquid around the tissue, add appropriate concentration of HRP-labeled donkey secondary antibody to the tissue so that the antibody completely covers the tissue, close the wet box lid, and incubate at 37°C for 1 hour;

[0029] k. Washing: Wash the sections with PBST buffer for 3 min × 3 times;

[0030] 1. DAB color development: Add DAB color development solution to the position of the tissue on the slide, place the slide on an inverted microscope to observe the staining of the tissue, and when the staining intensity reaches the best, discard the color development solution and wash with deionized water for 3 minutes × 3 times;

[0031] m. Hematoxylin counterstaining: Add an appropriate amount of modified Lillie-Mayer hematoxylin staining solution to the location of the tissue on the slide, stain for 10 seconds, shake off the staining solution, and place the slide rack with the slide under running tap water to wash for 1 minute to return to blue;

[0032] n. Dehydration: Soak the slide rack with slices in 75% ethanol solution for 5 min × 1 time; soak in 95% ethanol solution for 5 min × 1 time; soak in anhydrous ethanol solution for 5 min × 3 times;

[0033] o. Transparency: Soak the slices in xylene solution for 5 min × 2 times;

[0034] p. Sealing: Add an appropriate amount of neutral gum to the position of the tissue on the slide, use tweezers to pick up a cover glass and gently cover the slide, and place it in a fume hood to dry into a slice;

[0035] q. Scoring: All samples were reviewed by two independent pathologists experienced in immunohistochemistry (IHC) scoring who were blinded to the clinical outcomes of the patients. We evaluated the percentage of positively stained cells and the staining intensity to semiquantitatively determine KLHL14 expression. The percentage of positively stained cells was scored as follows: 0, <10%; 1, 10%-50%; 2, >50%. The staining intensity was graded as follows: 0 (no or weak staining = light yellow), 1 (moderate staining = yellow-brown), and 2 (strong staining = brown). The total score for KLHL14 expression was the sum of the percentage of cells scored for positive staining and the staining intensity score, with a total score ranging from 0 to 4. For statistical analysis, the final score was a combination of the independent scores assigned by the two pathologists reported in this study. Any discrepancies in the scores were resolved by discussion between the two pathologists.

[0036] 3. qRT-PCR experiment, the steps are as follows:

[0037] (1) Take well-growing Ishikawa and HEC-1-A endometrial cancer cells transfected with sh-NC+EV (negative control), sh-NC+OE-KLHL14 (overexpression), and sh-KLHL14+EV (knockdown) plasmids 24 hours later, aspirate the culture medium, add 1 mL TRIGene (total RNA extraction reagent) to each well, pipette several times to ensure complete cell lysis, and then transfer to a centrifuge tube;

[0038] (2) The lysate was placed at room temperature for 5 min to completely separate the nucleic acid-protein complex;

[0039] (3) Add 0.2 mL of chloroform per 1 mL of TRIGene, cap the tube tightly, shake vigorously for 15 seconds, and leave at room temperature for 2-3 minutes;

[0040] (4) Centrifuge at 4°C and 12,000 × g for 15 min. The sample will separate into three layers: an orange lower organic phase, a middle layer, and a colorless upper aqueous phase.

[0041] (5) Pipette the upper aqueous phase containing total RNA into a new centrifuge tube. The volume of the aqueous phase should be 60% of the TRIGene reagent used.

[0042] (6) Add 0.5 mL of isopropanol per 1 mL of TRIGene initially used, invert several times to mix, and leave at room temperature for 10 min;

[0043] (7) Centrifuge at 4°C, 12,000 × g for 10 min, discard the supernatant, and a gelatinous RNA precipitate will be visible;

[0044] (8) Add 1 mL of 75% ethanol per 1 mL of TRIGene initially used, invert several times to mix, and wash the precipitate;

[0045] (9) Centrifuge at 12,000 × g for 5 min at 4°C and discard the supernatant;

[0046] (10) Invert at room temperature for 5-10 minutes to dry;

[0047] (11) Add 25 μL DEPC-treated water (DEPC-ddH 2 O), pipetting several times to dissolve RNA;

[0048] (12) Detect RNA concentration, purity, and integrity by RNA electrophoresis and UV spectrophotometer;

[0049] (13) The obtained RNA should be used immediately or stored at -80°C after appropriate aliquoting to avoid repeated freezing and thawing;

[0050] (14) Reverse transcription reaction system: Enzyme Mix 1 μL, 5× All-in-one qRT SuperMix 4 μL, total RNA 1 pg-1 μg, RNase-free ddH 2 O to a volume of 20 μL; reaction procedure: 50°C, 15 min; 85°C, 5 sec;

[0051] (15) qRT-PCR detection, the qRT-PCR quantitative amplification primers are as follows: the nucleotide sequence of the KLHL14 forward amplification primer is shown in SQI NO: 2: GCAGTTCCTCAACGACCAGA, the nucleotide sequence of the KLHL14 reverse amplification primer is shown in SQI NO: 3: GTTTTCCACCTCCACAACGC; the nucleotide sequence of the GAPDH forward amplification primer is shown in SQI NO: 4: CATGGCCTTCCGTGTTCCTA, the nucleotide sequence of the GAPDH reverse amplification primer is shown in SQI NO: 5: CCCTCAGATGCCTGCTTCA;

[0052] Prepare the following mixture in a qPCR tube: 2× Taq Pro Universal SYBR qPCR Master Mix 10.0 μl, KLHL14-RTF / GAPDH-RTF primer (10 μM) 0.4 μl, KLHL14-RTR / GAPDH-RTR primer (10 μM) 0.4 μl, template DNA / cDNA x μl, add ddHO 2 O to a total volume of 20.0 μL; the reaction steps are as follows: pre-denaturation at 95°C for 30 seconds; cycle reaction at 95°C for 3-10 seconds, 60°C for 10-30 seconds, 40 cycles; melting curve at 95°C for 15 seconds, 60°C for 60 seconds, and 95°C for 15 seconds.

[0053] 4. In vivo xenograft experiment, the steps are as follows:

[0054] 3-5 week old C57BL / 6 mice (mass 15-25 g) were used for in vivo xenograft experiments. After 24 hours of transfection with sh-NC+EV (negative control), sh-NC+OE-KLHL14 (overexpression), and sh-KLHL14+EV (knockdown) plasmids, well-grown endometrial cancer cells were taken to prepare stable cell lines, and then resuspended in 50 μ PBS and 50 μ Matrigel. Starting from the 4th day after surgery, the tumor volume was measured every 4 days, and the calculation formula was: tumor volume = (length × width 2 )×1 / 2. After the experiment, the mice were killed, and the tumors were arranged and weighed. There were 6 mice in each group, and the blind method was not used. All experimental operations followed the operating procedures approved by the Animal Care Committee of Ningbo University.

[0055] 5. The result analysis method is as follows:

[0056] This experiment comprehensively checked, proofread, and sorted the experimental data and the collected original clinical data to ensure that the data was as complete, accurate, and correct as possible. Then, Excel software was used to establish tissue and cell databases, grouped, and summarized the original clinical data involved and entered them into the table. Finally, SPSS26.0 statistical software was used to sort and analyze the final experimental data. All data statistical tests were bilaterally probabilistic and statistically tested at the test level of α=0.05. If P<0.05, the difference between the two groups was considered statistically significant, otherwise the difference was considered statistically insignificant. The drawing of experimental result graphs such as bar graphs and line graphs was completed using GraphPad Prism 9.0 and SPSS26.0 software.

[0057] 2. Experimental Results Analysis

[0058] To investigate the expression levels of KLHL14 mRNA and protein in endometrial cancer, we downloaded and analyzed the differential expression of KLHL14 in tumor and normal samples from the TCGA (The Cancer Genome Atlas) database and the CPTAC (Clinical Proteomic Tum or Analysis Consortium) database. Figure 1 The results of the TCGA database of Zhong A showed that the expression level of KLHL14 mRNA in tumor tissues was higher than that in normal tissues, and there was a significant difference between the two, indicating that KLHL14 mRNA was highly expressed in patients with endometrial cancer. Figure 1 As shown in Figure B, the expression level of KLHL14 mRNA in the cancer tissue of the same endometrial cancer patient is higher than that in the adjacent normal tissue. Figure 1 As shown in C, Kaplan-Meier survival analysis based on the TCGA database showed that the clinical prognostic value of KLHL14 expression in endometrial cancer was as follows: the five-year survival rate and ten-year survival rate of patients with high KLHL14 expression were significantly lower than those of patients with low KLHL14 expression, which can be effectively used for the clinical prognosis of patients with endometrial cancer.

[0059] like Figure 2 As shown in Figure A, data from the CPTAC database show that the expression level of KLHL14 protein in endometrial cancer tissue is higher than that in normal tissue, and there is a significant difference between the two. In addition, the correlation between KLHL14 protein level and clinical stage and grade was analyzed in the CPTAC database. The results are shown in Figure 2. Figure 2 As shown in Figure B, high expression of KLHL14 is closely related to the clinical stage of the patient. The expression of KLHL14 protein in patients with stage I, II and III endometrial cancer is higher than that in normal people. There is no statistical difference between the expression of KLHL14 protein in patients with stage IV endometrial cancer and normal people (related to the small sample size), indicating that the expression of KLHL14 protein in patients with early and middle stage endometrial cancer is higher than that in normal people. Figure 2 As shown in C, high expression of KLHL14 is closely related to the patient's grade. The expression of KLHL14 protein in patients with stage I and II endometrial cancer is higher than that in normal people. There is no statistical difference between the expression of KLHL14 protein in patients with stage III endometrial cancer and normal people (related to the small sample size), indicating that the expression of KLHL14 protein in patients with moderately and highly differentiated endometrial cancer is higher than that in normal people.

[0060] Figure 3 To verify the expression of KLHL14 in human endometrial cancer tissues by immunohistochemistry, we collected 75 pairs of human endometrial cancer tissue slides and used immunohistochemical staining to detect the expression level of KLHL14 in clinical samples. Figure 3As shown in A, KLHL14 staining is brownish yellow with different shades and is mainly located in the cytoplasm of endometrial cancer tissue and adjacent tissue. Compared with endometrial cancer tissue, KLHL14 is weakly expressed or not expressed in the corresponding adjacent tissue. Pathologists were asked to analyze the immunohistochemical staining images. The expression levels of KLHL14 in endometrial cancer tissue were concentrated in three levels: negative (Negative, 0 points), low expression (Low positive, 1-2 points), and high expression (High positive, 3-4 points). At the same time, Figure 3 As shown in Figure B, in endometrial cancer tissues, the positive expression rate of KLHL14 was 96.00% (72 / 75), while that in paracancerous tissues was only 70.67% (53 / 75). The expression level of KLHL14 in endometrial cancer tissues was significantly higher than that in the corresponding paracancerous tissues (P<0.0001).

[0061] Figure 4 To construct stable cell lines, qRT-PCR and protein immunoblotting were used to verify KLHL14 overexpression and knockdown stable lines. We set up a control group of sh-NC+EV, a high expression group of sh-NC+OE-KLHL14, and a low expression group of sh-KLHL14+EV, and used protein immunoblotting and RT-PCR techniques for further confirmation. Figure 4 A in the middle shows the verification of KLHL14 overexpression and knockdown stable strains by qRT-PCR in HEC-1-A and ishikawa. The comparison between the control group and the high expression group showed that the KLHL14 mRNA level of the transfected OE-KLHL14 plasmid was significantly increased, and the comparison between the control group and the low expression group showed that the KLHL14 mRNA level of the transfected sh-KLHL14 plasmid was significantly decreased. Figure 4 B shows the protein immunoblotting technique to verify the KLHL14 overexpression and knockdown stable strains in HEC-1-A and ishikawa. The control group and the high expression group showed that the expression level of KLHL14 protein transfected with OE-KLHL14 plasmid increased significantly, and the control group and the low expression group showed that the expression level of KLHL14 protein transfected with sh-KLHL14 plasmid decreased significantly. , where sh-NC: sh-negative control, EV: empty plasmid, OE-KLHL14: KLHL14 high expression, sh-KLHL14: KLHL14 knockout.

[0062] Figure 5 The results of in vivo mouse tumor formation experiment and in vivo xenograft experiment with dynamic calculation and weighing of tumor volume are shown. Figure 5 Figure A shows the effect of KLHL14 expression level on tumor growth. Six replicate groups were set up and the tumors were arranged. Figure 5 Figure B shows the effect of KLHL14 expression level on tumor mass. The negative control group and the high expression group showed that the mass of tumors transfected with OE-KLHL14 plasmid increased significantly, while the control group and the low expression group showed that the mass of tumors transfected with sh-KLHL14 plasmid decreased significantly. Figure 5 Middle C shows the effect of KLHL14 expression level on tumor volume. The negative control group and the high expression group showed that the growth rate of tumor volume of the tumor transfected with OE-KLHL14 plasmid increased, and the control group and the low expression group showed that the growth rate of tumor volume of the tumor transfected with sh-KLHL14 plasmid slowed down. **P<0.01, ***P<0.001, ****P<0.0001, sh-NC is sh-negative control, EV is empty plasmid, OE-KLHL14 is KLHL14 high expression, sh-KLHL14 is KLHL14 knockout. The above results suggest that the detection of KLHL14 protein expression has a high value for the diagnosis of endometrial cancer.

[0063] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by a person skilled in the art within the spirit and scope of the present invention shall also fall within the protection scope of the present invention.

Claims

1. Use of KLHL14 protein in the preparation of reagents for assisting and / or early diagnosis of endometrial cancer.

2. Use of the KLHL14 protein according to claim 1 in the preparation of an agent for assisting and / or early diagnosis of endometrial cancer, characterized in that: The amino acid sequence of the KLHL14 protein is shown in SQI NO:

1.

3. Use of the KLHL14 protein according to claim 2 in the preparation of an agent for assisting and / or early diagnosis of endometrial cancer, characterized in that: The qRT-PCR quantitative amplification of the gene encoding the KLHL14 protein includes a KLHL14 forward amplification primer and a KLHL14 reverse amplification primer. The nucleotide sequence of the KLHL14 forward amplification primer is shown in SQI NO: 2: GCAGTTCCTCAACGACCAGA, and the nucleotide sequence of the KLHL14 reverse amplification primer is shown in SQI NO: 3: GTTTTCCACCTCCACAACGC.

Images