Method for screening high-activity tryptophanase based on random forest and application

Abstract

The invention discloses a method for screening high-activity tryptophanase based on random forest and application, potential high-activity tryptophanase coding genes are efficiently obtained based on a random forest method, cells containing recombinant tryptophanase are obtained through heterologous expression, and the cells are applied to DL-tryptophan resolution to efficiently prepare high-purity D-tryptophan. The problems that an existing tryptophanase screening method is low in flux, high in cost, large in error, poor in accuracy, complex in process and the like are solved. According to the present invention, the screened Morgan morganella-derived tryptophan enzyme gene is subjected to heterologous expression, the obtained recombinant strain can efficiently express the tryptophan enzyme, the whole cell containing the recombinant tryptophan enzyme is used for the resolution of the DL-tryptophan, the hydrolysis rate of the L-tryptophan achieves 99.36%, and the ee value of the obtained product D-tryptophan achieves 99.23%.

Description

(I) Technical field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a method for screening high-activity tryptophanase based on random forest, and application of the screened tryptophanase in splitting DL-tryptophan to prepare high-purity D-tryptophan. (II) Background technology

[0002] Tryptophanase (TPase, EC 4.1.99.1), also known as tryptophan indole lyase, is a pyridoxal phosphate-dependent hydrolase that hydrolyzes L-tryptophan into indole, pyruvate and ammonia through an α-elimination mechanism. Its catalytic mechanism mainly includes the following steps: first, the lysine residue at the active site of the enzyme protein combines with the coenzyme pyridoxal phosphate to form an internal aldimine (I); in the presence of the substrate L-tryptophan, it is converted into an external aldimine (III) through a geminal diamine structure (II); a quinone intermediate (IV) is produced through an α-C deprotonation process; the side chain indole is lost under the synergistic effect of the protonation of the indole part and the cleavage of the CC bond to form an α-aminoacrylate intermediate (VI); the α-aminoacrylate intermediate is further attacked by the ε-amino group of the lysine residue bonded to the coenzyme, and pyruvate and ammonia are lost to form a holoenzyme. Based on this principle, tryptophanase has been successfully applied to the resolution of racemic DL-tryptophan and the biocatalytic preparation of D-tryptophan has been achieved. D-tryptophan is a non-protein active amino acid with unique physiological properties. It can be used as a non-nutritional sweetener, feed additive and plant growth agent, and is applied to food, feed industry and agricultural production. In the pharmaceutical industry, D-tryptophan is mainly used to synthesize polypeptides, which are used to prolong the half-life of peptide drugs and reduce drug side effects. At the same time, its derivative D-tryptophan methyl ester hydrochloride is also an important precursor for the production of tumor-lytic drugs. So far, the preparation methods of D-tryptophan include chemical method and bioenzymatic method. The chemical method has problems such as cumbersome steps, low yield and environmental pollution. In comparison, the bioenzymatic synthesis process is simple, specific, mild and environmentally friendly, and is more suitable for large-scale industrial production. However, the screening method of tryptophanase used in the bioenzymatic preparation technology has the disadvantages of low flux, high cost, large error, poor accuracy and complex process.

[0003] To date, the tryptophanases discovered are widely present in most Gram-negative bacteria, a few Gram-positive bacteria and fungi. Given the characteristics of microbial diversity and the randomness and limitations of traditional screening methods, the screening efficiency of new and efficient tryptophanase genes is low. In recent years, advances in computer technology have provided new possibilities for deep mining of microbial gene resources. Among them, random forest (RF) is an ensemble learning algorithm that is widely used in classification and regression tasks. It improves decision accuracy by constructing multiple decision trees and combining their prediction results. In the medical field, RF has been widely used in disease subtype prediction, biomarker discovery, drug target identification, gene function prediction, and gene expression data analysis.

[0004] The implementation of the random forest strategy requires the construction of a random forest model. The first step is to determine the number of trees in the forest (n_estimators). If the number of trees is too small, it is easy to underfit. If it is too large, the amount of calculation will increase exponentially. After the number of trees reaches the threshold, increasing the number of trees will not improve the model much. The second step is to perform self-service sampling on the data, and repeatedly randomly extract samples from the samples with replacement to train each tree, thereby increasing the diversity of the data and allowing each tree to learn data from different perspectives (the reason why random forests are called random forests is that randomness is added during construction. Self-service sampling of data and construction of decision trees based on new data sets are the embodiment of randomness). The third step is to construct a decision tree based on the new data set.

[0005] For the selection of highly active tryptophanase, not only the source of the sample should be considered, but also the number of amino acids and the selection of conserved regions. Selecting microbial samples from different sources will produce different results for the selection of RF sample sets and the selection of training sets and test sets. Therefore, how to quickly and low-cost screen highly active tryptophanase becomes a problem that needs to be solved. (III) Summary of the invention

[0006] The purpose of the present invention is to provide a method and application of screening high-activity tryptophanase based on random forest. The present invention efficiently obtains potential high-activity tryptophanase encoding genes based on the random forest method, obtains cells containing recombinant tryptophanase through heterologous expression, and applies them to DL-tryptophan splitting to efficiently prepare high-purity D-tryptophan, thereby solving the problems of low flux, high cost, large error, poor accuracy, complex process, etc. in the existing tryptophanase screening methods.

[0007] The technical solution adopted by the present invention is:

[0008] The present invention provides a method for screening high-activity tryptophanase based on random forest, the method comprising the following steps:

[0009] (1) Data preparation:

[0010] Search the amino acid sequences of tryptophanase from bacteria from NCBI and randomly select 100 tryptophanase amino acid sequences;

[0011] (2) Feature setting:

[0012] a. Protein size: The length of the candidate protein is >400 amino acids;

[0013] b. Two necessary conserved sequences of tryptophanase (i.e., only enzymes containing both sequences are possible tryptophanase): the first segment is KKD, where the second K is a necessary site for binding to the coenzyme (pyridoxal phosphate); the second segment is any one of the seven conserved regions TDS, TYT, TYE, RHXT, QTHXD, XRD, EXXR (X is any amino acid);

[0014] (3) Decision tree splitting:

[0015] Step (1) 100 tryptophanase amino acid sequences were randomly selected and simulated using the learning toolkit scikit-learn in pycharm. During the decision tree formation process, each node was split according to the characteristics of step (2) until it could not be split any further.

[0016] Parameter settings of the learning toolkit scikit-learn: the number of estimators (n_estimators) is set to 10, the splitting criterion (criterion) selects Gini impurity (gini), the maximum depth (max_depth) is set to None, the maximum number of features (max_features) is set to square root (sqrt), the random state (random_state) is set to None, the bootstrap (bootstrap) is set to True, and the number of jobs (n_job) is set to None;

[0017] (4) Align the amino acid sequence obtained in step (3) with the tryptophanase (ACE63255.1) derived from Escherichia coli K12 to select the amino acid sequence with the highest homology.

[0018] The present invention provides a tryptophanase screened by the method, wherein the amino acid sequence of the tryptophanase is shown in SEQ ID NO. 1. The nucleotide sequence of the edited gene is shown in SEQ ID NO. 2.

[0019] The present invention also provides an application of the tryptophanase screened by the method in splitting DL-tryptophan. The application method is: using wet bacteria of recombinant genetic engineering bacteria expressing tryptophan after induction as a catalyst, using DL-tryptophan as a substrate, and using a pH 6-8 buffer as a reaction medium to form a conversion system, reacting at 30-50° C. and 100-300 rpm (preferably 200 rpm) to obtain a reaction solution containing D-tryptophan.

[0020] Furthermore, in the transformation system, the wet bacteria are added at a concentration of 1-21 g / L (preferably 16 g / L); and the substrate is added at a concentration of 1-10 g / L (preferably 4 g / L).

[0021] Furthermore, the transformation system uses pyridoxal phosphate as an auxiliary agent, and the amount of pyridoxal phosphate added is 1-10 mM (preferably 6 mM).

[0022] Furthermore, the reaction medium is preferably 0.12 M potassium phosphate buffer at pH 7.5.

[0023] Furthermore, the tryptophan recombinant genetic engineering bacteria are constructed as follows:

[0024] (1) Using the genome of Morganella CICC 22599 as a template, PCR cloned the TPase target gene fragment under the action of upstream and downstream primers;

[0025] Upstream:

[0026] 5'-CAGTGGTGGTGGTGGTGGTG CTCGAG TTACATGACAGGTTTCAGGCGGG-3'(XhoⅠ);

[0027] Downstream:

[0028] 5'-AGCAAATGGGTCGCGGATCC GAATTC ATGAAACGTATTCCAGAACCGTT CCG-3'(EcoRⅠ);

[0029] (2) The plasmid pET-28a(+) and the target gene fragment were digested with XhoⅠ and EcoRⅠ, respectively, and seamlessly cloned and connected using a kit to obtain the recombinant expression vector pET28a(+)-TPase;

[0030] (3) The recombinant expression vector pET28a(+)-TPase was heat-shock transformed into Escherichia coli DH5α competent cells, the plasmid was extracted, and transferred into Escherichia coli BL21 competent cells to construct Escherichia coli BL21-pET28a(+)-TPase.

[0031] Further, the wet bacterial cells were prepared as follows: a single colony of Escherichia coli BL21-pET28a(+)-TPase was selected and placed in an LB liquid medium containing 50 mg / L Kan resistance, and cultured overnight at 37°C and 200 rpm; the inoculation volume was transferred to a new LB liquid medium at a concentration of 1%, and cultured in a shaking incubator at 37°C and 200 rpm until the OD 600 The value was 0.6, and IPTG was added with a final concentration of 0.1 mM. The culture was shaken at 25°C and 200 rpm for 12 h. The induced bacterial solution was centrifuged at 8000 rpm and 4°C for 10 min to collect the wet bacteria.

[0032] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0033] (1) The present invention provides a new tryptophanase screening method for splitting DL-tryptophan, which improves the efficiency and accuracy of tryptophanase screening, provides a reference for the screening and preparation of other enzymes, and overcomes the problems of existing methods based on high-throughput fluorescence screening or high-throughput screening based on biosensors, such as high difficulty in experiments, expensive instruments, and long experimental cycles.

[0034] (2) The tryptophanase gene from Morganella morganii screened by the present invention was heterologously expressed, and the resulting recombinant strain was able to express tryptophanase more efficiently. Whole cells containing the recombinant tryptophanase were used to split DL-tryptophan, and the hydrolysis rate of L-tryptophan reached 99.36%, and the ee value of the obtained product D-tryptophan reached 99.23%. (IV) Description of the drawings

[0035] Figure 1 , Random Forest output results.

[0036] Figure 2 , tryptophanase amino acid sequence alignment result diagram; 1: Escherichia coli K12; 2: Morganella; 3: Photorhabdus; 4: Citrobacter cosei; 5: Dickie's bacillus; 6: Klebsiella; 7: Yersinia enterocolitica; 8: Enterobacter sakazakii; 9: Xenorhabdus burnetii; 10: Shewanella; 11: Achromobacter; 12: Aeromonas hydrophila; 13: Eilishella; 14: Limnocodia.

[0037] Figure 3 , Gel electrophoresis of tryptophanase PCR amplification products in Example 2; M: Marker; 1: tnaA.

[0038] Figure 4, Agarose gel electrophoresis diagram of the plasmid after double restriction digestion (XhoⅠ and EcoRI) during the construction of the recombinant engineering bacteria for heterologous expression of tryptophanase in Example 3; M: Marker; 1: DH5α-pET 28a(+)-TPase; 2: BL21-pET 28a(+)-TPase; 3: tnaA.

[0039] Figure 5 , Example 4 Tryptophanase protein SDS-PAGE result diagram; M: Marker; 1: supernatant; 2: precipitate; 3: pure enzyme TPase.

[0040] Figure 6 , Example 4 Tryptophanase protein Native-PAGE result diagram; M: Marker; 1: pure enzyme TPase.

[0041] Figure 7 , diagram of the catalytic mechanism of tryptophanase.

[0042] Figure 8 , Optimization of DL-tryptophanase conversion conditions in Example 5; 1: Effect of reaction time on TPase reaction; 2: Effect of bacterial concentration on TPase reaction; 3: Effect of reaction temperature on TPase reaction; 4: Effect of pyridoxal phosphate concentration on TPase reaction.

[0043] Fig. 9 , HPLC chart of the conversion liquid in step 5 in Example 5; 1: the conversion liquid under the optimal conditions of Example 5; 2: DL-tryptophan standard 4g / L; 3: L-tryptophan standard 2g / L; 4: D-tryptophan standard 2g / L. (V) Specific implementation methods

[0044] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0045] The culture medium used in the embodiments of the present invention is as follows:

[0046] NB medium: 0.5 g peptone, 0.3 g beef extract, 0.5 g sodium chloride, 100 mL distilled water, pH 7.0.

[0047] LB medium: peptone 1.0 g, sodium chloride 1.0 g, yeast extract 0.5 g, distilled water 100 mL.

[0048] Example 1: Screening of highly active tryptophanase based on random forests

[0049] 1. Data preparation:

[0050] The amino acid sequences of tryptophanase from bacteria were searched from NCBI, and 100 tryptophanase amino acid sequences were randomly selected.

[0051] 2. Feature settings:

[0052] a. Protein size: The length of the candidate protein is >400 amino acids;

[0053] b. Two necessary conserved sequences of tryptophanase (i.e., only enzymes containing both sequences are possible tryptophanase): the first segment is KKD, in which the second K is a necessary site for binding to the coenzyme (pyridoxal phosphate); the second segment is any one of the seven conserved regions TDS, TYT, TYE, RHXT, QTHXD, XRD, EXXR (X is any amino acid);

[0054] 3. Decision tree splitting:

[0055] https: / / scikit-learn.org / stable / modules / generated / sklearn.ensemble.RandomForestClassifier.html, the learning toolkit scikit-learn in pycharm is used for simulation, and the parameter settings are shown in Table 1. In the process of forming the decision tree, each node must be split according to the characteristics of step 2 until it can no longer be split.

[0056] Table 1 Random forest parameters

[0057]

[0058]

[0059] 4. Build a decision tree according to steps 1 to 3 to form a random forest. Put the 100 amino acid sequences randomly selected in step 1 into the random forest and let each decision tree in the random forest make judgments and classifications. The screening results are shown in Figure 1 : 98 amino acid sequences that meet feature a (protein length > 400 amino acids) were screened, and 2 amino acid sequences that did not meet feature b were screened; 98 sequences that met feature b were selected based on the number of occurrences of each sequence, and amino acid sequences with an occurrence of ≥3 were selected, of which 13 sequences had an occurrence of ≥3 times, and 85 sequences had an occurrence of <3 times (as shown in Table 2);

[0060] 5. The 13 amino acid sequences screened in step 4 were compared with the tryptophanase reported to be derived from Escherichia coli K12 (ACE63255.1, Deeley MC, Yanofsky C. Nucleotide sequence of the structural gene for tryptophanase of Escherichia coli K-12. [J]. Journal of Bacteriology, 1981, 147 (3): 787-96.) for amino acid sequence alignment (the results are shown in Table 5). Figure 2 As shown). According to the amino acid sequence comparison, it was found that the tryptophanase from Morganella had the highest homology, with a homology of 58.32% (as shown in Table 2), and its amino acid sequence was SEQ ID NO.1 (Gene ID: WP_015422483.1). The genus Morganella currently consists of a single species (Morganella morganii) with two subspecies, namely Morganella morganii and Semeria (Liu H, Zhu J, Hu Q, et al. Morganella morganii, a non-negligent opportunistic pathogen [J]. International Journal of Infectious Diseases, 2016, 50 (C): 10-17.) Morganella morganii with a strain number of CICC 22599 was selected through the China Industrial Microbiological Culture Collection Administration Center. To verify whether it contains tryptophanase activity, NB medium was first used for culture at 37°C for 12h, centrifuged, 0.1g of wet bacteria was added to 10mL of pH7.5, 0.12mM potassium phosphate buffer containing DL-tryptophan (0.02M) and pyridoxal phosphate (0.06mM), and reacted at 37°C overnight. 5% volume concentration of p-dimethylaminobenzaldehyde was added to the obtained fermentation broth, and the solution changed color, indicating that Morganella morganii did contain the tryptophanase encoding gene, and the encoded tryptophanase had the activity of splitting DL-tryptophan.

[0061] Table 2 Output results and homology comparison results

[0062]

[0063]

[0064] Example 2: Primer design and target gene amplification

[0065] 1. Primer design

[0066] According to the gene sequence of tryptophanase from Morganella morganii CICC 22599 screened in Example 1, SEQ ID NO. 2 (Gene ID: 69679949), primers were designed by snap gene. The details of the primers are as follows:

[0067] Upstream:

[0068] 5'-CAGTGGTGGTGGTGGTGGTG CTCGAG TTACATGACAGGTTTCAGGCGGG-3'(XhoⅠ);

[0069] Downstream:

[0070] 5'-AGCAAATGGGTCGCGGATCC GAATTC ATGAACGTATTCCAGAACCGTT CCG-3'(EcoRⅠ).

[0071] 2. Extraction of Morganella morganii genomic DNA

[0072] The genomic DNA of Morganella morganii CICC 22599 was extracted using a DNA extraction kit.

[0073] 3. PCR cloning of tryptophanase gene

[0074] Using the genomic DNA extracted in step 2 as a template, PCR was performed using the primers designed in step 1 to clone the tryptophanase gene.

[0075] PCR reaction system (total volume 50 μL): 2 μL of upstream and downstream primers (10 μM), 2 μL of Morganella morganii genomic template, 25 μL of DNA polymerase premix (Primer Star Max Mix), and 19 μL of nuclease-free water.

[0076] PCR reaction program: preliminary denaturation: 95°C for 5 min, complete denaturation at 95°C for 15 s, annealing: 55°C for 15 s, extension: 72°C for 90 s, 30 cycles, re-extension: 72°C for 5 min, reduce to 4°C for insulation.

[0077] The PCR amplification product (tnaA) was detected by 1% agarose gel electrophoresis. Figure 3 As shown, the order of loading from left to right is Marker (100-5000bp) and PCR amplification product (tnaA) recovered by gel excision, which proves that the amplification product is basically consistent with the size of the tryptophanase gene (tnaA, about 1398bp) in the GENBANK database, proving that the tryptophanase gene (tnaA) was obtained. The gene fragment was extracted and sequenced to determine the nucleotide sequence as shown in SEQ ID NO.2.

[0078] Example 3: Construction of recombinant engineering bacteria for heterologous expression of tryptophanase

[0079] 1. The PCR product of Example 2 was recovered using an agarose gel recovery kit, and the insert fragment (tnaA) was extracted using the SanPrep column plasmid DNA small-amount extraction kit method (see gel electrophoresis). Figure 4 middle lane 3).

[0080] 2. Digest the pET-28a(+) expression vector with XhoⅠ and EcoRⅠ, and use the SanPrep column PCR product purification kit to recover the linearized plasmid.

[0081] 3. The pET-28a(+) linearized plasmid and the insert fragment (tnaA) were seamlessly cloned according to the SeamLess cloning MasterMix kit method. The reaction system used is shown in Table 3.

[0082] 4. Transform the ligation product into E. coli DH5α competent cells to construct DH5α-pET 28a(+)-TPase cloning strain. Extract the plasmid and perform double digestion with XhoⅠ and EcoRⅠ. Figure 4 Lane 1 was used for sequencing to verify the accuracy of the gene. The pET28a(+)-TPase plasmid was extracted and transferred into E. coli BL21 competent cells to construct E. coli BL21-pET28a(+)-TPase tryptophanase heterologous expression engineering bacteria. The plasmid was extracted and double-digested with XhoⅠ and EcoRⅠ by gel electrophoresis. Figure 4 Lane 2 was sequenced to confirm that the engineered bacteria were successfully constructed.

[0083] Table 3 Seamless cloning reaction system

[0084]

[0085] Example 4: Heterologous expression of recombinant tryptophanase and enzyme activity determination

[0086] 1. Pick a single colony of E. coli BL21-pET 28a(+)-TPase from the plate and place it in 50 mL LB liquid medium containing Kan resistance (50 mg / L), and culture it at 37°C with shaking at 200 rpm overnight.

[0087] 2. Transfer the inoculum to a new 100 mL LB liquid medium at a volume concentration of 1% and culture at 37°C and 200 rpm in a shaking incubator until the OD 600 The value was 0.6, IPTG was added with a final concentration of 0.1 mM, and the culture was induced at 25°C and 200 rpm for 12 h.

[0088] 3. Cell wall disruption: centrifuge the induced bacterial solution at 8000 rpm and 4°C for 10 min, remove the supernatant, resuspend the wet cells in 0.1 mM, pH=8 sodium phosphate buffer, and disrupt them with 360W ultrasound for 20 min under ice bath conditions, with a working time of 2s and an interval of 2s. Centrifuge the ultrasonic cell disruption solution at 8000 rpm and 4°C for 10 min to obtain the supernatant (i.e., crude enzyme solution) and precipitate.

[0089] 4. Extraction of pure enzyme: The nickel column was balanced with a binding buffer (20 mM sodium phosphate buffer containing a final concentration of 0.5 M NaCl) containing 20 mM imidazole (pH = 7.4), the crude enzyme solution was passed through a 0.22 μm water filter membrane, added to the nickel column for equilibration for 30 to 60 min, and gradient eluted with a binding buffer containing a final concentration of 50 mM imidazole (pH = 7.4) for 20 column volumes, followed by gradient elution with a binding buffer containing a final concentration of 150 mM imidazole (pH = 7.4) for 10 column volumes, and then gradient eluted with a binding buffer containing a final concentration of 250 mM imidazole (pH = 7.4) for 10 column volumes and the eluate was collected, the collected eluate was filtered using an ultrafiltration membrane with a molecular weight cutoff of 50 KDa, the concentrate was collected, and the TPase pure enzyme was obtained.

[0090] 5. Detect the expression of the target protein by SDS-PAGE gel electrophoresis: prepare 10% SDS-PAGE gel, take 18μL of the sample (supernatant and precipitate from step 3, pure enzyme from step 4), mix with 2μL of 10×Loading Buffer, boil at 100℃ for 5min, and take 15μL for loading. The voltage is 80V when the protein is in the stacking gel, and 120V when it is in the separation gel. After the electrophoresis, remove the stacking gel, stain with Coomassie Brilliant Blue for 30min, and then decolorize until the bands are clear. The protein electrophoresis results are as follows: Figure 5 As shown, the protein was expressed soluble and the size of the tryptophanase subunit was determined to be approximately 52 KDa.

[0091] 6. Native-PAGE gel electrophoresis: The operation steps are basically the same as SDS-PAGE, except that: when making Native-PAGE gel, no denaturants such as SDS and ethanol are added, and the gel is placed in ice, and the constant voltage is 100V for 20 minutes, followed by 160V for 80 minutes. The electrophoresis results are as follows: Figure 6 The size of tryptophanase was determined to be about 312 KDa, and combined with the SDS-PAGE results, it can be confirmed that the tryptophanase obtained in the present invention is a homohexamer.

[0092] 7. Determination of enzyme activity: Add 0.1 g of wet bacteria to 10 mL of 0.12 mM (pH = 7.5) potassium phosphate buffer, then add 0.2 M reduced glutathione, 0.06 mM pyridoxal phosphate, 0.25 mg / mL bovine serum albumin, and 0.02 M DL-tryptophan at a final concentration. After reacting at 37 ° C for 1 hour, add 10 mL of toluene, and then add 100 mL of an aqueous solution containing 5% by volume p-dimethylaminobenzaldehyde and 5% by volume n-butyl sulfate as a mixed color developing solution to terminate the reaction, and form different shades of rose red. After 30 minutes, the absorbance is quantitatively determined at 570 nm (tryptophanase decomposes L-tryptophan into indole, pyruvic acid and ammonia, among which indole can react with p-dimethylaminobenzaldehyde to produce a deep red indole derivative by Ehrlich reagent).

[0093] Definition of enzyme activity: Under certain reaction conditions, at 37°C, the amount of enzyme required to catalyze the formation of 0.01 μmol of indole per minute is 1 U.

[0094] The enzyme activity of the wet cells of Morganella morganii CICC 22599 prepared by the method of steps 1-3 was 0.75 U / mg, and the enzyme activity of the wet cells of Escherichia coli BL21-pET 28a(+)-TPase was 1.58 U / mg.

[0095] Example 5: Optimization of whole-cell catalytic conditions of genetically engineered bacteria containing tryptophanase TPase

[0096] Reference Figure 7 Tryptophanase catalytic mechanism, the following conditions were screened for the splitting of DL-tryptophan by E. coli BL21-pET 28a(+)-TPase:

[0097] 1. Reaction time

[0098] The volume of the reaction system is 10 mL: DL-tryptophan with a final concentration of 4 g / L is dissolved in 0.12 mM, pH = 7.5 potassium phosphate buffer, and 16 g / L of Escherichia coli BL21-pET 28a(+)-TPase wet bacteria prepared by the method of Example 4 and 6 mM pyridoxal phosphate are added in sequence to form a 10 mL reaction system, and reacted at 35°C and 200 rpm for 2 to 10 h (2, 4, 6, 8, 10 h). After the reaction is completed, the transformation liquid is centrifuged at 8000 rpm for 10 min, the cells are removed, and the supernatant is ice-bathed for 15 min. The peak areas of D-tryptophan (D-Trp) and L-tryptophan (L-Trp) before and after transformation (substrate is added, enzyme has not yet been added) and after transformation are determined by HPLC, and the corresponding contents are calculated based on the standard curve of peak area and concentration of D-tryptophan and L-tryptophan under the same conditions. The results are as follows Figure 8 As shown in Figure 1, the optimal reaction time is 8h.

[0099] HPLC detection conditions: chromatographic column is InertSustain C18; mobile phase is aqueous phase (0.375mM L-phenylalanine and 0.075mM copper sulfate): organic phase (methanol) = 76:24, v / v; flow rate is 1mL / min; temperature is 25°C; injection volume is 20μL.

[0100] Conversion rate = (amount of L-tryptophan substance consumed / amount of L-tryptophan substance added) * 100%;

[0101] ee=[(A D -A L ) / (A D +A L )]*100%, A D : Peak area of ​​D-Trp, A L : Peak area of ​​L-Trp

[0102] 2. Bacteria concentration

[0103] The wet cell concentration in the reaction system of step 1 was changed to 1, 6, 11, 16, 21 g / L, the reaction time was changed to 8 h, and other operations were the same. The results are shown in Figure 8 In 2, the optimal bacterial concentration is 16g / L.

[0104] 3. Reaction temperature

[0105] The reaction time in step 1 was changed to 8 h, the reaction temperature was 30, 35, 40, 45, 50 ° C, and other operations were the same. The results are shown in Figure 8 In 3, the optimal reaction temperature is 35℃.

[0106] 4. Pyridoxal phosphate concentration

[0107] The reaction time in step 1 was changed to 8 h, the concentration of pyridoxal phosphate was changed to 0, 2, 4, 6, 8, 10 mM, and other operations were the same. The results are shown in Figure 8 In 4, the optimal pyridoxal phosphate concentration was 6 mM.

[0108] 5. Conversion process under optimal conditions

[0109] The volume of the reaction system is 10 mL: DL-tryptophan with a final concentration of 4 g / L is dissolved in 0.12 mM, pH = 7.5 potassium phosphate buffer, and 16 g / L of Escherichia coli BL21-pET 28a(+)-TPase wet cells prepared by the method of Example 4 and 6 mM pyridoxal phosphate are added in sequence to form a 10 mL reaction system, and the reaction is carried out at 35°C and 200 rpm for 8 hours. After the reaction is completed, the transformation liquid is centrifuged at 8000 rpm for 10 minutes. After removing the cell precipitate, the transformation liquid supernatant is ice-bathed for 15 minutes. The peak areas of D-tryptophan and L-tryptophan in the supernatant are determined by HPLC, and the corresponding contents are calculated based on the standard curve of peak area and concentration of D-tryptophan and L-tryptophan under the same conditions. Using 4 g / L DL-tryptophan standard aqueous solution, 2 g / L L-tryptophan standard aqueous solution, and 2 g / L D-tryptophan standard aqueous solution as detection controls, the tryptophanase conversion rate and D-tryptophan ee value are calculated, and the results are as follows: Fig. 9 As shown, the results showed that the tryptophanase conversion rate reached 99.36% and the ee value of the product reached 99.23%.

Claims

1. A method for screening high-activity tryptophanase based on random forest, characterized in that: The method comprises the following steps: (1) Data preparation: Search the amino acid sequences of tryptophanase from bacteria from NCBI and randomly select 100 tryptophanase amino acid sequences; (2) Feature setting: a. Protein size: The length of the candidate protein is >400 amino acids; b. Two necessary conserved sequences of tryptophanase: the first segment is KKD; the second segment is any one of the seven conserved regions TDS, TYT, TYE, RHXT, QTHXD, XRD, EXXR, where X is any amino acid; (3) Decision tree splitting: Step (1) 100 tryptophanase amino acid sequences were randomly selected and simulated using the learning toolkit scikit-learn in pycharm. During the decision tree formation process, each node was split according to the characteristics of step (2) until it could not be split any further. Parameter settings of the learning toolkit scikit-learn: the number of estimators is set to 10, the splitting criterion is selected as Gini impurity, the maximum depth is set to None, the maximum number of features is set to square root, the random state is set to None, the self-service sampling is set to True, and the number of jobs is set to None; (4) Align the amino acid sequence obtained in step (3) with the amino acid sequence of tryptophanase derived from Escherichia coli K12 to select the amino acid sequence with the highest homology.

2. A tryptophanase screened by the method of claim 1, characterized in that: The amino acid sequence of the tryptophanase is shown in SEQ ID NO.

1.

3. Use of the tryptophanase screened by the method of claim 1 in splitting DL-tryptophan.

4. The use according to claim 3, characterized in that The application method comprises the following steps: using wet bacteria of tryptophan recombinant genetic engineering bacteria induced to express as a catalyst, using DL-tryptophan as a substrate, and using a pH 6-8 buffer as a reaction medium to form a conversion system, and reacting at 30-50° C. and 100-300 rpm to obtain a reaction solution containing D-tryptophan.

5. The use according to claim 4, characterized in that In the transformation system, the wet bacteria are added at a concentration of 1-21 g / L; and the substrate is added at a concentration of 1-10 g / L.

6. The use according to claim 4, characterized in that The transformation system uses pyridoxal phosphate as an auxiliary agent, and the added amount of the pyridoxal phosphate is 1-10 mM.

7. The use according to claim 4, characterized in that The wet bacterial cells were prepared as follows: a single colony of Escherichia coli BL21-pET28a(+)-TPase was selected and placed in an LB liquid culture medium containing 50 mg / L of Kan resistance, and cultured overnight at 37° C. and 200 rpm with shaking; the inoculation amount was transferred to a new LB liquid culture medium at a volume concentration of 1%, and cultured at 37° C. and 200 rpm with shaking until the OD600 value was 0.6, IPTG with a final concentration of 0.1 mM was added, and cultured at 25° C. and 200 rpm with shaking for 12 hours, the induced bacterial solution was centrifuged at 8000 rpm and 4° C. for 10 minutes, and the wet bacterial cells were collected.

Images