Enhanced triacylglycerol productivity and extractability in engineered microalgae

Abstract

The present invention relates to engineered single-cell native algae bacteria microalgae comprising a loss of homologous Seipin gene function, an in vitro process for the production of triacylglycerol (TAG), and uses thereof.

Description

Technical Field

[0001] The present invention relates to the production of oil by engineering microalgae, in particular to increased production of triacylglycerols (TAGs) by engineering diatom microalgae. Background Art

[0002] Dependence on fossil fuels has led to environmental problems and energy crises, so there is a continuous search for sustainable and renewable energy sources for the production of biofuels with biological raw materials (such as seed oils, animal fats or oil-producing microorganisms). Microalgae are very promising organisms for the production of third-generation biofuels. The use of microalgae allows to alleviate some of the disadvantages associated with the production of first- and second-generation biofuels. They can grow quickly, use little water, and do not compete with food crops for arable land. In addition, unlike other microorganisms studied for third-generation biofuels, microalgae are autotrophic and consume CO2; marine species are particularly interesting because they do not use fresh water and can use functional industrial waste to grow. Finally, oils from microalgae can be rich in omega-3 fatty acids, which makes them interesting in other applications, especially food, feed and cosmetics. A review (HuQiang et al., 2008) presents the characteristics of TAG production by microalgae, especially the biosynthetic pathways involved and the parameters that affect yield (pH, temperature, light...).

[0003] Currently, two major obstacles that increase production costs considerably, especially compared to conventional fuels, hinder the production of third generation biofuels. The first obstacle relates to biomass production. Oil accumulation in microalgae is triggered by stress conditions that lead to slowing or even stopping growth. In addition, the maximum oil content depends largely on the species under consideration. The second obstacle is related to oil extraction, which can be divided into two stages: 1) destroying the cells to release the oil and 2) separating the oil from other cellular components. The actual methods used for oil extraction require high energy and are therefore very costly.

[0004] To circumvent the first obstacle and trigger oil accumulation while maintaining cell growth, many studies have attempted to alter the expression of enzymes involved in oil production or more generally in lipid metabolism (reviewed in Kang et al., 2022). Other studies have focused on proteins associated with lipid droplets (LDs), which are organelles that store oil in cells. Meanwhile, efforts to circumvent the second obstacle have mainly involved the development of new harvesting and lipid extraction techniques (reviewed in Kowthaman et al., 2022), while to the best of the applicant's knowledge, no studies have been conducted on the biological side.

[0005] Therefore, there remains a need to provide new methods to increase triacylglycerol (TAG) production and facilitate its extraction from cells.

[0006] The Applicant has surprisingly demonstrated that silencing the expression of the Seipin gene from the diatom Phaeodactylum tricornutum (Pt Seipin gene) in microalgae gives an increase in TAG production without any negative impact on cell growth, whereas previous work in yeast and plants showed opposite effects on TAG production and / or cell growth.

[0007] Indeed, previous studies in yeast and plants have shown that overexpression of Seipin protein leads to higher TAG accumulation (Cai et al., 2015) and that loss of Seipin triggers the formation of several very large LDs, rather than several small LDs, with very little change in oil accumulation (Fei et al., 2011; Taurino et al., 2018; WO 2012 / 075543).

[0008] Therefore, the present invention relates to engineered Stramenopile microalgae having a loss of function of a homologous Seipin gene, in particular a loss of function of a homologous Seipin gene of Phaeodactylum tricornutum, which results in increased triacylglycerol (TAG) production, as well as methods for producing the engineered microalgae and uses thereof. Summary of the invention

[0009] The first subject of the present invention is an engineered unicellular Stramenopile microalgae comprising a loss of function of a homologous Seipin gene.

[0010] The present invention also relates to a microalgae culture comprising the engineered unicellular stramenopile microalgae according to the present invention, preferably engineered unicellular Phaeodactylum tricornutum (from the wild-type CCMP2561 strain).

[0011] Another subject of the present invention is a vector comprising a Cas9 sequence and a single guide sgRNA designed to target a sequence upstream or downstream of the first transmembrane domain, in particular a single guide sRNA 1 (SEQ ID NO. 24: AGAAGAAGCGCACGCTGCCG) or sgRNA 8 (SEQ ID NO. 25: TTCAATCCATACCGAGAGCA).

[0012] The present invention also relates to an in vitro method for producing triacylglycerols (TAGs), comprising culturing the engineered microalgae according to the invention or the microalgae culture of the invention in a culture medium to produce TAGs, in particular under normal growth conditions or preferably under stress conditions selected from nutrient starvation and / or light stress conditions, and optionally the method further comprises a step of recovering the TAGs from the engineered microalgae, the culture medium or the whole culture.

[0013] Another subject of the present invention is the use of the engineered stramenopile microalgae according to the invention, or of the microalgae culture according to the invention, or directly of the TAGs produced by the in vitro method according to the invention, for biofuel production, in the food industry, in the feed industry, in green chemistry, in the pharmaceutical industry or for the production of cosmetics, in particular for biofuel production. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 :Use the neighbor-joining method (Saitou N. and Nei M, 1987) to infer evolutionary history. The best tree with a total branch length of 48.43171304 is shown. The percentage of repeated trees in which related taxa (taxa) cluster together in the bootstrap test (5000 repetitions) is shown next to the branch. The tree is drawn to scale, and the unit of the branch length is the same as the unit of the evolutionary distance used to infer the phylogenetic tree. The evolutionary distance is calculated using the method based on the JTT matrix (Jones DT et al., 1992), and the unit is the number of amino acid substitutions at each site. The rate change between sites is modeled with a gamma distribution (shape parameter = 2). The analysis involves 52 amino acid sequences. All unclear positions of each sequence pair are removed (paired deletion option). There are a total of 1511 positions in the final data set. Evolutionary analysis is performed in MEGA X. The figure also shows the percentage identity of each Seipin sequence to the Pt Seipin sequence based on the reference sequence (SEQ ID NO: 23).

[0015] Figure 2: Structural analysis of seipin. A: Cartoon representation showing the general organization common to most known seipin proteins. The length and structure of the N-terminal and C-terminal parts vary greatly and do not show any sequence conservation between phyla. The transmembrane domain forms an α-helix but shows little sequence conservation. The central part is mainly composed of 8 β-strands (β1 to 8), forming a β-sandwich. In humans, this structure mediates interactions with anionic lipids (Yan et al., 2018). The hydrophobic α-helix (α2-α3) located between the 5th and 6th β-strands plays an important role in seipin oligomerization (Sui et al., 2018, Yan et al., 2018) as well as TAG clustering (Zoni et al., 2021). Its structure and positioning are highly conserved, but it shows only limited sequence conservation. Another very small α-helix (α1) is found between the 3rd and 4th β-strands, associated with a very conserved small motif (PESxxN); however, its function has not been studied. B: AlphaFold prediction of the PtSeipin structure. Key features are highlighted, including the long loop found in diatoms, which is located between the 1st and 3rd β-strands, between amino acid positions P107 and L192 (inclusive) in the PtSeipin sequence. Tmb: transmembrane domain. C: AlphaFold prediction of the PtSeipin structure using the MEME tool for constructing the phylogenetic tree ( Figure 1 ) in all 52 sequences.

[0016] D: Alignment of the amino acid sequences of seven Seipin proteins from diatom microalgae, namely Nitzschia inconspicua (Accession No. KAG7356349), Fistulifera solaris (Accession No. GAX25459), Fragilariopsis cylindrus (Accession No. OEU20716), Chaetoceros tenuissimus (Accession No. GFH58951), Phaeodactylumtricornutum (Accession No. Phatr3_J47296), Thalassiosira pseudonana (Accession No. XP_002286702), and Thalassiosira oceanica (Accession number EJK50087), and two amino acid sequences of two Seipin proteins from the Euchloropsis phylum, namely Microchloropsis gaditana (Accession number Naga_100503g2) and Microchloropsis salina (Accession number TFJ84559). Legend: Large dashed line: positions of sgRNA 1 and 8; Full dashed line: transmembrane domain; Small dashed line: b-chain.

[0017] Figure 3 : Nucleotide alignment of the first part of the PtSeipin gene obtained from sequencing of the WT and ΔPtSeipin lines. Alignment was achieved using Multalin software (http: / / multalin.toulouse.inra.fr / multalin / ). The sequences targeted by the two guide RNAs (guide RNA1 and guide RNA8) are framed with solid lines. Both are upstream of the first transmembrane domain sequence, which is framed with dotted lines.

[0018] WT: SEQ ID NO. 26; ΔPtSeipin8: SEQ ID NO. 27; ΔPtSeipin1: SEQ ID NO. 28; Shared: SEQ ID NO. 29.

[0019] Figure 4: Protein translation of the Seipin gene of P. tricornutum in WT (incomplete) and mutants. The underlined portion corresponds to the signal peptide, and the bold portion in WT corresponds to the first transmembrane domain. The light grey portion in the mutant sequence corresponds to the portion between the frameshift and the translation end point, where the translated sequence is different from the WT sequence. *: stop codon. WT: SEQ ID NO. 30; ΔSeipin1: SEQ ID NO. 21; ΔSeipin8: SEQ ID NO. 22.

[0020] Figure 5 : Wild-type (WT) and knockout (ΔPtSeipin1 and ΔPtSeipin8) lines were grown under control conditions (ESAW10N10P, 75 µmol.photons.m 2 .s -1 , 20 ° C, 100 rpm) under growth curve. The absorbance at 730nm is used to measure the cell concentration. The cell concentration at each time point is normalized by the initial concentration (T0). The log scale with 2 as the base is used to reflect cell division (biomass per 24 hours under optimal conditions, in duplicate). Track the culture for 8 days.

[0021] Figure 6 : Lipid droplet accumulation under control conditions after 4 and 8 days of culture. Images were acquired by confocal microscopy after Nile Red staining. Representative images of bright field, Nile Red fluorescence (excitation: 514 nm - emission: 580-640 nm) and merged signals are shown. Scale bar = 3 μm.

[0022] Figure 7 : Oil (TAG) accumulation of WT and mutants under control (normal growth) conditions after 4 days of culture (end of exponential phase). (a): Total lipids in nmol per million cells. (b): The amount of triacylglycerol (TAG) in nmol per million cells increased by 3.8 (mutant ΔPtSeipin1) to 5.8 (mutant ΔPtSeipin8) fold ratios. (c): Triacylglycerol (TAG) as a percentage of total glycerolipids increased by 2.78 (mutant ΔPtSeipin1) and 7.4 (mutant ΔPtSeipin8) fold ratios compared to WT.

[0023] Figure 8 : Knockout (ΔPtSeipin1 and ΔPtSeipin8) lines and WT under higher light conditions (ESAW 10N10P, 200 μmol.m 2 .s -1, 20 ° C, 100 rpm) under growth curve. The absorbance at 730nm is used to measure the cell concentration. The cell concentration at each time point is normalized by the initial concentration (T0). The log scale with 2 as the base is used to reflect cell division (biomass per 24 hours under optimal conditions, in duplicate). Track the culture for 8 days.

[0024] Fig. 9 : Lipid droplet accumulation under higher light conditions after 4 and 8 days of culture. Images were acquired by confocal microscopy after Nile Red staining. Representative images of bright field, Nile Red fluorescence (excitation: 514 nm - emission: 580-640 nm) and merged signals are shown. Scale bar = 3 μm.

[0025] Fig.10 : Exposure to higher light (200 µmol.photons.m 2 .s -1 ) Oil (TAG) accumulation in WT and mutants after 8 days. (a): Total lipids in nmol per million cells. (b): The amount of triacylglycerol (TAG) in nmol per million cells increased to 16.3 (ΔPtSeipin1) and 15.2 (ΔPtSeipin8) fold ratios. (c): Triacylglycerol (TAG) as a percentage of total glycerolipids increased to 13.3 fold ratios for ΔPtSeipin1 and 9.7 fold ratios for ΔPtSeipin8 compared to WT.

[0026] Fig.11 : Wild-type (WT) and knockout (ΔPtSeipin1 and ΔPtSeipin8) lines were grown under phosphate starvation conditions (ESAW 10N00P, 75 µmol.photons.m 2 .s -1 , 20 ° C, 100 rpm) under growth curve. The absorbance at 730nm is used to measure the cell concentration. The cell concentration at each time point is normalized by the initial concentration (T0). The log scale with 2 as the base is used to reflect cell division (biomass per 24 hours under optimal conditions, in duplicate). Track the culture for 8 days.

[0027] Fig.12 : Lipid droplet accumulation under phosphate starvation conditions after 4 days of culture. Images were acquired by confocal microscopy after Nile Red staining. Representative images of bright field, Nile Red fluorescence (excitation: 514 nm - emission: 580-640 nm) and merged signals are shown. Scale bar = 3 μm.

[0028] Fig.13: Oil (TAG) accumulation under phosphate starvation conditions after 4 days of culture. (a): Total lipids per million cells. (b): Triacylglycerol (TAG) amount per million cells increased by 2.4 (ΔPtSeipin1) and 3.1 (ΔPtSeipin8) fold ratios. (c): Similar fold changes in TAG accumulation were observed in the percentage of total glycerolipids: 2.2-fold ratio for ΔPtSeipin1 and 3.1-fold ratio for ΔPtSeipin8 compared to WT.

[0029] Fig.14 : Epifluorescence images of lipid droplets floating in the culture medium. Left part: Image on mutant ΔPtSeipin1. Right part: Image on mutant ΔPtSeipin8. White arrows indicate LDs on the images, and microalgae CT is also shown in the images: control conditions, higher light: higher light conditions, -P: phosphate-deficient conditions.

[0030] Fig.15 : TAG accumulation in the culture medium of wild-type (WT) and knockout (ΔPtSeipin1 and ΔPtSeipin8) lines. (a) Control conditions (ESAW 10N10P, 75 µmol.photons.m 2 .s -1 , 20°C, 100 rpm). (b): Higher light conditions (ESAW10N10P, 200 µmol.photons.m 2 .s -1 , 20°C, 100 rpm). (c): Phosphate starvation conditions (ESAW 10N00P, 75 µmol.photon.m 2 .s -1 , 20°C, 100 rpm). The measured TAG amount in nmol was normalized by the number of cells in the total culture.

[0031] Fig.16 : Confocal microscopy z-stack acquisition on the ΔPtSeipin8 mutant after 4 days of exposure to higher light. Bright field and Nile Red signals are shown. Four slices of the z-stack acquisition are shown (33 slices in total). Lipid droplet release can be observed between slices 15 and 16 acquisitions and is highlighted by white arrows. Scale bar = 3 μm.

[0032] Fig.17 : Vector map of the pKSdiaCAs9_sgRNA_ZeoR plasmid (Seydoux et al., 2022) used in the example. DETAILED DESCRIPTION

[0033] The first object of the present invention is an engineered unicellular stramenopile microalgae comprising a loss of function of a homologous Seipin gene.

[0034] In other words, the present invention relates to engineered unicellular stramenopile microalgae, wherein the Seipin gene from Phaeodactylum tricornutum having the sequence SEQ ID NO. 3 or one of its homologues is silenced.

[0035] definition

[0036] As used herein, the term "engineered" with respect to stramenopile microalgae defines non-naturally occurring microalgae and recombinant progeny thereof that have at least one genetic alteration not found in naturally occurring microalgae (including wild-type microalgae of the same type). Such genetic modifications are typically achieved by technical means of human intervention (i.e., non-naturally), and may include, for example, the introduction of exogenous nucleic acids and / or the modification or deletion of endogenous nucleic acids.

[0037] As used herein, the expression "microalgae" refers to tiny algae ranging in size from a few microns to hundreds of microns.

[0038] The microalgae of interest for producing TAGs in the present invention are algae belonging to the Stramenopile (also known as the Heterokont or Heterokontaceae), which includes Bacillariophyceae (diatoms), Eustigmatophycea, Phaeophyceae (brown algae), Xanthophyceae (yellow-green algae), and Chrysophyceae (golden algae). The present invention is primarily concerned with Stramenopile.

[0039] Diatoms are a major group of unicellular photosynthetic heteroflagellate (or stramenopile) microalgae that live in oceans and freshwaters.

[0040] They are found in diverse environments, aquatic and soil ecosystems, and are major contributors to the carbon, nitrogen and silicon cycles of the oceans.The oleaginous marine diatom Phaeodactylum tricornutum has a fully sequenced and annotated genome (Bowler et al., 2008; accession number GCA_000150955).

[0041] In particular, microalgae with high industrial potential (eg use as food supplement or for biofuel production) are Phaeodactylum tricornutum and Thalassiosira pseudonana, preferably Phaeodactylum tricornutum.

[0042] "Homologous genes" are one or more genes that are related by vertical descent and are responsible for substantially the same or identical function in different organisms. For example, genes are related by vertical descent when they share a sufficient amount of sequence similarity to indicate that they are homologous or related by evolution from a common ancestor.

[0043] As used herein, the term "homolog" related to the Pt Seipin gene refers to the fact that the homologous gene is different from the Pt Seipin gene having the sequence SEQ ID NO. 3 in its sequence, but retains the activity of the Pt Seipin protein and is derived from another species, i.e., is a naturally occurring sequence. Homologs of Pt Seipin can be identified by a technician by pairwise search methods such as BLAST and checking the corresponding activities.

[0044] In particular, the following diatoms may be mentioned: Nitzschia inconspicua (Accession No. KAG7356349), Fistulifera solaris (Accession No. GAX25459), Fragilariopsis cylindrus (Accession No. OEU20716), Chaetocerostenuissimus (Accession No. GFH58951), Phaeodactylum tricornutum (Accession No. Phatr3_J47296), Thalassiosira pseudonana (Accession No. XP_002286702) and Thalassiosira oceanica (Accession No. EJK50087).

[0045] The article (Guéguen et al., 2021) reports the identification of Seipin homologs in microalgae by sequence homology: by this method, no homologs have been identified in species of the genus Nannochloropsis, since the sequence of this protein is poorly conserved between species. Later, with the help of structural predictions, in particular the AlphaFold protein structure database, Seipin homologs have been identified in Michrochloropsis gaditana (UNIPROT accession number W7TBE7) and Microchloropsissalina (UNIPROT accession number A0A4D9D7J7). These proteins present a high degree of structural homology, but not sequence homology, and in particular a long loop between the first β strand and the third β strand of the β sandwich containing the lumenal domain, with a length of at least 80 amino acids, which is located between the end of the first transmembrane domain and the conserved motif PESxxN (or PDSxxN) located at the end of said third β strand.

[0046] By "loss of Seipin gene function" is meant that the activity of the targeted Seipin gene is reduced or abolished. Different mechanisms for silencing gene expression are known. Mutations, RNA interference, antisense DNA, knockouts or small molecule inhibitors may be mentioned.

[0047] As used herein, "mutation" refers to a change in a nucleic acid sequence relative to a reference Seipin gene sequence (which is preferably a naturally occurring normal or "wild type" sequence), and includes translocation, deletion, insertion and substitution mutations.

[0048] Suitable genetic engineering methods for introducing mutations in endogenous genes are known to those skilled in the art and include by using so-called molecular scissors (nucleases) (e.g. TALEN, CRISPR / Cas9, etc.), or by using vectors containing specific sequences for homologous recombination and site-directed insertion.

[0049] As used herein, the term "mutant Seipin" refers to a Seipin protein comprising one or more additions, deletions and / or substitutions in its amino acid sequence. In a specific embodiment, the mutant Seipin is a truncated non-functional protein in which a sequence mutation results in the introduction of a premature stop codon.

[0050] As used herein, "triacylglycerol" or "triacylglyceride" (TAG) is an ester resulting from the esterification of the three hydroxyl groups of glycerol with three fatty acids.

[0051] In triacylglycerol, glycerol can be connected to saturated and / or unsaturated fatty acids. The triacylglycerol produced by the present invention preferably contains one, two or three saturated and / or monounsaturated fatty acids. More preferably, the triacylglycerol containing one, two or three saturated fatty acids. Specifically, the TAG produced by P. tricornutum comprises palmitic acid (C16:0) and palmitoleic acid (C16:1).

[0052] Table 1 below discloses several sequences shown in the examples of the present invention, but the present invention is not limited to the sequences.

[0053] Table 1

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062] SEIPIN proteins from stramenopiles and diatoms

[0063] Lipid droplets (LDs) are endoplasmic reticulum (ER)-derived subcellular organelles that specialize in storing metabolic energy in the form of neutral lipids (NLs). The anhydrous core of these droplets is composed of the two most abundant NLs, triacylglycerols (TAGs) and sterol esters. This droplet is shielded from the aqueous environment by a monolayer of phospholipids and carries a set of LD-specific proteins, including lipases, acyltransferases, and scaffold proteins. The ER protein seipin is key to LD biogenesis. Seipin forms a cage-like structure in which each seipin monomer contains a conserved hydrophobic helix and two transmembrane (TM) domains.

[0064] The applicants conducted phylogenetic and structural analyses of Seipin proteins and detected some specificities shared by stramenopile Seipins and, in particular, diatom Seipins.

[0065] As examples and Figure 1 As shown, diatom Seipin does not share a common ancestor with plant and green algae Seipin, confirming the unique characteristics of this protein in diatoms.

[0066] Seipins are transmembrane proteins located on the ER membrane. They adopt a hairpin structure with two transmembrane alpha helices. The cytoplasmic N-terminal domain and the C-terminal domain show little conservation in terms of sequence and structure, and their lengths are very variable. However, although the sequence conservation of seipin proteins is generally low, the secondary structure of the luminal domain is strikingly conserved ( Figure 2 A), and the same is true for the tertiary structure ( Figure 2 B).

[0067] Both transmembrane domains form α-helices but do not show sequence conservation. The central part is mainly composed of 8 β-strands, forming a β-sandwich. The hydrophobic α-helix (HH) located between the 5th and 6th β-strands plays an important role in Seipin oligomerization (Sui et al., 2018, Yan et al., 2018) as well as TAG clustering (Zoni et al., 2021). Another very small α-helix was found between the 3rd and 4th β-strands, which is associated with a very conserved small motif (PESxxN).

[0068] A more detailed analysis of the region between the first transmembrane domain and the highly conserved PESxxN motif ( Figure 2 A) reveals a peculiarity of all diatoms, in which there is a long loop, usually containing one or more α-helices, surrounding the second β-strand ( Figure 2 B).

[0069] We can consider 3 ways (standards) to define a long loop:

[0070] 1) If we consider the length of the domain located between the end of the first transmembrane domain and the conserved motif PESxxN (or PDSxxN) located at the end of the third strand (in the sequence of Pt Seipin, between amino acid positions P107 and L192 (inclusive)), then this length must be greater than 80 amino acids;

[0071] 2) If we consider the length of the domain located between two conserved motifs: FDY (or LDY), just downstream of the first β-strand, and PESxxN (in the sequence of PtSeipin, between amino acid positions T120 and L 192 (inclusive)), then the length must be greater than 65 amino acids;

[0072] 3) If we consider the length of the domain located between the last amino acid of the first β strand and the first amino acid of the third β strand constituting the β sandwich (in the Pt Seipin sequence, between amino acid positions Y116 and D183 (inclusive)), then this length must be greater than 60 amino acids.

[0073] Thus, according to the first definition (standard), a long loop will typically have a number of amino acids in the range of 80 to 160 amino acids, in particular 84 to 154 amino acids.

[0074] In comparison, in the land plants tested, the length of the same region ranged from 50 to 75 amino acids; in the fungi and animalia tested, the length of the same region ranged from 40 to 60 amino acids; and in Oomycetes and Phaeophyceae, the length of the same region was around 70-75 amino acids.

[0075] Therefore, in a specific embodiment, the wild-type homologous Seipin gene of the stramenopile microalgae of interest of the present invention encodes an amino acid sequence comprising the following: (i) a long loop between the first β strand and the third β strand of the β sandwich of the lumenal domain, which is at least 80 amino acids in length, and which is located between the end of the first transmembrane domain and the conserved motif PESxxN (or PDSxxN) located at the end of the third β strand, particularly in the Pt Seipin sequence, between amino acid positions P107 and L192 (inclusive).

[0076] In particular, the long loop has a sequence that is at least 80%, 90% or 100% identical to the sequence of SEQ ID NO: 6.

[0077] In addition, the applicant calculated the percent identity of each amino acid Seipin sequence in the phylogenetic tree compared to Pt Seipin, where the alignment was based on the reference sequence Pt Seipin (SEQ ID NO: 23), which includes the 7 amino acids of the third β strand before the PESxxN motif and all the way to the 6th β strand (excluding).

[0078] The percent identity of each diatom Seipin sequence to SEQ ID NO: 23 ranged from 41% to 64% (except for Chaetoceros tenuissima, which had 29.8% identity), while all other Seipin sequences aligned to the same SEQ ID NO: 23 had a percent identity below 40%.

[0079] If we calculate the average percent identity for a group (e.g. diatoms), defined as the sum of the percent identities of the Seipin sequences to the reference sequence (SEQ ID NO: 23) divided by the number of sequences considered in the group, based on Figure 1 The average percent identity of the six diatom Seipin sequences shown (without Pt Seipin 100%) is about 47%, or based on Figure 1For the 7 diatom Seipin sequences shown (with Pt Seipin 100%), this average percent identity is about 54%, while in the Sardae family the average percent identity compared to Pt Seipin is lower (38.7% or 43.1%, respectively).

[0080] Therefore, in a specific embodiment, the wild-type homologous Seipin gene of the diatom microalgae of main interest of the present invention encodes an amino acid sequence comprising: (i) a long loop between the 1st β strand and the third β strand of the β sandwich of the lumenal domain, having a length of at least 80 amino acids, which is located between the end of the 1st transmembrane domain and the conserved motif PESxxN (or PDSxxN) located at the end of the third β strand, in particular in the Pt Seipin sequence, between amino acid positions P107 and L192 (inclusive), and further comprises (ii) the following sequence, which comprises the 7 amino acids before the PESxxN motif and up to the 6th β strand (excluding), having a percentage identity of at least 40%, preferably at least 41%, with SEQ ID NO: 23.

[0081] By at least 40% identity, it is meant at least 40%, 41%, 42%, 43%, 44%, 45%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 23.

[0082] As used herein, " percent identity " (or " % identity ") between two nucleic acid or amino acid sequences means the percentage of identical nucleotides or amino acid residues between two sequences to be compared obtained after optimal comparison, and this percentage is statistical completely, and the difference between two sequences is randomly distributed along its length. Traditionally, the comparison of two nucleic acid sequences or amino acid sequences is carried out by comparing sequences after optimal comparison, and the comparison can be carried out by fragment or by using " comparison window ". Except manual comparison, the optimal comparison of the sequence for comparison can also be carried out by the local homology algorithm of Smith and Waterman, by the similarity search method of Pearson and Lipman (1988) or by computer using the software of these algorithms (Wisconsin Genetics Software (Package, Genetics Computer Group, 575 ScienceDr., Madison, Wl) GAP, BESTFIT, FASTA and TFASTA, or by comparing software BLAST NR or BLASTP). The percent identity between two nucleic acids or amino acid sequences is determined by comparing the sequences of two optimal comparisons, wherein the nucleic acid sequence to be compared or the amino acid sequence can have an insertion or disappearance compared to the reference sequence for the optimal comparison between the two sequences. The percent identity is calculated by: determining the number of positions at which amino acids, Nucleotide or residues are identical between the two sequences, preferably between two complete sequences, the number of identical positions is divided by the total number of positions in the comparison window, and the result is multiplied by 100 to obtain the percent identity between the two sequences.

[0083] Applicants have also noted specific amino acid sequences or patterns that are conserved in diatom Seipins and not conserved in Euoplocistomycetes Seipins, in particular:

[0084] - the amino acid sequence between the 5th beta strand and the 6th beta strand, including an α hydrophobic helix (SEQ ID NO: 7) that is highly conserved among diatom Seipin sequences; different species may have up to 3 non-conserved amino acids (so the diatom sequence has at least 85%, in particular at least 90%, or even 100% identity with the SEQ ID NO: 7, and has 100% identity with the model PHES (or PYES); and the amino acids E, S, K at positions 4, 9, and 13 on the 28 amino acid sequence (from left to right) are changed to R, R, and S in the Seipin sequence of Euoploceros;

[0085] - the amino acid pattern 'PHES' (SEQ ID NO: 8) after the 5th beta strand; and / or

[0086] - Amino acid pattern 'IGKE' in the 8th beta strand (SEQ ID NO: 9).

[0087] Therefore, according to another specific embodiment, the wild-type homologous Seipin gene of the diatom microalgae of main interest in the present invention encodes an amino acid sequence comprising (i) a long loop between the 1st β strand and the third β strand of the β sandwich of the lumenal domain, having a length of at least 80 amino acids, which is located between the end of the 1st transmembrane domain and the conserved motif PESxxN (or PDSxxN) located at the end of the third β strand, in particular in the Pt Seipin sequence, between amino acid positions P107 and L192 (inclusive), and further comprises (iii) a sequence having at least 85% identity with SEQ ID NO: 7, which is located between the 5th β strand and the 6th β strand including the α hydrophobic helix, and preferably also has the pattern PHES' (SEQ ID NO: 8) after the 5th β strand and / or the pattern 'IGKE' (SEQ ID NO: 9) in the 8th β strand.

[0088] By at least 85% identity, it is meant 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the sequence.

[0089] Sequence identity is defined as disclosed above.

[0090] Thus, in a specific and preferred embodiment, the wild-type homologous Seipin gene of the diatom microalgae of primary interest in the present invention encodes an amino acid sequence comprising (i) a long loop between the 1st and 3rd β-strands of the β-sandwich of the lumenal domain, having a length of at least 80 amino acids, which is located between the end of the 1st transmembrane domain and the conserved motif PESxxN (or PDSxxN) located at the end of the third β-strand, in particular in the Pt Seipin sequence, between amino acid positions P107 and L192 (inclusive), and advantageously further comprises (ii) a sequence comprising 7 amino acids before the PESxxN motif and up to the 6th β-strand (excluding) having a percentage identity of at least 40%, preferably at least 41%, to SEQ ID NO: 23, and / or (iii) a sequence having at least 85% identity to SEQ ID NO: 7, which is located between the 5th and 6th β-strands comprising the alpha hydrophobic helix, and preferably also having the pattern PHES' (SEQ ID NO: 8) and / or the pattern 'IGKE' in the 8th beta strand (SEQ ID NO: 9).

[0091] In the case of substitution of one or more consecutive or discontinuous amino acids ("variant Pt Seipin"), it is preferred that the substitution be made in which the substituted amino acid is replaced by an "equivalent" amino acid. In this context, the expression "equivalent amino acid" is intended to mean any amino acid that may replace one of the structural amino acids, but which does not alter the biological activity of the corresponding Seipin protein and those specific examples defined below. Equivalent amino acids may be determined based on their structural homology to the substituted amino acid or based on the results of comparative tests of biological activity between the various Seipins that may be generated.

[0092] As non-limiting examples, Table 2 below summarizes possible substitutions that may be made without resulting in a significant change in the biological activity of the corresponding modified binding protein; under the same conditions, the reverse substitution is naturally possible.

[0093] Table 2

[0094]

[0095] Engineered microalgae with loss of SEIPIN gene function

[0096] In a particular embodiment, the loss of function of a homologous Seipin gene of a stramenopile microalgae is obtained by genetic tools for silencing gene expression, the genetic tools being particularly selected from the group consisting of: mutations, RNA interference, antisense DNA, knockout genes and small molecule inhibitors. The Seipin gene or one of its homologs is described as "silent".

[0097] In a specific and preferred embodiment, loss of function is achieved by targeting mutations in the Seipin gene. Changes in the nucleotide sequence of the coding region of the gene may cause different amino acids to be added to the growing polypeptide chain, thereby causing changes in protein structure and function. For example, when a mutation on the DNA chain produces a premature stop codon, the RNA template will not be able to fully translate, which results in a protein with a lower molecular weight due to fewer amino acid residues. Therefore, truncated proteins may also be non-functional.

[0098] Zinc finger nucleases, nucleases, meganucleases (MNs), transcription activator-like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR / Cas9) have emerged in the past decade as effective tools for genome editing in many organisms. CRISPR-Cas9 is a simple two-component system that allows researchers to precisely edit any sequence in the genome of an organism. This is achieved by a guide RNA that recognizes the target sequence and a CRISPR-associated endonuclease (Cas) that cuts the targeted sequence.

[0099] PAM, also known as protospacer adjacent motif, is located approximately 2-6 nucleotides downstream of the DNA sequence targeted by the guide RNA, and Cas makes cuts 3-4 nucleotides upstream of it. The most commonly used Cas9 from Streptococcus pyogenes recognizes the PAM sequence 5'-NGG-3' (where "N" can be any nucleotide base).

[0100] Therefore, in a specific and preferred embodiment, the loss of function of the homologous Seipin gene is preferably obtained by targeting mutations on the Seipin gene, in particular by zinc finger nucleases, nucleases, meganucleases (MNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPR / Cas9), preferably CRISPR-Cas9 or TALEN systems, more preferably CRISPR-Cas9.

[0101] Via TALEN The genome editing of Phaeodactylum tricornutum was successfully demonstrated using CRISPR / Cas9 (Nymark et al., 2016). CRISPR / Cas9-mediated genome editing is a simple and versatile tool for creating targeted genome modifications.

[0102] The discovery of E. coli-mediated conjugation for delivery of non-integrated extrachromosomal DNA (diatom episomes) to the nucleus of P. tricornutum demonstrates an ideal system for delivering CRIPSR / Cas9 for genome editing without integrating CRIPSR / Cas9 into the nuclear genome. Delivery of CRISPR / Cas9 has been achieved in P. tricornutum via biolistic transformation of plasmids (Nymark et al., 2016) or RNPs (Serif et al., 2018) and E. coli-mediated conjugation (Slattery et al., 2018). In all of these methods, E. coli-mediated conjugation does not require specialized equipment or chemicals to maintain auxotrophy (for RNP counter-selection) and can be performed in a high-throughput format.

[0103] Additionally, diatom episomes can be solidified after removal of the selective pressure that removes all foreign genetic material.

[0104] In a specific and preferred embodiment, the mutated Seipin gene is obtained by CRISPR-Cas9-mediated gene editing on a targeted coding sequence.

[0105] Mutations made to the targeted coding sequence typically result in a frameshift that introduces a stop codon early in the targeted coding sequence, or result in a deletion or insertion in the targeted coding sequence, preferably a frameshift that introduces a stop codon early in the sequence.

[0106] Since the two transmembrane domains and the sequences between these transmembrane domains are involved in the conformational structure and function of the Seipin protein, by targeting them, for example targeting at least the upstream or downstream of the first transmembrane domain, at least one of these domains will become non-functional, resulting in a non-functional protein.

[0107] In particular, the targeting sequence is upstream or downstream of the first transmembrane domain, preferably upstream.

[0108] The term "upstream" of the first transmembrane domain refers to at least 1, 5, 10 or 20 amino acids upstream of the first amino acid of the transmembrane domain. The length of the targeting sequence of the designed sgRNA generally ranges from 15 to 25 amino acids, generally 20 amino acids.

[0109] In a specific sequence, the target sequence was selected with respect to its position in the PtSeipin (Accession No. Phatr3_J47296) gene so that the target sequence was as close as possible to the start codon of the gene.

[0110] In a specific and preferred embodiment, the mutated Seipin gene is obtained by CRISPR-Cas9-mediated gene editing by targeting one or two sequences upstream of the first transmembrane domain, particularly one or two sequences having at least 80% identity, 90% identity or 100% identity to the sequences complementary to sgRNA 1 (AGAAGAAGCGCACGCTGCCG) and sgRNA 8 (TTCAATCCATACCGAGAGCA).

[0111] By at least 80% identity is meant 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the sequences complementary to sgRNA 1 (AGAAGAAGCGCACGCTGCCG) and sgRNA 8 (TTCAATCCATACCGAGAGCA).

[0112] % identity is calculated as defined above.

[0113] Carrier

[0114] The present invention also relates to a vector comprising a Cas9 sequence and a single guide sgRNA designed to target a sequence upstream or downstream of the first transmembrane domain, in particular a single guide sRNA 1 (as shown in SEQ ID NO. 24: AGAAGAAGCGCACGCTGCCG) or sgRNA 8 (as shown in SEQ ID NO. 25: TTCAATCCATACCGAGAGCA).

[0115] As used herein, "vector" is a nucleic acid molecule used as a medium for transferring genetic material into a cell. The term "vector" encompasses plasmids, viruses, cosmids, and artificial chromosomes. In general, engineered vectors include a replication origin, a multiple cloning site, and a selectable marker. The vector itself is typically a nucleotide sequence, typically a DNA sequence, which includes an insert (transgene) and a larger sequence that serves as a vector "skeleton." In addition to transgenic inserts and skeletons, modern vectors can also encompass additional features: promoters (inducible or transient), genetic markers, antibiotic resistance, reporter genes, targeting sequences, protein purification tags. The vector (expression construct) referred to as an expression vector is specifically used to express a transgene in a target cell, and typically has a control sequence.

[0116] Conversion method

[0117] Methods for transforming microalgae are well known to those skilled in the art. For example, electroporation and / or chemical (such as based on calcium chloride or lithium acetate) transformation methods known in the art or Agrobacterium tumefaciens-mediated transformation methods can be used.

[0118] In a particular embodiment, the engineered unicellular microalgae according to the invention are obtained by genetic transformation, in particular selected from the group consisting of biolistic transformation, electroporation and bacterial conjugation, preferably biolistic transformation (eg: plasmid on tungsten beads).

[0119] In certain embodiments:

[0120] - One week before transformation, the microalgae were kept in exponential growth (maximum concentration 3.10 6 Cell.mL -1 );

[0121] - For each transformation, add plasmid DNA to tungsten beads;

[0122] - Perform biolistic transformations using the Biolistic Particle Delivery System under a laminar flow hood as recommended by the supplier (e.g. BioRad);

[0123] According to a preferred embodiment, the engineered unicellular microalgae is a diatom, such as a diatom selected from the group consisting of Thalassiosira pseudonana, Thalassiosira oceanica, Chaetoceros tenuissimus, Fistuliferasolaris, Phaeodactylum tricornutum, Nitzschia inconspicua, Fragilariopsis cylindrus, preferably Phaeodactylum tricornutum (strain CCMP2561), in particular a pennate diatom selected from the group consisting of Fistuliferasolaris, Phaeodactylum tricornutum, Nitzschia inconspicua, Fragilariopsis cylindrus, preferably Phaeodactylum tricornutum (strain CCMP2561).

[0124] Therefore, the present invention also relates to an in vitro method for silencing the expression of homologous Seipin genes in unicellular stramenopile microalgae, especially Phaeodactylum tricornutum (strain CCMP2561), which comprises a step of using a genetic tool selected from the group consisting of mutation, RNA interference, antisense DNA, knockout gene and small molecule inhibitors in the upstream sequence of the first transmembrane domain, preferably mutation of the targeted Seipin gene, especially by zinc finger nucleases, nucleases, meganucleases (MN), transcription activator-like effector nucleases (TALEN) and clustered regularly interspaced short palindromic repeats (CRISPR / Cas9), preferably CRISPR-Cas9 or TALEN system, more preferably CRISPR-Cas9.

[0125] In a particular embodiment, the present invention relates to an in vitro method for producing an engineered unicellular stramenopile microalgae, particularly an engineered unicellular Phaeodactylum tricornutum, having increased triacylglycerol (TAG) content when compared to a wild-type microalgae cell of the same type cultured under the same conditions, the method comprising:

[0126] i) preparing a CRISPR-Cas9 plasmid comprising the insertion of a single guide RNA (sgRNA1 or sgRNA8) targeting a sequence upstream of the first transmembrane domain in the coding sequence of a homologous Ptseipin gene (Phatr3 J47296 Phaeodactylum tricornutum),

[0127] ii) detection and selection of CRISPR-Cas9 plasmids with the correct sgRNA insertion, in particular via PCR using the forward sgRNA primer (Seipin-g1-Fwd or Seipin-g8-Fwd) and the pCas9-U6-Rev primer,

[0128] iii) optionally adding a CRISPR-Cas9 plasmid to the tungsten beads,

[0129] iv) genetically transforming Phaeodactylum tricornutum (strain CCMP2561) with a CRISPR-Cas9 plasmid, preferably by biolistic transformation,

[0130] v) Transformants were screened by PCR amplification of the first exon of Seipin using primers Seipin-PCR-Fwd and Seipin-PCR-Rev, and colonies carrying the mutant amino acid sequence ΔPtSeipin1 (SEQ ID NO: 21) or the mutant amino acid sequence ΔPtSeipin8 (SEQ ID NO: 22) were selected.

[0131] Mutants

[0132] The present invention also relates to the engineered unicellular microalgae according to the present invention, wherein it comprises a mutated amino acid sequence truncated upstream of the first transmembrane domain, in particular a mutated amino acid sequence having at least 80%, 90% or 100% identity with ΔPt Seipin1 (SEQ ID NO: 21) or a mutated amino acid sequence having at least 80%, 90% or 100% identity with ΔPt Seipin8 (SEQ ID NO: 22).

[0133] Microalgae cultivation

[0134] The present invention also relates to a microalgae culture comprising the engineered unicellular stramenopile microalgae according to the present invention as defined above, preferably engineered unicellular Phaeodactylum tricornutum (from strain CCMP2561).

[0135] The culture media and culture conditions are disclosed below.

[0136] The present invention relates to providing engineered stramenopile microalgae comprising a Pt Seipin mutant and methods of culturing the engineered microalgae to allow for the production of TAGs.

[0137] In certain embodiments, the triglyceride content in the engineered microalgae is at least 110% (corresponding to an increase of at least a factor 1.1) of the triglyceride content of the corresponding microalgae that does not comprise the Pt Seipin gene mutant.

[0138] In vitro method for producing triacylglycerols (TAG)

[0139] Another subject of the present invention is an in vitro method for producing triacylglycerols (TAGs), which comprises culturing the engineered stramenopile microalgae as defined above according to the invention or a microalgae culture as defined above in a culture medium, in particular under normal growth conditions or preferably under stress conditions chosen from nutrient starvation and / or light stress conditions, to produce TAGs.

[0140] In certain embodiments, the in vitro method further comprises the step of recovering the TAG from the engineered stramenopile microalgae, the culture medium, or the entire culture.

[0141] For example, the step of recovering TAGs from the engineered microalgae includes pressure stress, such as mechanical pressure, sonication, shear flow, or low-speed centrifugation, or any other cell disruption method as disclosed in Lee et al. (2012).

[0142] In certain embodiments, the step of recovering TAGs from the engineered microalgae comprises centrifugation at 3500 g or more for 10 minutes or more.

[0143] In certain embodiments, the number of TAGs per cell (or per liter of culture or per liter of culture per day) of the engineered stramenopile microalgae of the invention is increased by at least 1.1 times compared to the number of TAGs per cell (or per liter of culture or per liter of culture per day) of wild-type microalgae cultured under the same conditions.

[0144] In specific methods, the TAG production of the engineered microalgae of the invention under normal growth conditions is increased by at least 1.1 times, more specifically 3 to 4 times or more, compared to wild-type microalgae cells of the same type cultured under the same conditions.

[0145] The cultivation of microalgae is usually carried out in a chemically defined medium. Some chemically defined mediums that can be used in the present invention contain a carbon source, a nitrogen source and / or a phosphate source and minerals, salts and vitamins necessary for its growth. Those skilled in the art are familiar with the elements necessary for the growth of microalgae.

[0146] By 'normal growth conditions' for stramenopile microalgae in the present invention is meant culture medium and conditioned culture with parameters such as day / night cycle, oxygenation by rotation and / or gas supply, temperature, light and culture medium supplemented with nutrients such as carbon, nitrogen, phosphorus, iron and vitamins.

[0147] In particular, the parameters will include:

[0148] - Day / night cycle: 12h / 12h to 16h / 8h;

[0149] - Oxidation by rotation or by bubbling of the gas supply;

[0150] - Light conditions: exposure to 75-80 µmol.photons.m 2 .s -1

[0151] - temperature between 15°C and 25°C, preferably 20°C;

[0152] - Medium supplemented with nitrogen, phosphate, iron and vitamins.

[0153] In a preferred embodiment, the culture medium is Enhanced Artificial Sea Water (ESAW) containing minerals, salts, vitamins, excess nitrogen and phosphate sources, such as the culture medium used in the examples: 326.7 mM NaCl, 25 mM Na2SO4, 8.03 mM KCl, 0.725 mM KBr, 0.372 mM H3BO3, 0.0657 mMNaF, 47.18 mM MgCl2-6H2O, 9.134 mM CaCl2-2H2O, 0.082 mM SrCl2-6H2O, 8.17 µM Fe-EDTA, 8.3 µM Na2EDTA-2H2O, 0.254 µM ZnSO4-7H2O, 0.0672 µM CoCl2-6H2O, 2.73 µM MnCl2-4H2O, 6.12 nM Na2MoO4-2H2O, 1 nM Na2SeO3, 6.27 nM NiCl2-6H2O, 0.039 nM CuSO4-5H2O, 4.09 nM vitamin B8, 0.738 nM vitamin B12, 0.593 µM vitamin B1, with excess nitrogen and phosphate sources (10N10P: 0.549 mM NaNO3 and 0.022 mM NaH2PO4-H2O).

[0154] To ensure adequate growth, the culture volume during biomass expansion should not exceed one-fifth of the flask capacity and should not exceed a maximum concentration of 10 million cells.mL -1 Liquid cultures were maintained in an incubator (Infors, HT Multitron Pro) at 20°C with constant stirring (100 rpm) and a 12 / 12 light (75 µmol.photons.m2.s-1) / dark cycle. This culture condition was subsequently referred to as control (CT) condition.

[0155] In another specific embodiment, the production of TAGs by the engineered microalgae of the present invention under light stress conditions is increased by at least 1.2 times, more particularly by at least 10 to 15 times or more, compared to wild-type microalgae cells of the same type cultured under the same conditions, particularly when exposed to at least 100 μmol.photons.m 2 .s -1 , in particular at least 150 µmol.photons.m 2 .s -1 and preferably at least 200 µmol.photons.m 2 .s -1 8 days later.

[0156] The term “light stress condition” refers to exposure to at least 100 µmol.photons.m 2 .s -1 light intensity, in particular in the range of 100 µmol.photons.m 2 .s -1 Up to 1000 µmol.photon.m 2 .s -1 , preferably in the range of 150 µmol.photon.m 2 .s -1 Up to 400µmol.photon.m 2 .s -1 In particular, light stress conditions are exposure to at least 150 µmol.photons.m 2 .s -1 , preferably at least 200 µmol.photon.m 2 .s -1 A few days, especially 8 days.

[0157] In another specific embodiment, under nutrient starvation, in particular phosphate starvation, the accumulation of TAGs of the engineered microalgae of the present invention is accelerated, wherein the accumulation is increased to at least 1.2 times, more particularly to at least 2 to 3 times or more, compared to the same type of wild-type microalgae cells cultured under the same conditions, in particular in the first few days of culture, more particularly in the first 3-4 days.

[0158] By 'nutrient starvation' or 'nutrient deficiency', it is meant nitrogen and / or phosphate starvation, particularly during the first few days of cultivation, more particularly the first 3-4 days.

[0159] Such nutrient starvation triggers the accumulation of storage lipids in subcellular organelles called lipid droplets (LDs). The LD cores of P. tricornutum are rich in TAGs and encapsulated by a single layer of specialized membrane lipids.

[0160] It is therefore advantageous that mutant Pt Seipin microalgae be grown in phosphate-depleted medium.

[0161] Uses of TAG

[0162] The ability of the engineered microalgae of the present invention to accumulate TAGs has led to their development as hosts for fatty acid production, for example, for biofuel production, for chemical applications or in the food industry, such as for the industrial production of omega-3 polyunsaturated fatty acids.

[0163] Therefore, the present invention also relates to the use of the engineered stramenopile microalgae as defined above, or the microalgae culture of the present invention, or the TAGs directly produced by the in vitro method according to the invention for biofuel production, in the food industry (e.g. as food supplements), in the feed industry (e.g. for fisheries), in green chemistry (e.g. for polymer production), in the pharmaceutical industry (e.g. nutraceuticals) or in cosmetic production (as emollients in formulations), in particular for biofuel production.

[0164] For this purpose, they are added in customary amounts to food, feed, cosmetics or medicines.

[0165] In a particular embodiment, the engineered stramenopile microalgae as defined above, or the microalgae culture of the invention, or the TAGs directly produced by the in vitro method according to the invention are used for biofuel production.

[0166] The invention will now be illustrated by way of non-limiting examples.

[0167] Example

[0168] The microalgae used in the examples was Phaeodactylum tricornutum (Pt1) Bohlin strain 8.6 CCMP2561 (Culture Collection of Marine Phytoplankton, now known as NCMA: National Center for Marine Algae and Microbiota), which was used for the experiments.

[0169] 1. Materials and Methods

[0170] 1.1 Cloning

[0171] Single guide RNA (sgRNA) was designed using the phytoCRISP-Ex website (www.phytocrispex.biologie.ens.fr / CRISP-Ex / ) and the reference genome of P. triangularis (accession number GCA_000150955). NGG was selected as the protospacer adjacent motif (PAM) sequence (PAM sequence 5'-NGG-3'). The target was selected with respect to the position of the target sequence in the PtSeipin (accession number Phatr3_J47296) gene so that the target was as close as possible to the start codon of the gene. Additional BLAST was performed on the P. triangularis genome using the pre-selected CRISPR target sequence to ensure that no similar sequences were found elsewhere in the genome. Primer pairs corresponding to the selected sgRNA sequences (Table 1) were annealed by heating 2.5 µl of 100 µM of each primer in 45 µl of annealing buffer (1 mM EDTA, 50 mM NaCl, 10 mM Tris pH 7.6) at 95°C for 4 min and then allowing the mixture to cool at room temperature for 45 min.

[0172] The primers are listed in Table 1 disclosed above in the specification.

[0173] like Fig.17 As indicated, pKSdiaCAs9_sgRNA_ZeoR (Seydoux et al. 2022) was digested by BsaI (NewEngland BioLabs) at 37°C for 1 h. Annealing was performed with 1 μl of annealed sgRNA and 100 ng of linearized vector using T4 DNA ligase (New England BioLabs). The ligation product was transformed into Escherichia coli DH5α. Bacterial colonies were PCR screened with Phire Plant Direct PCR Master Mix (F160, ThermoFisher Scientific) to assess the presence of the insert using the forward sgRNA primer (Seipin-g1-Fwd or Seipin-g8-Fwd) and pCas9-U6-Rev primer (Table 1).

[0174] Plasmids were extracted from positive colonies using the NucleoSpin Plasmid Kit (Macherey-Nagel) and sent to Macrogen (The Netherlands) for sequencing using the M13-Reverse primer (Thermofisher). Plasmid midipreps (NucleoBond Xtra Midi Kit, Macherey Nagel) were performed to obtain vectors with the correct sgRNA insert at a minimum concentration of 1 µg / µl.

[0175] 1.2 Phylogenetic analysis

[0176] The amino acid sequence of the putative PtSeipin protein (product of the Phatr3J_47296 locus) was used as a query to search all sequence databases (NCBI, Ensembl, JGI) to retrieve the highest number of sequences suitable for phylogenetic analysis. Sequences were processed using the BioEdit Sequence Alignment Editor computer program (Hall 1999). Multiple sequence alignments were performed using the MAFFT (Katoh et al. 2019) tool implemented in NGphylogeny.fr (Lemoine et al. 2019). Phylogenetic analysis was performed in MEGA X using the neighbor-joining method (Saitou and Nei 1987). The best tree with a sum of branch lengths = 48.43171304 is shown. The percentage of replicate trees in which related taxa clustered together in the bootstrap test (5000 replicates) is shown next to the branches. The tree is scaled by substitution at each site. Evolutionary distances were calculated using a JTT matrix-based method (Jones et al. 1992). The rate variation between sites was modeled using a gamma distribution (shape parameter = 2). The analysis involved 52 amino acid sequences, and a total of 1511 positions (including gaps). All ambiguous positions for each sequence pair were removed (pairwise deletion option). The resulting trees were edited in MEGA X.

[0177] 1.3 Structural analysis

[0178] The PtSeipin protein was modeled using AlphaFold (Varadi et al., 2021). ChimeraX software (https: / / www.rbvi.ucsf.edu / chimerax) was used for visualization and analysis of the model. The PESxxN motif was identified using the MEME (Multiple Em for Motif Elicitation) motif discovery online software (https: / / meme-suite.org / meme / tools / meme) using sequences that have been used for phylogenetic analysis as queries. The study parameters were set to detect 10 motifs ranging from 6 to 20 amino acids. The motif containing PESxxN was the first hit.

[0179] 1.4 Microalgae cultivation

[0180] P. tricornutum (ecotype Pt1 strain CCMP2561) cells were cultured in Enhanced Artificial SeaWater (326.7 mM NaCl, 25 mM Na2SO4, 8.03 mM KCl, 0.725 mM KBr, 0.372 mM H3BO3, 0.0657 mM NaF, 47.18 mM MgCl2-6H2O, 9.134 mM CaCl2-2H2O, 0.082 mM SrCl2-6H2O, 8.17 µM Fe-EDTA, 8.3 µM Na2EDTA-2H2O, 0.254 µM ZnSO4-7H2O, 0.0672 µM CoCl2-6H2O, 2.73 µM MnCl2-4H2O, 6.12 nM Na2MoO4-2H2O, 1 nM Na2SeO3, 6.27 nM NiCl2-6H2O, 0.039 nM CuSO4-5H2O, 4.09 nM vitamin B8, 0.738 nM vitamin B12, 0.593 µM vitamin B1) with excess nitrogen and phosphate sources (10N10P: 0.549 mM NaNO3 and 0.022 mM NaH2PO4-H2O). To ensure adequate growth, the culture volume during biomass expansion did not exceed one-fifth of the flask capacity and did not exceed a maximum concentration of 10 million cells.mL -1 Liquid cultures were maintained in an incubator (Infors, HT Multitron Pro) at 20°C with constant stirring (100 rpm) and a 12 / 12 light (75 µmol.photons.m2.s-1) / dark cycle. This culture condition was subsequently referred to as control (CT) condition.

[0181] For phosphate (-P) starvation, cells were harvested from exponential phase CT cultures, centrifuged at 1500 g for 10 min, washed three times, and resuspended in ESAW (10N00P) without NaH2PO4-H2O. For higher light (HL) conditions, the above temperature, agitation, and photoperiod were maintained, but the light intensity was increased to 200 µmol.photons.m 2 .s -1 For all experiments, CT, HL, and –P cultures were cultured at 10 6 cells.mL -1 The initial inoculation concentration of –N culture was 5.10 6 cells.mL -1 The initial inoculum concentration was .

[0182] To assess the cell concentration, the absorbance at 730 nm (A730) was measured using a TECAN infinite M1000 pro microplate reader (TECAN, Austria), and the corresponding concentration was calculated based on the following formula: number of cells = 1.834.10- 08 *A730 + 0.03758 (Conte et al., 2018). For all experiments, each sample (cell line / culture condition) was cultured in triplicate and at each time point considered (days 4 and 8 for HL and –P, days 1 and 2 for –N, and days 1 and 2 or days 4 and 8 for CT), samples were monitored using Nile red staining (9-diethylamino-5-benzo[a]-phenoxazinone in 100% DMSO, Thermo fisher), confocal microscopy, transmission electron microscopy, and lipid content as follows.

[0183] 1.5 Microalgae transformation

[0184] Before transformation, the microalgae were maintained at exponential growth (maximum concentration 3.10 6 cells.mL -1 One day before transformation, 100.10 6 Cells were plated on ESAW 10N10P / 1% agar plates containing 0.237 µM carbenicillin. The plates were placed in a vertical incubator at 20°C with constant light overnight.

[0185] For each transformation, 4-5 µg of plasmid DNA, 50 µl of CaCl2 (2.5 M diluted in ethanol) and 20 µL of spermidine (0.1 M (Sigma-Aldrich)) were sequentially added to 3 mg of tungsten beads M17 (Bio-Rad, Hercules, USA) diluted in 50 µl of glycerol 50% (v / v). The beads were vortexed thoroughly during the whole process and the final mixture was left to incubate at room temperature for 1 min, then washed twice with cold 70% ethanol and resuspended in 50 μl of absolute ethanol. The coated beads were kept under gentle vortexing until use.

[0186] Biolistic transformations were performed with the Bio-Rad Biolistic PDS-1000 / He Particle Delivery System (Bio-Rad) under a laminar flow hood according to the manufacturer's recommendations and using 1550 psi rupture disks. For each transformation with a CRISPR-Cas9 construct, four consecutive shots were performed on the same plate with the plate rotated 90° between each shot. The algae were left in a vertical incubator at 20°C with constant light to recover for three days before being transferred to selective ESAW 10N10P / 1% agar plates containing 0.237 µM carbenicillin and 0.07 µM bleomycin.

[0187] The first colonies start to appear after 4 to 6 weeks. When they are large enough, up to 20 colonies are marked and resuspended in 10 µl ESAW. 5 μl is used for re-plating and 5 μl is reserved for further analysis.

[0188] 1.6 Storage of strains

[0189] For long-term storage, P. tricornutum cells were concentrated at 10 million cells / mL in 15% DMSO and then gradually frozen to -80°C (sequentially, 1 hour at 4°C, 1 hour at -20°C) and stored at -80°C.

[0190] For short-term storage, P. tricornutum cells were maintained on solid medium (ESAW10N10P, 1% agar) containing 0.237 μM carbenicillin alone (wild type: WT) or with 0.07 μM zeocin (all mutant strains).

[0191] 1.7 Screening and purification of transformants

[0192] 1 µl of cells suspended in ESAW was diluted with 9 µl of Phire Dilution Buffer (ThermoFisherScientific) and heated at 95°C for 10 min to promote cell disruption. The first exon of Seipin was then PCR amplified using Phire PlantDirect PCR Master Mix (F160, ThermoFisher Scientific) with primers Seipin-PCR-Fwd and Seipin-PCR-Rev (Table 1). The PCR product was then purified using the Monarch® DNACleanup Kit (NEB) and sent to Macrogen for sequencing using primers Seipinseq-Fwd and Seipinseq-Rev (Table 1). Sequence analysis was performed using Tide (Tracking of Indels by Decomposition v3.3.0; http: / / shinyapps.datacurators.nl / tide / ) and ICE (Inference of CRISPR Edits v2; https: / / ice.synthego.com / # / ) online software). Colonies carrying pure deletions / insertions were kept intact and mosaic colonies containing mutations of interest were further purified. For each mosaic colony, approximately 200 cells were plated on a new selection plate and the algae were left to grow for 4-6 weeks. Up to 20 colonies were then picked and screened using PCR / sequencing / sequence analysis as described above. The same process was repeated until 3 independent colonies were obtained for 2 of the guide RNAs containing 99-100% of the mutation of interest.

[0193] 1.8 Nile red staining

[0194] 2.5 mg.mL -1 Nile Red stock solution (9-diethylamino-5-benzo[a]-phenoxazinone in 100% DMSO, Thermo Fisher) was diluted 1:5 (v / v) into each aliquot of culture.

[0195] Confocal microscopy

[0196] Images of microalgae stained with Nile Red were acquired using a Zeiss LSM880 FastAiryscan confocal microscope equipped with a 63x / 1.4 oil-immersion Plan-Apochromat objective, running Zen 2.3 SP1 acquisition software. Nile Red fluorescence was acquired using Airyscan mode with an argon laser (458, 488, 514 nm) excitation at 514 nm and emission detection between 580 and 640 nm. Brightfield images were acquired by differential interference contrast (DIC) using laser excitation at 488 nm and a photomultiplier tube detector (T-PMT) for transmitted light.

[0197] Harvesting samples for lipid analysis

[0198] Samples for lipid analysis were collected on days 4 and 8. The cultures were centrifuged at 3500 g for 10 minutes. The cell pellets were transferred to low binding Eppendorf tubes while the supernatants were placed in 250 ml glass bottles (Schott, Germany). The cells and supernatants were frozen in liquid nitrogen and stored at -80°C.

[0199] Cellular lipid extraction

[0200] Before lipid extraction, the cell pellet stored at -80°C was freeze-dried overnight (CHRIST Alpha 2-4LSCbasic). The freeze-dried precipitate was transferred to a Corex glass tube and ground, and then 4 mL of boiling ethanol was added to prevent the effect of lipase. Then 2 mL of methanol was added at room temperature (RT) followed by 8 mL of chloroform to extract the lipid phase, and argon bubbling was performed for 1 minute to mix and prevent lipid oxidation. The tube was then covered and left at RT for one hour. Filtering was performed through glass wool to eliminate cell debris, and the filter was rinsed with 3 mL of chloroform methanol (2: 1, v / v). Two phases were initially formed by adding 5 mL of 1% (w / v) NaCl and centrifuging at 2500 g for 10 minutes. The lower organic phase was evaporated at 40°C under argon gas flow. Lipid was resuspended in 1.5 mL of chloroform, transferred to a lysing vessel and chloroform was evaporated under argon. The lipid fraction was stored at -20°C.

[0201] Culture medium lipid extraction

[0202] One volume of chloroform and one volume of methanol are added directly to the frozen supernatant, which is left to thaw at room temperature. Once the samples are completely thawed, they are transferred to a separatory funnel and mixed by argon bubbling for 1 minute. The funnel is then capped and left for about 2 hours to allow phase separation. The lower organic phase is then collected and evaporated under argon. The lipid is resuspended in 3 ml of chloroform, transferred to a lysing tube and chloroform is evaporated again under argon. The lipid fraction is stored at -20 ° C.

[0203] Methanol decomposition and gas chromatography coupled with flame ionization detection (GD-FID)

[0204] Methanolysis was performed using a MultiPurpose Sampler (MPS, Gerstel). The lipid fraction was left at room temperature for 15 minutes before sample preparation. It was then resuspended in 1 mL of chloroform and 50 µL of it was subjected to methanolysis. 5 µg of internal standard C15 standard (SIGMA) was added to each sample. 3 mL of methanolysis medium (methanol: sulfuric acid 40:1, v / v) was added to the sample and then heated at 100°C for 1 hour. This reaction allows fatty acids to be separated from the glycerol backbone and form fatty acid methyl esters (FAMEs). The reaction was terminated by adding 3 mL of water and then 3 mL of hexane was added to extract the FAMEs. The upper phase was collected, evaporated under argon, and the FAME fractions can be stored at -20°C or immediately processed by gas chromatography coupled to flame ionization detection (GC-FID). FAMEs were resuspended in 100 µL of hexane and loaded onto a GC-FID Perkin Elmer Clarus 580 equipped with a 30-m long cyanopropyl polysilphenesiloxane column with a diameter of 0.22 mm and a film thickness of 0.25 µm for GC separation using nitrogen as carrier gas. Identification of FAMEs was achieved by comparing their retention times with those of standards (Sigma-Aldrich). The surface peak method using an internal standard (15:0 FA) allowed quantification of FAME species and determination of glycerolipid concentrations in the initial sample.

[0205] Liquid chromatography coupled to tandem mass spectrometry (LC-MS / MS)

[0206] 25 nmol of total lipids were then used for identification by liquid chromatography coupled to tandem mass spectrometry (LC-MS / MS). Separation by LC was performed using an Agilent 1200 HPLC on a 5 μm diol column with a length of 150 mm and a diameter of 3 mm (Macherey-Nagel, Hoerdt, France). Tandem mass spectrometry analysis was performed on a triple quadrupole 6460 (Agilent, Santa Clara, USA) using a Jetstream electrospray ionization source. Glyceride identification and quantification were done using a MassHunter Workstation (Agilent, Santa Clara, USA) and the amounts were adjusted by comparison with quality control (QC) (Jouhet et al., 2017).

[0207] 2. result

[0208] 2.1 Seipins from diatoms form a distinct phylogenetic group

[0209] Phylogenetic analysis showed that the tree consists of three main clades ( Figure 1 ), a basal clade containing green algae; a second clade containing plant Seipins, split into two subclades (higher plant Seipin 1 / lower plant and higher plant Seipin 2); and a third clade containing stramenopiles, fungi, and animals. The latter clade splits into four subclades: a fully supported clade clustering animals, which is sister to fungal Seipins, with weak support (64%); a clade with several stramenopiles (e.g., Oomycetes, Eusoma, and Phaeophyceae) grouped together; and a fourth highly supported (97%) clade, which is robustly basal (97%) compared to the first three clades, clustering only diatom Seipins. To our knowledge, the present phylogeny is the first to include different kingdoms. It precisely defines the evolutionary origin of stramenopile Seipins from non-photosynthetic hosts in a secondary endosymbiotic event that gave rise to stramenopiles. Diatom Seipin shares no common ancestor with green lineage Seipin, confirming the unique identity of this protein in diatoms.

[0210] 2.2 Seipin shows a high degree of structural conservation, with some unique features of diatoms

[0211] Seipins are transmembrane proteins located in the endoplasmic reticulum (ER) membrane. They adopt a hairpin structure with two transmembrane alpha helices. The cytoplasmic N-terminal and C-terminal domains show little conservation in terms of sequence and structure, and their lengths are very variable. However, despite the generally low sequence conservation of Seipin proteins, the secondary structure of the luminal domain is remarkably conserved ( Figure 2 A), and the same is true for the tertiary structure ( Figure 2 B) A more detailed analysis of the region between the first transmembrane domain and the highly conserved PESxxN motif ( Figure 2 A) reveals a peculiarity of all diatoms, in which there is a long loop (>80 amino acids) containing one or more alpha helices between the first and third beta strands ( Figure 2 B) In the species tested, the length of this loop varies between 84 and 154 amino acids. In contrast, in the land plants tested, the length of the same region ranges from 50 to 75 amino acids; in the fungi and animal kingdoms tested, the length of the same region ranges from 40 to 60 amino acids; and in the Oomycetes and Phaeophyceae, the length of the same region is around 70-75 amino acids. This peculiarity has also been observed in the true eye-spot algae Microchloropsis gaditana and Microchloropsis oceanica, and in the lipogenic yeast Yarrowia lipolytica. But if Figure 2 As shown in D, the amino acids in Euphthalomonas do not have the amino acid pattern 'PHES' after the 5th β strand and the IGKE pattern in the 8th β strand (which are conserved in all diatom sequences), and have a less conserved hydrophobic α helix compared to diatom sequences.

[0212] 2.3 Mutations in P. tricornutum Seipin (PtSeipin) leading to truncated proteins

[0213] PtSeipin mutants were generated using two different guide RNAs and the CRISPR-Cas9 gene editing system. The genomic PtSeipin sequences of mutants ΔPtSeipin1 (SEQ ID NO: 19) and ΔPtSeipin8 (SEQ ID NO: 20) are shown in Figure 3 Shown (incomplete sequence shown).

[0214] Both mutants present a mutation of three nucleotides 5' to the PAM motif, which corresponds to the Cas9 cleavage site. The resulting mutations are an insertion of two nucleotides (TG) for ΔPtSeipin1 and one nucleotide (A) for ΔPtSeipin8.

[0215] Computer translation of the mutant sequences revealed that the sequence mutations resulted in the introduction of premature stop codons and, therefore, truncated, non-functional proteins ΔPtSeipin1 (SEQ ID NO: 21) and ΔPtSeipin8 (SEQ ID NO: 22) ( Figure 4 ).

[0216] 2.4 Seipin knockout mutants of P. tricornutum accumulate more oil

[0217] Surprisingly, in the absence of any stress, loss of PtSeipin resulted in oil accumulation, while changes in cell growth remained very small. This phenotype was enhanced under stress conditions: in particular, mild light stress resulted in extensive oil accumulation with very limited effects on cell growth. We compared two knockout (KO) lines, ΔPtSeipin1 and ΔPtSeipin8, obtained by CRISPR-Cas9 using guide RNAs 1 and 8, respectively.

[0218] 2.5 Oil accumulation under control conditions

[0219] WT and both KO strains were followed for 8 days under control conditions. KO exhibited a slightly slower growth rate compared to WT, but all cell lines maintained growth during this period ( Figure 5 ). The stable phase was reached after about 7 days of culture.

[0220] Lipid droplets were stained with Nile red and visualized by confocal microscopy. We observed lipid droplets in each cell, but at both observation times (day 4 and day 8), the size of lipid droplets increased in both KO lines ( Figure 6 ). In some mutant cells, lipid droplets occupied the entire width of the cell, which was never observed in WT under these growth conditions.

[0221] Glycerolipid content analysis by GC-FID and LC-MS / MS showed that the total amount of lipids per cell was similar between the WT and KO lines ( Figure 7 a). However, the glycerolipid profile was altered, with triacylglycerol (TAG) in the mutant system increasing in quantity ( Figure 7 b) and percentage ( Figure 7 c) had a significant increase in both. These results suggest redirection of metabolic pathways in favor of oil (TAG) production.

[0222] 2.6 Oil accumulation under higher light stress

[0223] To evaluate the effects of high light stress on the mutants, the strains were placed under higher light conditions (200 µmol.photons.m 2 .s -1) for 8 days. Similar to what was observed under control conditions, all strains maintained growth, even though the mutants showed a slight delay ( Figure 8 ).

[0224] Although lipid droplets accumulated in all strains after 4 days of higher light, the size of lipid droplets was greatly increased in the KO line, and LDs occupied a significant portion of the cell volume ( Fig. 9 ). The shape of LDs is affected by the physical constraints of the cells and appears deformed for larger cells. After 8 days, the size and number of LDs decreased in the WT strain, but not in the KO strain.

[0225] Glycerolipid content analysis by GC-FID and LC-MS / MS showed that after 8 days of exposure to higher light, the total amount of lipids per million cells in the ΔPtSeipin8 line was slightly increased compared to the WT ( Fig.10 a). The amount of TAG in both KO lines was greatly increased (up to 16.3-fold) compared with WT ( Fig.10 b), and TAGs in mutant lines can represent up to 60% of total glycerolipids ( Fig.10 c).

[0226] 2.7 Oil accumulation under phosphate starvation stress

[0227] During phosphate starvation stress, cells continue to grow for several days while they remobilize their internal phosphate reserves, then stop growing when these reserves are depleted ( Fig.11 ). Under this condition, there was no significant difference in growth between the WT line and the mutant lines.

[0228] Compared with WT, oil accumulation occurred faster in the mutant system ( Fig.12 ). After 4 days of culture, phosphate deficiency had not yet been fully established in the WT, whereas large lipid droplets had already accumulated in the mutant.

[0229] Glycerolipid content analysis by GC-FID and LC-MS / MS showed that the total amount of lipids in nmol per million cells in the mutants was similar to that in the WT after 4 days of culture in phosphate-reduced medium ( Fig.13 a). However, the number of TAGs was higher in the mutant compared to WT (2- to 3-fold difference) ( Fig.13 b), and TAG represented a higher percentage of total glycerolipids in the mutants, with the mutants reaching up to 40% of total glycerolipids ( Fig.13 c).

[0230] 2.8 Liberation of oil from the culture medium

[0231] During microscopic examination of cell lines cultured under different conditions, we observed lipid droplets floating in the culture medium of the KO cell line. This was true for all conditions but appeared to be enhanced under phosphate starvation conditions ( Fig.14 ).

[0232] To quantify the amount of TAG released into the culture medium, we extracted lipids from the culture medium of all conditions after 15 days of culture and analyzed the glycerolipid content by LC-MS / MS ( Fig.15 This analysis revealed firstly an increase in TAG in the culture medium under stress conditions compared to the control and secondly a dramatic increase in the amount of TAG in the culture medium of the mutant. The most important differences were observed under higher light conditions (up to 11.5-fold increase between WT and mutant ΔPtseipin1) ( Fig.15 b), but TAG release was more significant under phosphate starvation conditions (100-fold change between CT and -P, and up to 5.32-fold increase between WT and mutant ΔPtseipin8) ( Fig.15 c).

[0233] 2.9 Can release lipid droplets without cell destruction

[0234] Thus, it appears that mechanical shear stress induced by pipetting cells for microscopy or by mild centrifugation to pellet cells (2500 g for 10 min) and collect medium (3500 g for 10 min) is sufficient to trigger the release of lipid droplets in the medium. In one case, we were able to observe lipid droplet release from cells during confocal imaging, where the pressure of the objective on the coverslip during z-stack acquisition was sufficient to expel lipid droplets from the cells ( Fig.16 ).

[0235] References

[0236] WO 2012 / 075543

[0237] Bowler, C. et al. (2008) 'The Phaeodactylum genome reveals theevolutionary history of diatom genomes', Nature, 456(7219), pp. 239–244. Available at: https: / / doi.org / 10.1038 / nature07410.

[0238] Cai, Y. et al. (2015) ‘Arabidopsis SEIPIN Proteins ModulateTriacylglycerol Accumulation and Influence Lipid Droplet Proliferation’, ThePlant Cell, 27(9), pp. 2616–2636. Available at: https: / / doi.org / 10.1105 / tpc.15.00588.

[0239] Conte, M. et al. (2018) ‘Screening for Biologically Annotated DrugsThat Trigger Triacylglycerol Accumulation in the Diatom Phaeodactylum’, PlantPhysiology, 177(2), pp. 532–552. Available at: https: / / doi.org / 10.1104 / pp.17.01804.

[0240] Fei, W., Du, X. and Yang, H. (2011) ‘Seipin, adipogenesis and lipiddroplets’, Trends in endocrinology and metabolism: TEM, 22(6), pp. 204–210.Available at: https: / / doi.org / 10.1016 / j.tem.2011.02.004.

[0241] Guéguen, N., Le Moigne, D., Amato, A., Salvaing, J., & Maréchal, E.(2021). Lipid droplets in unicellular photosynthetic stramenopiles. Frontiersin Plant Science, 12, 639276.

[0242] Hu Q, Sommerfeld M, Jarvis E, et al. (2008) Microalgaltriacylglycerols as feedstocks for biofuel production: perspectives andadvances. Plant J. 2008;54(4):621-639. doi:10.1111 / j.1365-313X.2008.03492.

[0243] Jones, D.T., Taylor, W.R. and Thornton, J.M. (1992) ‘The rapidgeneration of mutation data matrices from protein sequences’, Computerapplications in the biosciences: CABIOS, 8(3), pp. 275–282. Available at:https: / / doi.org / 10.1093 / bioinformatics / 8.3.275.

[0244] Jouhet, J. et al. (2017) ‘LC-MS / MS versus TLC plus GC methods:Consistency of glycerolipid and fatty acid profiles in microalgae and higherplant cells and effect of a nitrogen starvation’, PloS One, 12(8), p.e0182423. Available at: https: / / doi.org / 10.1371 / journal.pone.0182423.

[0245] Kang, N.K. et al. (2022) ‘Microalgal metabolic engineering strategiesfor the production of fuels and chemicals’, Bioresource Technology, 345, p.126529. Available at: https: / / doi.org / 10.1016 / j.biortech.2021.126529.

[0246] Katoh, K., Rozewicki, J. and Yamada, K.D. (2019) ‘MAFFT onlineservice: multiple sequence alignment, interactive sequence choice andvisualization’, Briefings in Bioinformatics, 20(4), pp. 1160–1166. Availableat: https: / / doi.org / 10.1093 / bib / bbx108.

[0247] Kowthaman, C.N. et al. (2022) ‘A comprehensive insight frommicroalgae production process to characterization of biofuel for thesustainable energy’, Fuel, 310, p. 122320. Available at: https: / / doi.org / 10.1016 / j.fuel.2021.122320.

[0248] Lu, Y., Wang, X., Balamurugan, S., Yang, W. D., Liu, J. S., Dong, H.P., & Li, H. Y. (2017). Identification of a putative seipin ortholog involvedin lipid accumulation in marine microalga Phaeodactylum tricornutum. Journalof applied phycology, 29, 2821-2829.

[0249] Lee, A.K., Lewis, D.M. and Ashman, P.J. (2012) ‘Disruption ofmicroalgal cells for the extraction of lipids for biofuels: Processes andspecific energy requirements’, Biomass and Bioenergy, 46, pp. 89–101.Available at: https: / / doi.org / 10.1016 / j.biombioe.2012.06.034.

[0250] Lemoine, F. et al. (2019) ‘NGPhylogeny.fr: new generationphylogenetic services for non-specialists’, Nucleic Acids Research, 47(W1),pp. W260–W265. Available at: https: / / doi.org / 10.1093 / nar / gkz303.

[0251] Mann, M. et al. (2017) ‘PtAUREO1a and PtAUREO1b knockout mutants ofthe diatom Phaeodactylum tricornutum are blocked in photoacclimation to bluelight’, Journal of Plant Physiology, 217, pp. 44–48. Available at: https: / / doi.org / 10.1016 / j.jplph.2017.05.020.

[0252] Nymark, M. et al. (2017) ‘CRISPR / Cas9 Gene Editing in the MarineDiatom Phaeodactylum tricornutum’, Bio-Protocol, 7(15), p. e2442. Availableat: https: / / doi.org / 10.21769 / BioProtoc.2442.

[0253] Saitou, N. and Nei, M. (1987) ‘The neighbor-joining method: a newmethod for reconstructing phylogenetic trees’, Molecular Biology andEvolution, 4(4), pp. 406–425. Available at: https: / / doi.org / 10.1093 / oxfordjournals.molbev.a040454.

[0254] Seydoux, C. et al. (2022) ‘Impaired photoprotection in Phaeodactylumtricornutum KEA3 mutants reveals the proton regulatory circuit of diatomslight acclimation’, New Phytologist, 234(2), pp. 578–591. Available at:https: / / doi.org / 10.1111 / nph.18003.

[0255] Slattery, S.S. et al. (2018) ‘An Expanded Plasmid-Based GeneticToolbox Enables Cas9 Genome Editing and Stable Maintenance of SyntheticPathways in Phaeodactylum tricornutum’, ACS Synthetic Biology, 7(2), pp. 328–338. Available at: https: / / doi.org / 10.1021 / acssynbio.7b00191.

[0256] Sui, X. et al. (2018) ‘Cryo-electron microscopy structure of thelipid droplet-formation protein seipin’, The Journal of Cell Biology, 217(12), pp. 4080–4091. Available at: https: / / doi.org / 10.1083 / jcb.201809067.

[0257] Taurino, M. et al. (2018) ‘SEIPIN Proteins Mediate Lipid DropletBiogenesis to Promote Pollen Transmission and Reduce Seed Dormancy’, PlantPhysiology, 176(2), pp. 1531–1546. Available at: https: / / doi.org / 10.1104 / pp.17.01430.

[0258] Varadi, M. et al. (2022) ‘AlphaFold Protein Structure Database:massively expanding the structural coverage of protein-sequence space withhigh-accuracy models’, Nucleic Acids Research, 50(D1), pp. D439–D444.Available at: https: / / doi.org / 10.1093 / nar / gkab1061.

[0259] Yan, R. et al. (2018) ‘Human SEIPIN Binds Anionic Phospholipids’,Developmental Cell, 47(2), pp. 248-256.e4. Available at: https: / / doi.org / 10.1016 / j.devcel.2018.09.010.

[0260] Zoni, V. et al. (2021) ‘Seipin accumulates and traps diacylglycerolsand triglycerides in its ring-like structure’, Proceedings of the NationalAcademy of Sciences of the United States of America, 118(10), p. e2017205118.Available at: https: / / doi.org / 10.1073 / pnas.2017205118.

Claims

1. Engineered unicellular Stramenopile microalgae comprising a loss of function of a homologous Seipin gene.

2. The engineered unicellular stramenopile microalgae according to claim 1, wherein the wild-type homologous Seipin gene encodes an amino acid sequence comprising (i) a long loop between the first and third beta strands of the beta sandwich of the lumenal domain, having a length of at least 80 amino acids, which is located between the end of the first transmembrane domain and the conserved motif PESxxN (or PDSxxN) located at the end of the third beta strand, in particular between amino acid positions P107 and L192 (inclusive) in the Pt Seipin sequence, and advantageously further comprising (ii) a sequence comprising the 7 amino acids before the PESxxN motif and up to the first beta strand (excluding) having a percentage identity of at least 40%, preferably at least 41%, to SEQ ID NO: 23, and / or (iii) a sequence having at least 85% identity to SEQ ID NO: 7, which is located between the fifth and sixth beta strands including an alpha hydrophobic helix, and preferably also having the pattern PHES' (SEQ ID NO: 7) after the fifth beta strand. NO: 8) and / or the pattern 'IGKE' in the 8th beta strand (SEQ ID NO: 9).

3. An engineered unicellular microalgae according to claim 1 or 2, wherein the loss of function of the homologous Seipin gene is obtained by genetic tools for silencing gene expression, in particular, the genetic tools are selected from the group consisting of: mutations, RNA interference, antisense DNA, knockout genes and small molecule inhibitors, preferably mutations of the targeted Seipin gene, in particular by zinc finger nucleases, nucleases, large-range nucleases (MNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPR / Cas9), preferably CRISPR-Cas9 or TALEN systems, more preferably CRISPR-Cas9.

4. The engineered unicellular microalgae according to claim 3, wherein the mutated Seipin gene is obtained by CRISPR-Cas9-mediated gene editing on a targeted coding sequence, in particular by targeting a sequence upstream or downstream of the first transmembrane domain, preferably an upstream sequence.

5. The engineered unicellular microalgae according to claim 4, wherein the mutated Seipin gene is obtained by CRISPR-Cas9-mediated gene editing, wherein the gene editing is by targeting one or two sequences upstream of the first transmembrane domain, in particular one or two sequences having at least 80% identity, 90% identity or 100% identity with two sequences complementary to sgRNA 1 (SEQ ID NO. 24: AGAAGAAGCGCACGCTGCCG) and sgRNA 8 (SEQ ID NO. 25: TTCAATCCATACCGAGAGCA).

6. The engineered unicellular microalgae according to any one of claims 1 to 5, obtained by genetic transformation, in particular selected from the group consisting of biolistic transformation, electroporation and bacterial conjugation, preferably biolistic transformation.

7. The engineered unicellular microalgae according to any one of claims 1 to 6, wherein the stramenopile microalgae is a diatom, such as a diatom selected from the group consisting of Thalassiosira pseudonana, Thalassiosira oceanica, Chaetoceros tenuissimus, Fistulifera solaris, Phaeodactylum tricornutum, Nitzschia inconspicua, Fragilariopsis cylindrus, preferably Phaeodactylum tricornutum (strain CCMP2561), in particular a pennate diatom selected from the group consisting of Fistulifera solaris, Phaeodactylum tricornutum, Nitzschia inconspicua, Fragilariopsis cylindrus, preferably Phaeodactylum tricornutum (strain CCMP2561).

8. The engineered unicellular microalgae according to any one of claims 1 to 7, wherein it comprises a mutated amino acid sequence truncated upstream of the first transmembrane domain, in particular a mutated amino acid sequence having at least 80%, 90% or 100% identity with ΔPtSeipin1 (SEQ ID NO: 21) or a mutated amino acid sequence having at least 80%, 90% or 100% identity with ΔPtSeipin8 (SEQ ID NO: 22).

9. A microalgae culture comprising the engineered unicellular stramenopile microalgae according to any one of claims 1 to 8, preferably the engineered unicellular Phaeodactylum tricornutum (strain CCMP2561).

10. A vector comprising a Cas9 sequence and a single guide sgRNA designed to target a sequence upstream or downstream of the first transmembrane domain, in particular a single guide sRNA 1 (SEQ ID NO. 24: AGAAGAAGCGCACGCTGCCG) or sgRNA 8 (SEQ ID NO. 25: TTCAATCCATACCGAGAGCA).

11. An in vitro method for producing triacylglycerols (TAGs), comprising culturing the engineered microalgae according to any one of claims 1 to 8 or the microalgae culture according to claim 9 in a culture medium to produce TAGs, particularly under normal growth conditions or preferably under stress conditions selected from nutrient starvation and / or light stress conditions, and optionally the method further comprises a step of recovering the TAGs from the engineered microalgae, the culture medium or the whole culture.

12. The in vitro method according to claim 11, wherein the production of TAGs under normal growth conditions is increased to at least 1.1 times, more particularly to 3 to 4 times or more, compared to wild-type microalgae cells of the same type under the same conditions.

13. The in vitro method according to claim 11, wherein the production of TAG under light stress conditions is increased by at least 1.2 times, more particularly by 10 to 15 times or more, compared to wild-type microalgae cells of the same type under the same conditions, particularly when exposed to at least 100 µmol.photons.m 2 .s -1 , in particular at least 150 µmol.photon.m 2 .s -1 and preferably at least 200 µmol.photons.m 2 .s -1 8 days later.

14. The in vitro method according to claim 11, wherein the accumulation of TAG is accelerated under nutrient starvation, in particular phosphate starvation, wherein the accumulation is increased to at least 1.2 times, more particularly to 2 to 3 times or more, compared to wild-type microalgae cells of the same type under the same conditions, in particular in the first few days of cultivation, more particularly in the first 3-4 days.

15. Use of the engineered stramenopile microalgae according to any one of claims 1 to 8, or the microalgae culture according to claim 9, or directly the TAGs produced by the in vitro method according to any one of claims 11 to 14 for biofuel production, in the food industry, in the feed industry, in green chemistry, in the pharmaceutical industry or for cosmetic production, in particular for biofuel production.

Images