Bone regeneration composite material as well as preparation method and application thereof

Abstract

The invention belongs to the field of materials, and particularly discloses a bone regeneration composite material as well as a preparation method and application thereof. The composite material comprises a zeolite imidazate material; the zeolite imidazate material contains a bioactive material; the bioactive material comprises at least one of a nucleic acid drug and a bioactive molecule with a surface modification function. According to the composite material, on one hand, nucleic acid drugs are delivered through the zeolite imidazate material, the delivery stability and the delivery efficiency are improved, various different functions are achieved by loading different nucleic acid drugs, and specific nucleic acid drugs are specifically loaded aiming at the reason of insufficient bone regeneration capacity according to the characteristic that bone microenvironments of different diseases are different; a better bone regeneration and repair effect can be achieved; on the other hand, the zeolite imidazate material has biological activity, and metal ions such as zinc ions can be continuously released after the zeolite imidazate material is taken by cells, so that osteogenic differentiation of the bone marrow mesenchymal stem cells is promoted.

Description

Technical Field

[0001] The invention belongs to the field of materials, and specifically relates to a bone regeneration composite material and a preparation method and application thereof. Background Art

[0002] Bone regeneration and repair is a complex dynamic process that requires not only the osteogenic activity of the bone itself, but also the coordinated cooperation of the bone microenvironment, such as nerves, blood vessels, and immune regulation. Current bone regeneration materials mainly focus on promoting osteogenesis, but lack multifunctional regulation of osteogenesis, angiogenesis, immunity, and other related cells and cytokines in the bone microenvironment. Nucleic acid drugs can specifically target and regulate different functions, and have broad application prospects in bone regeneration and repair. However, nucleic acid molecules are susceptible to nuclease degradation and have low cell delivery efficiency, so suitable nucleic acid delivery carriers are needed to improve delivery efficiency.

[0003] At present, nucleic acid delivery vectors mainly include viral vectors, liposome vectors, polymer vectors, etc., but there are some problems. For example, viral vectors may cause host immune response and viral integration vectors may cause genome mutations; liposome vectors have relatively low delivery efficiency and limited delivery effect; polymer vectors may cause toxic reactions, etc. Nucleic acid drug carriers have poor biocompatibility and targeting, lack precise drug release control mechanisms, etc., and most of them can only play the role of nucleic acid drug delivery, with relatively single functions, which greatly limits their application in the field of bone regeneration. Summary of the invention

[0004] In order to overcome at least one technical problem existing in the above-mentioned prior art, one of the objectives of the present invention is to provide a composite material.

[0005] A second object of the present invention is to provide a method for preparing a composite material.

[0006] The third object of the present invention is to provide the use of the above composite material in the preparation of bone regeneration and repair materials.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] The first aspect of the present invention provides a composite material, comprising a zeolite imidazolate material; the zeolite imidazolate material contains a bioactive material; the bioactive material comprises at least one of a nucleic acid drug and a bioactive molecule with a surface modification function.

[0009] On the one hand, the composite material of the present invention delivers nucleic acid drugs through zeolite imidazolate materials, thereby improving the stability and efficiency of delivery, and plays a variety of different functions by loading different nucleic acid drugs. According to the different characteristics of the bone microenvironment of different diseases, specific nucleic acid drugs are loaded specifically for the reasons of insufficient bone regeneration capacity, which can better play the role of bone regeneration and repair; on the other hand, the zeolite imidazolate material itself has biological activity, and when it is taken up by cells, it will continuously release metal ions, such as zinc ions, thereby promoting the osteogenic differentiation of bone marrow mesenchymal stem cells.

[0010] The bioactive material in the present invention refers to molecules, macromolecules or their complexes that have biological effects.

[0011] In some embodiments of the present invention, the zeolite imidazolate material is a zinc-based zeolite imidazolate material. In some embodiments of the present invention, the zeolite imidazolate material is at least one of ZIF-8 and ZIF-90.

[0012] In some embodiments of the present invention, the nucleic acid drug is selected from at least one of siRNA, miRNA, and plasmid DNA. The zeolite imidazolate material is loaded with nucleic acid drugs, which are suitable for different bone environments according to different nucleic acid drugs, and are more conducive to bone regeneration and bone repair.

[0013] In some embodiments of the present invention, the nucleic acid drug is selected from at least one of siShn3, siSRC, siRANK, miR-126, miR-5106, miR-27, miR-21, miR-26a, and miR-92a.

[0014] In some embodiments of the present invention, the bioactive molecule with surface modification function is selected from at least one of chitosan, adriamycin, polypeptide, protein, polysaccharide and collagen. Loading the bioactive molecule with surface modification function on the zeolite imidazolate material can further improve the biocompatibility of the composite material.

[0015] In some embodiments of the present invention, each 1 mg of the composite material contains 10-40 μg of nucleic acid drug. In some embodiments of the present invention, the composite material is a bone regeneration material.

[0016] The second aspect of the present invention provides a method for preparing the composite material according to the first aspect of the present invention, comprising the following steps:

[0017] The zeolite imidazolate material or the raw material for synthesizing the zeolite imidazolate material is mixed with a biologically active material for reaction to obtain the product.

[0018] In some embodiments of the present invention, the raw materials for synthesizing zeolite imidazolate materials include imidazole derivative ligands and metal salts.

[0019] In some embodiments of the present invention, the metal salt is selected from at least one of zinc nitrate hexahydrate and zinc nitrate.

[0020] In some embodiments of the present invention, the imidazole derivative ligand is selected from 2-methylimidazole or imidazole-2-carboxaldehyde.

[0021] In some embodiments of the present invention, the molar ratio of the metal salt to the imidazole derivative ligand is 1:(1.5-4).

[0022] The third aspect of the present invention provides use of the composite material described in the first aspect of the present invention in preparing a bone regeneration and repair material.

[0023] The beneficial effects of the present invention are as follows: the composite material in the present invention is a bioactive material loaded on a zeolite imidazolate material, and the nucleic acid drug in the bioactive material is delivered by the zeolite imidazolate material. The zeolite imidazolate material nanoparticles have low cytotoxicity, good biosafety, and can improve the stability of delivery and the efficiency of delivery. It can play a variety of different functions by loading different bioactive materials. According to the different characteristics of the bone microenvironment of different diseases, specific bioactive materials are loaded specifically for the reasons of insufficient bone regeneration capacity, which can better play the role of bone regeneration and repair. In addition, the zeolite imidazolate material itself has biological activity, and when it is taken up by cells, it will continuously release metal ions, such as zinc ions, thereby promoting the osteogenic differentiation of bone marrow mesenchymal stem cells.

[0024] The preparation method of the present invention has a wide range of raw material sources and low cost, and can be prepared in a one-pot process, or by first synthesizing the zeolite imidazolate nanomaterial and then adsorbing the nucleic acid drug in the bioactive material on its surface, thereby realizing rapid and efficient synthesis of the composite material. The preparation method is simple to operate, has no requirements on equipment, and is suitable for mass industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Schematic diagram of the preparation process of bone regeneration materials in Examples 1 to 4.

[0026] Figure 2 TEM images of ZIF-8 nanoparticles and miR-126@ZIF-8 in Example 2.

[0027] Figure 3 This is the EDS image of ZIF-8 nanoparticles in the embodiment of the present invention.

[0028] Figure 4 This is the EDS image of miR-126@ZIF-8 in Example 2.

[0029] Figure 5 This is a graph showing the cytotoxicity test of miR-126@ZIF-8 on umbilical vein endothelial cells in Example 2.

[0030] Figure 6 This is a graph showing the cytotoxicity test of miR-126@ZIF-8 on bone marrow mesenchymal stem cells in Example 2.

[0031] Figure 7 This is a graph showing the in vitro osteogenic activity test of miR-126@ZIF-8 in Example 2.

[0032] Figure 8 This is a graph showing the in vitro tubulation activity test of miR-126@ZIF-8 in Example 2.

[0033] Fig. 9 This is the loading rate test diagram of miR-126@ZIF-8 in Example 2.

[0034] Fig.10 This is the release curve test diagram of miR-126@ZIF-8 in Example 2.

[0035] Fig.11 This is a test diagram of miR-126@ZIF-8 being taken up by cells in Example 2. DETAILED DESCRIPTION

[0036] The specific implementation of the present invention is further described in detail below in conjunction with the accompanying drawings and examples, but the implementation and protection of the present invention are not limited thereto. It should be noted that if there are processes that are not particularly described in detail below, they can be implemented or understood by those skilled in the art with reference to the prior art. The reagents or instruments used that do not indicate the manufacturer are all conventional products that can be purchased commercially.

[0037] In some embodiments of the present invention, the present invention provides a composite material, including a zeolite imidazolate material; the zeolite imidazolate material contains a bioactive material; the bioactive material includes at least one of a nucleic acid drug and a bioactive molecule with a surface modification function.

[0038] In some embodiments of the present invention, the present invention provides a composite material, including a zeolite imidazolate material; the zeolite imidazolate material contains a bioactive material; and the bioactive material is a nucleic acid drug.

[0039] In some embodiments of the present invention, the present invention provides a composite material, including a zeolite imidazolate material; the zeolite imidazolate material contains a bioactive material; the bioactive material is a bioactive molecule with a surface modification function.

[0040] In some embodiments of the present invention, the present invention provides a composite material, including a zeolite imidazolate material; the zeolite imidazolate material contains a bioactive material; the bioactive material is a nucleic acid drug and a bioactive molecule with a surface modification function.

[0041] In some embodiments of the present invention, the zeolite imidazolate material is a zinc-based zeolite imidazolate material. In some embodiments of the present invention, the zeolite imidazolate material includes at least one of ZIF-8 and ZIF-90. The zinc-based zeolite imidazolate material in the present invention has the characteristics of MOF materials, can not only be used as a nanocarrier of nucleic acid drugs to deliver nucleic acid drugs, realize the function of nucleic acid itself, can also degrade to produce zinc ions under a specific environment, has the effect of promoting bone regeneration, and can also be further functionalized on the surface of the zinc-based zeolite imidazolate material, so that the zinc-based zeolite imidazolate material contains bioactive molecules with surface modification function, and then realizes gene delivery, osteogenic activity, targeting and other functions at the same time, is a promising bone repair regeneration nanomaterial. In addition, the zinc-based zeolite imidazolate material used in the present invention has the characteristics of easy synthesis, low cytotoxicity, high delivery efficiency, and the released nucleic acid drug can play a targeted regulation of angiogenesis, osteogenesis, immunity and other functions in bone regeneration.

[0042] In some embodiments of the present invention, the nucleic acid drug is selected from at least one of siRNA, miRNA, and plasmid DNA.

[0043] In some embodiments of the present invention, the nucleic acid drug is selected from at least one of siShn3, siSRC, siRANK, miR-126, miR-5106, miR-27, miR-21, miR-26a, and miR-92a.

[0044] In some embodiments of the present invention, the bioactive molecule with surface modification function is selected from at least one of chitosan, doxorubicin, polypeptide, protein, polysaccharide, and collagen. The present invention uses bioactive molecules with surface modification function such as chitosan and doxorubicin to modify the surface of zeolite imidazolate nanomaterials, which can improve the biocompatibility and targeting of bone regeneration materials. The bioactive molecules with surface modification function in the present invention can modify the aldehyde groups, metal ions, etc. on the surface of the zeolite imidazolate material through Schiff base, coordination bond, positive and negative charges, etc.

[0045] In some embodiments of the present invention, each 1 mg of the composite material contains 10 to 40 μg of nucleic acid drugs. In some embodiments of the present invention, the mass of the nucleic acid drug contained in each 1 mg of the composite material can be 10 μg, 12 μg, 14 μg, 16 μg, 18 μg, 20 μg, 22 μg, 24 μg, 26 μg, 28 μg, 30 μg, 32 μg, 34 μg, 36 μg, 38 μg, 40 μg, or any range formed by any two of them. The present invention is mainly aimed at the problem of clinical difficulty in bone tissue regeneration. By loading nucleic acid drugs on zeolite imidazolate materials and adjusting the types of loaded nucleic acid drugs, it can more effectively play a variety of roles including regulating immunity, promoting angiogenesis, promoting neurogenesis, and promoting bone regeneration in different diseases. In addition, the zeolite imidazolate material in the present invention is a type of crystalline material composed of metal ions or metal clusters and organic ligands, which has the characteristics of high porosity, high specific surface area, adjustable pore size, selective chemical stability and responsiveness to specific stimuli. It is also low in price, simple in synthesis procedure and low in cytotoxicity, and shows good application prospects in nucleic acid drug delivery.

[0046] In some embodiments of the present invention, the present invention also provides a method for preparing the above composite material, comprising the following steps:

[0047] The zeolite imidazolate material is mixed with a biologically active material to react and obtain the product.

[0048] In some embodiments of the present invention, the present invention also provides a method for preparing the above composite material, comprising the following steps:

[0049] The raw materials for synthesizing zeolite imidazolate materials are mixed with biologically active materials for reaction to obtain the zeolite imidazolate materials. The method can realize one-pot preparation of zeolite imidazolate materials loaded with biologically active materials. The preparation method is simple, fast, has few steps, and improves the preparation efficiency.

[0050] In some embodiments of the present invention, the present invention also provides a method for preparing the above composite material, comprising the following steps:

[0051] The zeolite imidazolate material or a raw material for synthesizing the zeolite imidazolate material, a nucleic acid drug and a solvent are mixed and reacted to obtain the product.

[0052] In some embodiments of the present invention, the solvent is selected from at least one of methanol, ethanol and water.

[0053] In some embodiments of the present invention, the raw materials for synthesizing zeolite imidazolate materials include imidazole derivative ligands and metal salts.

[0054] In some embodiments of the present invention, the metal salt is selected from at least one of zinc nitrate hexahydrate and zinc nitrate.

[0055] In some embodiments of the present invention, the imidazole derivative ligand is selected from 2-methylimidazole or imidazole-2-carboxaldehyde.

[0056] In some embodiments of the present invention, the molar ratio of the metal salt to the imidazole derivative ligand is 1:(1.5-4). In some embodiments of the present invention, the molar ratio of the metal salt to the imidazole derivative ligand can be any value of 1:1.5, 1:1.7, 1:1.9, 1:2, 1:2.2, 1:2.4, 1:2.6, 1:2.8, 1:3, 1:3.2, 1:3.4, 1:3.6, 1:3.8, 1:4 or a range formed by any two of them.

[0057] The specific implementation of the present invention is further described in detail below in conjunction with specific embodiments:

[0058] The bone regeneration material in the present invention can be prepared by a one-pot method or a surface adsorption method. If the one-pot method is adopted, the raw material for preparing the zeolite imidazolate nanomaterial needs to be mixed with nucleic acid, so as to obtain the zeolite imidazolate nanomaterial loaded with nucleic acid in one step; if the surface adsorption method is adopted, the zeolite imidazolate nanomaterial needs to be prepared first, and then the zeolite imidazolate nanomaterial is mixed with nucleic acid, so that the nucleic acid is adsorbed and loaded on the zeolite imidazolate nanomaterial. The zeolite imidazolate nanomaterial in the present invention can be synthesized using an aqueous phase or an organic phase as a solvent. The ZIF-8 nanoparticles and ZIF-90 nanoparticles used in the embodiments of the present invention can be prepared by the following preparation method, as follows:

[0059] (1) Synthesis of ZIF-8 nanoparticles (organic phase):

[0060] 0.4 g zinc nitrate hexahydrate was dissolved in 0.8 mL methanol, and then 10 mL (24.36 mmol) of 2-methylimidazole was added. After stirring for 15 min, the product was collected by centrifugation, washed three times with a mixture of ethanol and water, and dried in vacuum at 51° C. to obtain ZIF-8 nanoparticles.

[0061] (2) Synthesis of ZIF-8 nanoparticles (aqueous phase):

[0062] 0.372 g of zinc nitrate hexahydrate was dissolved in 5 mL of deionized water, and then a mixed solution containing dimethylimidazole (6.15 g) and deionized water (45 mL) was added dropwise to the above solution. After gentle stirring for 60 minutes, the product was collected by centrifugation, washed four times with ethanol to remove excess reactants, and dried to obtain ZIF-8 nanoparticles.

[0063] (3) Synthesis of ZIF-90 nanoparticles:

[0064] Zinc nitrate (371.25 mg) was dissolved in 20 mL of tert-butanol solution (tert-butanol: water = 1:1) under stirring and placed in a separate sample bottle to obtain a solution containing zinc nitrate; imidazole-2-carboxaldehyde (480 mg) and polyvinylpyrrolidone PVP (50 mg) were added to a water and glycerol solution (glycerol ratio 25%, 20 mL), and stirred until completely dissolved to obtain an aqueous solution containing imidazole-2-carboxaldehyde and PVP.

[0065] Then, under vigorous stirring and ultrasonic conditions, the solution containing zinc nitrate was added to the aqueous solution containing imidazole-2-carboxaldehyde and PVP, and a white precipitate was formed in about 5 minutes; after washing three times with methanol, the product was collected by centrifugation and dried to obtain ZIF-90 nanoparticles.

[0066] Example 1

[0067] This example provides a bone regeneration material, which includes ZIF-90 nanoparticles and siShn3; siShn3 is loaded on the ZIF-90 nanoparticles. siShn3 can inhibit the activity of Shn3. SiShn3 promotes osteoclast activity by promoting osteoblasts to express receptor activator of nuclear factor κB ligand (RANKL), and can also inhibit the production of angiogenic factor slit guidance ligand 3 (SLIT3) and reduce the formation of H-type blood vessels.

[0068] The bone regeneration material in this example is prepared by a preparation method comprising the following steps:

[0069] siShn3, whose nucleotide sequence is: GCAAAGAGACAUAUACCAUTT (SEQ ID NO: 1), was dissolved in DEPC water (i.e., ultrapure water (primary water) treated with DEPC (diethyl pyrocarbonate) and sterilized by high temperature and high pressure), and then 160 μL of siShn3 solution (concentration of 132 μg / mL) was dispersed in 60 μL, 5 mg / mL ZIF-90 nanoparticles, and the mixture was shaken on a shaker at 500 rpm for 30 min, and the siShn3-loaded ZIF-90 nanoparticles were collected by centrifugation.

[0070] Example 2

[0071] This example provides a bone regeneration material, which includes ZIF-8 nanoparticles and miR-126, wherein the nucleotide sequence of miR-126 is: CAUUAUUACUUUUGGUACGCG (SEQ ID NO: 2); miR-126 is loaded on the ZIF-8 nanoparticles. MiR-126 is an angiogenesis-related miRNA that can promote angiogenesis.

[0072] The bone regeneration material in this example is prepared by a preparation method comprising the following steps:

[0073] Dissolve 0.4 g of zinc nitrate hexahydrate in 0.8 mL of methanol to obtain a zinc nitrate solution; then add 4 mL of miR-126 stock solution (concentration 66 μg / mL, solvent DEPC water) to the zinc nitrate solution. After stirring for 5 minutes, add 10 mL of 2-methylimidazole (30 mmol) solution dropwise. After stirring for 15 minutes, centrifuge to collect the product and supernatant, wash 3 times with a mixture of ethanol and water, and dry to obtain the bone regeneration material in this example, recorded as miR-126@ZIF-8.

[0074] Example 3

[0075] This example provides a composite material, which includes chitosan and ZIF-90 nanoparticles; the ZIF-90 nanoparticles are modified with chitosan.

[0076] The composite material in this example is prepared by a preparation method comprising the following steps:

[0077] Imidazole-2-carboxaldehyde (96 mg, 1 mmol) was dissolved in 5 mL of methanol and 0.1 mL of triethylamine. Zinc nitrate (147 mg, 0.5 mmol) was dissolved in 5 mL of methanol. The resulting mixed liquid was stirred at 70°C for 20 min, then added with 1 mL of NaOH (5 mol / L) and 1 mL of chitosan solution (1% by mass), and stirred at room temperature for 12 h. The mixture was washed with anhydrous ethanol three times and then vacuum dried to obtain the composite material in this example.

[0078] Example 4

[0079] This example provides a bone regeneration material, including ZIF-90 nanoparticles, doxorubicin and miR-5106, wherein the nucleotide sequence of miR-5106 is AGGUCUGUAGCUCAGUUGGCAGA (SEQ ID NO: 3); miR-5106 is loaded on ZIF-90 nanoparticles; and doxorubicin is modified on ZIF-90 nanoparticles.

[0080] The bone regeneration material in this example is prepared by a preparation method comprising the following steps:

[0081] (1) preparing ZIF-90 nanoparticles loaded with miR-5106 according to the preparation method described in Example 1;

[0082] (2) Add doxorubicin (0.058 g, 0.1 mmol) to 25 mL of methanol and stir until completely dissolved. Then add 0.02 g of the ZIF-90 nanoparticles loaded with miR-5106 prepared in step (1), mix, and further stir the solution at room temperature for 48 h, centrifuge the particles (10000 rpm, 10 min), and wash with excess methanol until colorless to obtain miR-5106@ZIF-90-DOX. The obtained miR-5106@ZIF-90-DOX sample is further exchanged with methanol for 48 h, and the residual DOX is removed without reaction, and then vacuum dried at room temperature for 12 h to obtain the bone regeneration material in this example, which is recorded as.

[0083] The bone regeneration material in this case can target bone defects caused by osteosarcoma surgery, achieve targeted killing of osteosarcoma cells while promoting bone regeneration.

[0084] The schematic diagram of the preparation process of the bone regeneration material in Examples 1 to 4 of the present invention is as follows Figure 1 shown.

[0085] Performance Test:

[0086] TEM, XRD, EDS, etc. were used to characterize the ZIF-8 nanoparticles and miR-126@ZIF-8 in Example 2. Figures 2 to 4 As shown, Figure 2 (a) and Figure 2 (b) TEM images of ZIF-8 nanoparticles and miR-126@ZIF-8 in Example 2, respectively; Figure 3 and Figure 4 They are the EDS images of ZIF-8 nanoparticles and miR-126@ZIF-8 in Example 2. The test results show that the ZIF-8 nanoparticles present a rhombic dodecahedron structure, are uniform in size, and have a particle size of about 120 nm. The XRD peak graph is consistent with the standard card. The P element appears in the EDS graph of miR-126@ZIF-8, and its particle size is larger than that of ZIF-8 nanoparticles, and the particle size is about 170 nm.

[0087] Umbilical vein endothelial cells (HUVEC) and bone marrow mesenchymal stem cells (BMSC) were treated with miR-126@ZIF-8 in Example 2 at different concentrations (0 μg / mL, 10 μg / mL, 20 μg / mL, 40 μg / mL, and 80 μg / mL, respectively), and cultured normally for 1 day, 2 days, and 3 days. CCK8 was used to characterize cell proliferation, and cells were stained with calcein. Cell conditions were observed under a fluorescence microscope, and OD values ​​were recorded. The specific test results are as follows: Figure 5 and Figure 6 As shown. Figure 5 and Figure 6 It can be seen that the results show that the miR-126@ZIF-8 in Example 2 has little cytotoxicity when the concentration is below 80 μg / mL, and the miR-126@ZIF-8 nanoparticles can promote the proliferation of umbilical vein endothelial cells.

[0088] Normal bone marrow mesenchymal stem cells were seeded on a 12-well plate and cultured for 3 days. Blank osteogenic induction solution (i.e., without ZIF-8 nanoparticles and miR-126@ZIF-8, as a control group), ZIF-8 nanoparticles, and osteogenic induction solution of miR-126@ZIF-8 in Example 2 were added respectively. After 7 days of osteogenic induction, the cells were fixed with 10% neutral formalin, stained with an alkaline phosphatase colorimetric kit for 30 minutes, and then observed under a microscope. The specific test results are shown in the figure. Figure 7 As shown. Figure 7 It can be seen that the colors of the two groups with the addition of ZIF-8 and miR-126@ZIF-8 are darker than the control group, indicating that ZIF-8 has the effect of promoting osteogenesis, and loading miR-126 does not affect the osteogenesis-promoting performance of ZIF-8.

[0089] Human umbilical vein endothelial cells were resuspended with ZIF-8 nanoparticles and miR-126@ZIF-8 in Example 2 and inoculated on matrix gel. After culturing for 6 hours, the cells were stained with calcein and observed under a fluorescence microscope. Human umbilical vein endothelial cells were directly resuspended and inoculated on matrix gel. After culturing for 6 hours, the cells were stained with calcein and observed under a fluorescence microscope as a control group. The results measured according to the above test method are as follows: Figure 8 As shown. Figure 8 It can be seen that miR-126@ZIF-8 can improve the tube-forming effect of human umbilical vein endothelial cells.

[0090] The concentration of unloaded miR-126 in the supernatant collected after centrifugation in Example 2 was measured using a NanoDrop spectrophotometer (Thermo Scientific, NanoDrop One, USA), and the loading capacity of miR-126 in miR-126@ZIF-8 was calculated using the following formula:

[0091] Loading amount = (loaded miR-126 weight) / (miR-126@ZIF-8 nanoparticle weight)×100%.

[0092] 2 mg of miR-126@ZIF-8 was dispersed in PBS solution, and then the concentration of miR-126 released in the solution was measured. The formula for calculating the percentage of miR-126 release is:

[0093] Release percentage (%) = (released miR-126 weight) / (total weight of loaded miR-126)

[0094] The miR-126@ZIF-8 nanoparticles in Example 2 were tested for miR-126. The specific test results are as follows: Fig. 9 As shown, the release rate of miR-126@ZIF-8 nanoparticles in PBS solution with a pH of 7.4 was tested. The specific test results are shown in Fig.10 As shown. By Nanodrop Fig. 9 and Fig.10 It can be seen that the miR-126@ZIF-8 nanoparticles in Example 2 can achieve efficient loading of miRNA (loading rate is about 37%, and a loading amount of about 1 mg of miR-126@ZIF-8 nanoparticles contains 15 μg of miR-126) and slow release (about 10% released in 7 hours), and have a higher nucleic acid drug loading capacity and a better sustained release effect.

[0095] hBMSCs and HUVECs were inoculated into glass culture dishes and cultured for 12 hours, then rinsed with PBS and treated with cy5-labeled miR-126@ZIF-8. After 12 hours of culture, the cells were fixed with 4% paraformaldehyde for 30 minutes and then rinsed with PBS. The cell nuclei were stained with DAPI for 5 minutes and the cells were observed under a confocal microscope. Then, the test graph of miR-126@ZIF-8 nanoparticles in Example 2 being taken up by BMSC cells and HUVEC cells was tested, as shown in the figure below. Fig.11 As shown. Fig.11 It can be seen that miR-126@ZIF-8 nanoparticles can be taken up by BMSC cells and HUVEC cells, achieving effective delivery of miRNA.

[0096] In summary, the nanoparticles of the bone regeneration material prepared by the present invention have low cytotoxicity, good biosafety, and can improve the stability of the delivered nucleic acid, improve the efficiency of the delivered nucleic acid, and can play a variety of different functions by loading different nucleic acids (siRNA, miRNA, DNA, etc.), according to the different characteristics of the bone microenvironment of different diseases, specifically targeting the reasons for insufficient bone regeneration ability to load specific nucleic acid drugs, can better play the role of bone regeneration and repair. In addition, the present invention uses chitosan, doxorubicin, etc. to surface modify the aldehyde groups on the zeolite imidazole ester nanomaterials, which can improve the biocompatibility and targeting of bone regeneration materials.

[0097] The preparation method of the present invention has a wide range of raw materials and low cost. It can be prepared in a one-pot process, or by first synthesizing zeolite imidazolate nanomaterials and then adsorbing nucleic acid drugs on their surfaces, thereby achieving rapid and efficient synthesis of bone regeneration materials. The preparation method is simple to operate, has no requirements on equipment, and is suitable for mass industrial production.

[0098] The above is a detailed description of the embodiments of the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A composite material, characterized in that: The invention comprises a zeolite imidazolate material; the zeolite imidazolate material contains a bioactive material; the bioactive material comprises at least one of a nucleic acid drug and a bioactive molecule with a surface modification function.

2. The composite material according to claim 1, characterized in that: The zeolite imidazolate material is at least one of ZIF-8 and ZIF-90.

3. The composite material according to claim 1, characterized in that: The nucleic acid drug is selected from at least one of siRNA, miRNA, and plasmid DNA.

4. The composite material according to claim 3, characterized in that: The nucleic acid drug is selected from at least one of siShn3, siSRC, siRANK, miR-126, miR-5106, miR-27, miR-21, miR-26a, and miR-92a.

5. The composite material according to claim 1, characterized in that: The bioactive molecule with surface modification function is selected from at least one of chitosan, adriamycin, polypeptide, protein, polysaccharide and collagen.

6. The composite material according to claim 1, characterized in that: Every 1 mg of the composite material contains 10 to 40 μg of nucleic acid drug.

7. The method for preparing the composite material according to any one of claims 1 to 6, characterized in that: The following steps are involved: The zeolite imidazolate material or the raw material for synthesizing the zeolite imidazolate material is mixed with a biologically active material for reaction to obtain the product.

8. The method for preparing a composite material according to claim 7, characterized in that: The raw materials for synthesizing the zeolite imidazole ester material include imidazole derivative ligands and metal salts.

9. The method for preparing a composite material according to claim 8, characterized in that: The metal salt is selected from at least one of zinc nitrate hexahydrate and zinc nitrate; and / or, the imidazole derivative ligand is selected from 2-methylimidazole or imidazole-2-carboxaldehyde; And / or, the molar ratio of the metal salt to the imidazole derivative ligand is 1:(1.5-4).

10. Use of the composite material according to any one of claims 1 to 6 in the preparation of bone regeneration and repair materials.

Images