Auricularia plicata strain and cultivation and domestication method thereof

Abstract

The invention discloses an auricularia plicata strain and a cultivation and domestication method thereof, and particularly relates to an auricularia plicata strain W-24 (Jiangxi No.1) and a cultivation and domestication method thereof, the auricularia plicata strain W-24 is preserved in China General Microbiological Culture Collection Center on June 11, 2024; the preservation number is CGMCC (China General Microbiological Culture Collection Center) The cultivation method comprises the following steps: firstly, activating auricularia plicata strains on a PDA (potato dextrose agar) comprehensive culture medium, inoculating the auricularia plicata strains into a solid culture medium, and culturing at 24-26 DEG C for 30-35 days to obtain solid stock seeds; the solid stock seeds are inoculated into cultivation bags, the inoculation amount is 10-15 g / bag, the cultivation bags are sealed, the cultivation bags are placed in a cultivation room to be cultivated in a dark place at the constant temperature of 24-26 DEG C, after cultivation is carried out for 80-85 days, hyphae grow all over the fungus bags, and fruiting management is carried out; the auricularia plicata strain W-24 provided by the invention has the characteristics of short cultivation period, high yield, strong stress resistance and the like, and has a wide market prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of edible fungus cultivation, and relates to a Auricularia auricula strain and a cultivation and domestication method thereof, in particular to a Auricularia auricula strain CGMCC No.41332 and a cultivation and domestication method thereof. Background Art

[0002] Auricularia delicata is a rare edible and medicinal fungus belonging to the phylum Basidiomycetes, class Agaricales, family Auricularia, genus Auricularia. Its Chinese aliases include crispy fungus, wrinkled fungus, coarse fungus, tripe fungus, sand fungus, and plain tripe fungus. Auricularia delicata includes two species, A. sinodelicata and Auricularia lateralis. A. sinodelicata is widely distributed, but there are few studies on its biological characteristics, domestication and cultivation, and nutritional value in China.

[0003] At present, with the vigorous development of the edible fungus industry, Auricularia auricula has been widely cultivated, creating great economic and social value. Summary of the invention

[0004] In view of the problem that the prior art lacks research on the biological characteristics, domestication and cultivation, and nutritional value of Auricularia auricula, the present invention provides an Auricularia auricula strain and a cultivation and domestication method thereof.

[0005] The purpose of the present invention is achieved through the following technical solutions:

[0006] The first object of the present invention is to provide a wrinkled wood ear strain W-24, named "Gan wrinkled ear 1".

[0007] A wrinkled wood ear, specifically a wrinkled wood ear strain W-24, named "Gan wrinkled ear No. 1", Auricularia delicata, deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, with a deposit date of June 11, 2024, a deposit number of CGMCC No.41332, and a deposit address: Chaoyang, Beijing.

[0008] The second object of the present invention is to provide a cultivation method of Ganzhuanger No. 1.

[0009] The cultivation method of Gan Zhuang'er No. 1 is also a cultivation and domestication method of the Auricularia auricula "Gan Zhuang'er No. 1" strain, comprising the following steps:

[0010] S1. Method for obtaining pure culture of strains:

[0011] The samples of Auricularia auriculariae strain W-24 collected in the wild were separated by tissue, cultured on Martin's agar medium to isolate pure culture, and then transferred to PDA comprehensive medium to observe its mycelial structure until its pure culture was obtained.

[0012] S2. Cultivated seeds preparation:

[0013] S2-1, solid stock: The Auricularia auricula strain W-24 activated on the PDA comprehensive medium was inoculated into the solid cultivation matrix medium, and cultured at 24°C-26°C for 30-35 days to obtain the solid stock;

[0014] S2-2, Cultivated seeds: Inoculate solid original seeds into solid cultivation substrate bags at an inoculation rate of 10g / bag to 15g / bag, seal the bags, and place them in a culture room at a constant temperature of 24°C to 26°C in the dark. After 80 to 85 days of cultivation, the mycelium will fill the bags and fruiting management can be carried out;

[0015] S3. Mushroom production management:

[0016] Open the bag with a scalpel one week after the mycelium fills the bag. Disinfect with alcohol before opening the bag and burn with the outer flame of an alcohol lamp. Score a "V" on the bag after cooling to room temperature. Place it at 22℃-26℃ for one day, then transfer it to the fruiting room. Control the temperature at 23℃-28℃ and the humidity at 85%-95%. Spray water in mist form. Stop spraying water when the ear pieces are fully unfolded. Harvest after one day.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] 1. The wrinkled wood ear strain described in the present invention is a strain obtained by collecting, identifying and separating pure strains of wild mushroom resources. After growth characteristic determination and domestication and cultivation experiments, the mycelium grows fast and vigorously, the fruiting body has obvious wrinkles and forms a grid, the colloid is thick, the single flower is heavy, and the texture is crisp.

[0019] 2. The Auricularia auricula strain and the cultivation and domestication method thereof described in the present invention have a short cultivation cycle (the entire cultivation cycle is about 110 days) and strong adaptability to cultivation with substitute materials in different regions; the ears grow evenly, the flower shape is complete and the yield is high, the biological efficiency is 85%, the ears grow evenly and the fruiting body traits are consistent; by using different raw materials, different periods and different cultivation modes, the ears grow and the yield are stable, the resistance to stress is strong, and the market prospect is broad. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a picture of the pure culture of the strain in Example 1 of the present invention (June 2022);

[0021] Figure 2 This is a diagram showing the mushroom cultivation conditions in Example 1 of the present invention;

[0022] Figure 3 This is a diagram showing the mushroom cultivation conditions in Example 1 of the present invention;

[0023] Figure 4 A picture of the wrinkled fungus in Example 1 of the present invention (Guposhan Forest Park, Hezhou City, Guangxi, June 2022);

[0024] Figure 5 A picture of the wrinkled fungus in Example 1 of the present invention (Guposhan Forest Park, Hezhou City, Guangxi, June 2022);

[0025] Figure 6 A picture of the wrinkled fungus in Example 1 of the present invention (Guposhan Forest Park, Hezhou City, Guangxi, June 2022);

[0026] Figure 7 is a diagram of the morphological characteristics of the fruiting body in Example 2 of the present invention;

[0027] Figure 8 This is the phylogenetic tree of mycelium and fruiting body of Auricularia auricularia strain W-24. DETAILED DESCRIPTION

[0028] The specific implementation modes of the present invention are further described below in conjunction with examples.

[0029] Embodiment 1:

[0030] Obtaining the Auricularia auricula strain W-24:

[0031] The wild Auricularia auricula collected from Guposhan Forest Park in Hezhou City, Guangxi Province in June 2022 was isolated and domesticated for cultivation;

[0032] Figure 4 , Figure 5 , Figure 6 All of them are pictures of the wrinkled fungus in Example 1;

[0033] After removing impurities from the surface of the ear pieces, the collected fresh wild fruiting bodies of Auricularia auricula were placed on a clean bench, soaked in 75% (v / v) alcohol for 3 minutes, taken out, rinsed with sterile water, and the internal tissue of the fruiting bodies was picked out with tweezers, inoculated into Martin's agar medium, and placed in a 26°C incubator for dark culture for 2-3 days. The mycelia with white mycelia and good growth were selected and inoculated into PDA medium. Figure 1 The figure is a picture of the pure culture of the strain in Example 1. A fungus bag was made to cultivate the ears; after the ears grew, the fruiting body tissue with better fruiting body traits was selected to separate the strains; through repeated cultivation and fruiting breeding, a wrinkled fungus strain W-24 with stable cultivation traits was finally obtained, named "Gan wrinkled ear 1". Figure 2 is a diagram showing the mushroom cultivation conditions in Example 1, and Figure 3 This is a diagram showing the mushroom cultivation conditions in Example 1.

[0034] Embodiment 2:

[0035] Morphology and molecular identification of Auricularia auriculariae strain W-24:

[0036] 1. Morphological identification:

[0037] The morphological characteristics of Auricularia auriculariae strain W-24 are as follows: Figure 7 Figure 2 is a diagram of the morphological characteristics of the fruiting body in Example 2:

[0038] The fruiting body is 3cm-8cm in diameter, 2cm-5.5cm in width, 1mm-3mm in thickness, growing in groups or imbricately, nearly round and ear-shaped, colloid when fresh, with yellow-brown to red-brown cap, dark red-brown when dry, dry-wet ratio of 9.4, with fine hairs on the surface; with obvious wrinkles and forming a grid; the stipe is 0.4--cm0.6cm long;

[0039] 2. Molecular biology identification:

[0040] The DNA of W-24 hyphae and fruiting bodies was extracted using the Kangwei Century new plant DNA extraction kit, and then the target gene fragment was amplified using universal primers ITS1 and ITS4 (ITS1: 5'TCCGTAGGTGAACCTGC 3'; ITS4: 5'TCCTCCGCTTATTGATATGC 3');

[0041] The PCR system was 25 μL: 2×Taq Master Mix 12.5 μL, DNA template 1 μL, ITS 11 μL, ITS 41 μL, ddH2O 9.5 μL; the PCR program was: 94°C pre-denaturation for 5 min; 94°C denaturation for 1 min, 54°C annealing for 1 min, 72°C extension for 1.5 min, 36 cycles; 72°C extension for 10 min, 4°C storage; detection after 1% agarose gel electrophoresis, and sent to Qingke Biotechnology for sequencing;

[0042] Mycelium sequence:

[0043] GGTATGAGATTTTGGGCTTTTACCCGATCGCTCAGCTGTGCGCCCTCACGGGCTGCACGCTGAATCAAGACCTCACACCTGTGCACATTTTCGGTTGCGGCTTCGGTCGCCGCCGCTTTCACATGCAACTACTCAGTCTCGAATGTCAACAAACCATAAAAAAGTAACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCATGGAGCATGCCTGTTTGAGTGTCACGTAAACCCTCACCCTCGCGATGTAACAGTCGCCCGCGGTGGACTTGGACTGTGCCGTAACCGGCTCGTCTTGAAATGCATTAGCTGGCGCTTTTAGAGTGCTGGGCGACGGTGTGATAATTATCTGCGCCAATGCCTTAGGCCTCTTCAGCGGTGCTGCTTACAGCCGTCCCTTTGTGGACACGCAATTTTAAAGCTTTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAAGCGGGGAAGAAAATTTGCGGGAGGAA

[0044] Fruiting body sequence:

[0045] CCTACCTGATTTGAGGCCAAGCTTTAAAATTGCGTGTCCACAAAGGGACGGCTGTAAGCAGCACCGCTGAAGAGGCCTAAGGCATTGGCGCAGATAATTATCACACCGTCGCCCAGCACTCTAAAAGCGCCAGCTAATGCATTTC AAGACGAGCCGGTTACGGCACAGTCCAAGTCCACCGCGGGCGACTGTTACATCGCGAGGGTGAGGGTTTACGTGACACTCAAACAGGCATGCTCCATGGAATACCAAGGAGCGCAAGATGCGTTCAAAGATTCGATGATTCACTGA ATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTGTTACTTTTTTATGGTTTGTTGACATTCGAGACTGAGTAGTTGCATGTGAAAGCGGCGGCGACCG AAGCCGCAACCGAAAATGTGCACAGGTGTGAGGTCTTGATTCAGCGTGCAGCCCGTGAGGGCGCACAGCTGAGCGATCGGGTTAAAAGCCCAAAATCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAGGGCCCTCCCAGTTTC

[0046] The two sequences were submitted to GeneBank, and BLAST (www.ncbi.nlm.nih.gov / BLAST) was used for homology search. The similarity analysis with the sequences of each strain in the database was performed, and the identity (Identities) of the target strain and each strain of Chinese wrinkled fungus (Auricularia sinodelicata) reached 98%-100%. Eight species of the genus Auricularia were downloaded from the GeneBank database, with Exidia truncata as the outgroup, and the phylogenetic tree was constructed using the maximum likelihood method using MEGA7 software, using default parameters and 1000 Bootstrap tests.

[0047] Figure 8This is the phylogenetic tree of the mycelium and fruiting bodies of the Auricularia sinodelicata strain W-24. From the phylogenetic tree, it can be seen that the mycelium and fruiting bodies of W-24 are clustered in one branch with the same genus species of Chinese Auricularia sinodelicata in the GeneBank database, and the support rate of the branch with the same genus species is 98-100%. Combining the results of BLAST comparison and phylogenetic tree, W-24 was identified as a new strain of Chinese Auricularia sinodelicata.

[0048] Embodiment 3:

[0049] Cultivation of Auricularia auricula W-24:

[0050] The above-mentioned method for cultivating and domesticating the Auricularia auricularia auricula strain comprises the following steps:

[0051] According to the mass ratio, 65 parts of sawdust, 30 parts of corn cobs, 30 parts of cottonseed hulls, 6 parts of wheat bran, 2 parts of quicklime and 2 parts of gypsum were mixed with water to obtain a solid cultivation matrix medium with a water content of 60%;

[0052] The activated Auricularia auriculariae strain W-24 was inoculated into a solid stock culture medium, and cultured at 25° C. in the dark for 30 days to obtain a solid stock culture;

[0053] Then, 65 parts of sawdust, 30 parts of corn cobs, 30 parts of cottonseed hulls, 6 parts of wheat bran, 2 parts of quicklime and 2 parts of gypsum are mixed with water to obtain a cultivation medium with a water content of 60%. The cultivation medium is placed in a cultivation bag, and the bag is sealed and sterilized at 121° C. for 3 hours. After cooling to room temperature, the solid original seed is inoculated into the cultivation bag, and the inoculation amount is 10 g / bag to 15 g / bag. The bag is sealed and placed in a culture room at a constant temperature of 24° C. to 26° C. and protected from light. After culturing for 80 days, the mycelium fills the bag and the fruiting management is carried out.

[0054] One week after the mycelium fills the bag, open the bag with a scalpel. Disinfect with alcohol before opening the bag, and burn with the outer flame of an alcohol lamp. After cooling to room temperature, draw a "V" on the bag. Place it at 22℃-26℃ for one day, and then transfer it to the fruiting room. Control the temperature at 23℃-28℃, the humidity at 85%-95%, and spray water in a mist. Stop spraying water when the ear pieces are fully unfolded, and harvest after one day.

[0055] The above description is only a preferred embodiment of the present invention. It should be pointed out that it is possible for a person skilled in the art to make several improvements and changes without departing from the creative concept of the present invention, and these all fall within the protection scope of the present invention.

Claims

1. A wrinkled wood ear strain W-24, named "Gan wrinkled ear No. 1", Auricularia delicata, was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, with a deposit date of June 11, 2024 and a deposit number of CGMCC No.41332.

2. The method for cultivating and domesticating the Auricularia auricula strain W-24 according to claim 1, characterized in that: The following steps are involved: S1. Method for obtaining pure culture of strains: The samples of Auricularia auriculariae strain W-24 collected in the wild were separated by tissue, cultured on Martin's agar medium to isolate pure culture, and then transferred to PDA comprehensive medium to observe its mycelial structure until its pure culture was obtained. S2. Cultivated seeds preparation: S2-1, solid stock: The Auricularia auricula strain W-24 activated on the PDA comprehensive medium was inoculated into the solid cultivation matrix medium, and cultured at 24°C-26°C for 30-35 days to obtain the solid stock; S2-2, Cultivated seeds: Inoculate solid original seeds into solid cultivation substrate bags at an inoculation rate of 10g / bag to 15g / bag, seal the bags, and place them in a culture room at a constant temperature of 24°C to 26°C in the dark. After 80 to 85 days of cultivation, the mycelium will fill the bags and fruiting management can be carried out; S3. Mushroom production management: Open the bag with a scalpel one week after the mycelium fills the bag. Disinfect with alcohol before opening the bag and burn with the outer flame of an alcohol lamp. Score a "V" on the bag after cooling to room temperature. Place it at 22℃-26℃ for one day, then transfer it to the fruiting room. Control the temperature at 23℃-28℃ and the humidity at 85%-95%. Spray water in a mist form. Stop spraying water when the ear pieces are fully unfolded. Harvest after one day.

Images