Mstnb gene editing composition as well as preparation method and application thereof

Abstract

The invention relates to an mstnb gene editing composition as well as a preparation method and application thereof, and belongs to the technical field of biology. The technical problems that in the prior art, grass carp gene editing efficiency is low, and operation is complex are solved. A composition which contains a specific gRNA sequence and is shown as SEQ ID NO: 1 is constructed, and the composition further contains Cas9mRNA and cas9 protein. The gRNA is obtained by carrying out PCR amplification on a gRNA skeleton plasmid sequence as shown in SEQ ID NO: 3 and carrying out in-vitro transcription preparation, and Cas9mRNA is obtained by carrying out in-vitro transcription after carrying out linearization treatment on a cas9 plasmid. The gene editing composition with a specific concentration ratio is microinjected into a grass carp fertilized egg to prepare the grass carp mutant. By means of the precise gene editing composition, the efficiency and accuracy of grass carp gene editing are improved, and a powerful tool is provided for aquatic breeding.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a mstnb gene editing composition and a preparation method and application thereof. Background Art

[0002] Grass carp (Ctenopharyngodon idella) is the largest freshwater species farmed in China, with an annual output of more than millions of tons. According to the Ministry of Agriculture and Rural Affairs, the output of grass carp farming will reach 5.941 million tons in 2023, accounting for 10.2% of my country's aquaculture output. Grass carp not only grows quickly and has strong adaptability, but also has strong reproductive capacity, making it one of the most popular species for mass consumption of aquatic products. With the improvement of people's living standards, the demand for fish and other products has also increased dramatically, and the output of grass carp farming has also increased year by year. Therefore, it is of great significance to cultivate or create new germplasm of fast-growing grass carp.

[0003] The Mstn gene, or myostatin, has attracted widespread attention in vertebrate research. This gene mainly regulates muscle development and is an important factor affecting growth performance. Studies in recent years have shown that the expression level of the Mstn gene is closely related to the body size and growth rate of vertebrates. In mammalian vertebrates, such as cattle and sheep, inhibition of Mstn gene expression can significantly increase muscle mass and growth rate through gene editing or gene intervention technology. Similarly, in fish (such as tilapia, zebrafish, salmon, etc.), it has also been shown that knockout of the Mstn gene will lead to an increase in muscle mass and growth rate. In addition, the study also found that the variation of the Mstn gene is related to the growth characteristics and adaptability of different fish, revealing its important role in muscle development and growth. These studies show that new fast-growing grass carp germplasm can be obtained by targeted editing of the grass carp mstn gene.

[0004] Traditional gene editing delivery methods, such as plasmid-based delivery systems, have problems such as low translation and expression efficiency and high off-target effects. In response to the urgent need for grass carp germplasm improvement, developing an efficient, safe, and easy-to-operate gene editing delivery method and achieving efficient knockout of the Mstn gene are of great significance for promoting the healthy development of grass carp aquaculture. Summary of the invention

[0005] In view of this, the purpose of the present invention is to provide an mstnb gene editing composition, the second purpose is to provide a preparation method of the mstnb gene editing composition, and the third purpose is to use the composition to prepare a new fast-growing germplasm of grass carp.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention provides a mstnb gene editing composition, the composition comprising gRNA, Cas9 mRNA and Cas9 protein, the sequence of the gRNA is shown in SEQ ID NO: 1;

[0008] The Cas9 mRNA is transcribed and synthesized by a Cas9 plasmid, and the nucleotide sequence of the Cas9 plasmid is shown in SEQ ID NO: 2;

[0009] Further, the preparation method of the mstnb gene editing composition, the preparation method steps are as follows:

[0010] S1: gRNA synthesis, using the gRNA backbone plasmid as a template, using the primer set to perform PCR amplification and recover the fragment, and using T7 RNA polymerase to perform in vitro transcription to obtain gRNA;

[0011] S2: Cas9 mRNA synthesis, extracting the Cas9 plasmid and linearizing the Cas9 plasmid with Xba I restriction endonuclease, and in vitro transcription to obtain the Cas9 mRNA;

[0012] The gRNA backbone plasmid sequence in step S1 is shown in SEQ ID NO: 3;

[0013] The primer set sequences in step S1 are shown in SEQ ID NO:4 and SEQ ID NO:5;

[0014] Use of the mstnb gene editing composition in preparing a grass carp mutant, microinjecting the gene editing composition of claim 2 into a grass carp fertilized egg;

[0015] The concentration ratio of gRNA, Cas9 mRNA and Cas9 protein in the gene editing composition is 5:5:1.

[0016] The beneficial effects of the present invention are: 1) The method has high mutation efficiency: compared with the injection of Cas9 mRNA alone or Cas9 protein alone, the joint use of Cas9 mRNA and Cas9 protein significantly increases the mutation efficiency;

[0017] 2) Significantly faster growth rate: Compared with wild-type grass carp, grass carp with the mstnb mutation grow significantly faster, and individuals with higher mutation efficiency grow faster; the growth rate of the population is significantly improved compared with traditional breeding;

[0018] 3) By establishing the mstnb homozygous mutant line, a fast-growing grass carp strain with stable inheritance can be obtained.

[0019] Other advantages, objectives and features of the present invention will be described in the following description to some extent, and to some extent, will be obvious to those skilled in the art based on the following examination and study, or can be taught from the practice of the present invention. The objectives and other advantages of the present invention can be realized and obtained through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention will be described in detail below in conjunction with the accompanying drawings, wherein:

[0021] Figure 1 The target site sequence of the grass carp mstnb gene mutation (A), mutation restriction enzyme detection (B), mutation F0 individual sequencing (C), and mutation type (D); the dotted line represents the number of missing bases; the asterisk (*) represents the number of inserted bases;

[0022] Figure 2 The mutation efficiency of Cas9 mRNA alone or Cas9 protein alone was compared, as well as the co-administration of Cas9 mRNA and Cas9 protein. The co-administration of Cas9 mRNA and Cas9 protein significantly increased the mutation efficiency of embryos.

[0023] Figure 3 Comparison of the weight and length of three combinations of mstnb mutant grass carp. The combined use of Cas9 mRNA and Cas9 protein increased the mutation efficiency of the mstnb gene, resulting in a significant increase in the weight of the mutants in this combination. Figure A shows the body shape of grass carp mutants in different combinations, Figure B shows the sequencing peak of the mutant PCR product corresponding to Figure A, and Figure C shows the weight statistics of mstnb mutant grass carp in different combinations. DETAILED DESCRIPTION

[0024] The following describes the embodiments of the present invention by specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the illustrations provided in the following embodiments only illustrate the basic concept of the present invention in a schematic manner, and the following embodiments and features in the embodiments can be combined with each other without conflict.

[0025] Among them, the drawings are only used for illustrative explanations, and they only represent schematic diagrams rather than actual pictures, and should not be understood as limitations on the present invention. In order to better illustrate the embodiments of the present invention, some parts of the drawings may be omitted, enlarged or reduced, and do not represent the size of actual products. For those skilled in the art, it is understandable that some well-known structures and their descriptions in the drawings may be omitted.

[0026] The same or similar numbers in the drawings of the embodiments of the present invention correspond to the same or similar parts; in the description of the present invention, it should be understood that if the terms "upper", "lower", "left", "right", "front", "rear", etc. indicate the orientation or position relationship, they are based on the orientation or position relationship shown in the drawings, which is only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operate in a specific orientation. Therefore, the terms describing the position relationship in the drawings are only used for illustrative purposes and cannot be understood as limiting the present invention. For ordinary technicians in this field, the specific meanings of the above terms can be understood according to specific circumstances.

[0027] Example 1 Synthesis of gRNA and Cas9 mRNA

[0028] Target design:

[0029] The gene sequence of grass carp mstnb was downloaded from the NCBI database, and the complete gene sequence of the target gene mstnb was isolated from the female grass carp genome (https: / / www.ncbi.nlm.nih.gov / assembly / GCA_004786185.1). Its coding region and exon introns were determined, and the optimal gene editing target sequence was screened and designed. The grass carp mstnb targeting sequence was designed according to the CRISPR / gRNA target sequence design website CHOPCHOP (http: / / chopchop.cbu.uib.no). The specific principles are as follows: 1) The length is 18-20 bases, the 5' end starts with GG or G (CC or C in reverse), and ends with NGG after the target sequence; 2) When designing the target, there is an available restriction site near the PAM sequence NGG, which is convenient for the later detection of the mutation efficiency of the target by enzyme cutting; 3) The target sequence should be on the exon, preferably close to the 5' end, so as to denature the protein, and the target is designed on the first exon. The target site is such as Figure 1 As shown in A. The target site sequence is: 5'-GGATCAGTACGATGTTCTGG-3'.

[0030] Synthesis of gRNA:

[0031] The 5' end of the forward primer contains a T7 promoter sequence for in vitro synthesis of gRNA. The primer sequence is: F: T7 promoter sequence + target sequence + gRNA backbone sequence. The forward primer was designed as TAATACGACTCACTATAGCTGGATCAGTACGATGTTCTGGGTTTTAGAGCTAGAAATA and the reverse primer was AGCACCGACTCGGTGCCAC, and PCR amplification was performed with the gRNA backbone plasmid (sequence: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT) as a template. The system was as follows: 10×PCR Buffer, 2.5μL; dNTPMixture (2.5mM), 0.5μL; forward primer (10μM), 0.5μL; reverse primer (10μM), 0.5μL; plasmid template containing gRNA sequence, 100ng; Ex-taq enzyme, 0.25μL; add water to 25μL. The PCR cycle parameters were as follows: 94°C pre-denaturation for 3 min; 94°C, 30 s, 60°C, 30 s, 72°C, 45 s, 35 cycles; 72°C extension for 10 min. The transcription template was recovered by agarose gel electrophoresis, and the concentration was detected by Nanodrop 2000.

[0032] T7 RNA polymerase (Invitrogen, AM1344) was used to transcribe gRNA in vitro, and gRNA was precipitated and purified using sodium acetate and anhydrous ethanol. The transcription system was as follows: 10×T7 Buffer, 2 μL; T7 RNA polymerase, 1 μL; rNTP, 1 μL; DNA template, 1000 ng; RNase inhibitor (NEB, M0314S), 0.5 μL; enzyme-free water was added to make up the total volume to 20 μL. The above system was incubated in a 37°C water bath for 3h; then DNase I (enzyme-free) (10U / μL) was added and incubated at 37°C for 15min; then 50μL 100% anhydrous ethanol (2.5 times the volume) and 2μL 3mol / L sodium acetate at pH 5.3 were added; vortexed gently and stored at -80°C overnight; centrifuged at 4°C 14000rpm for 30min; the ethanol was discarded and washed with 70% ethanol (prepared with enzyme-free water); the above steps were repeated once, 70% ethanol was discarded, and dried at room temperature for 5min; 1μL of RNase inhibitor and 50μL of enzyme-free water were added for dissolution, the concentration was detected by Nanodrop2000, and stored at -80°C for future use. The complete gRNA sequence is shown in SEQ ID NO: 1.

[0033] Synthesis of Cas9 mRNA:

[0034] Extract the Cas9 plasmid and linearize it with Xba I restriction endonuclease. The enzyme digestion system is: 5 μg of Cas9 plasmid DNA; 5 μL Xba I; 5 μL buffer; ddH2O to make up to 50 μL system. Incubate in a 37°C water bath for 3 hours. After the incubation, place the reaction tube in a 65°C-70°C water bath and heat for 10-15 minutes to inactivate the enzyme. After linearization, add a final concentration of 5% SDS and 20 μg / μL proteinase K, treat at 50°C for 30 minutes, purify with Qiagen PCR gel recovery kit, and dilute the template to 500 ng / μL with enzyme-free water. Cas9 mRNA for injection was prepared according to T7 mMESSAGE The synthesis was performed using the steps of the Ambion Kit. The specific process is as follows:

[0035] 1) In vitro transcription reaction system: 1-2μg linearized template DNA; 2×NTP / CAP solution 10μL; 10×T7Reaction Buffer 2μL; T7 Enzyme Mix 2μL; enzyme-free water to make up to 20μL reaction system. Reaction conditions: Gently mix the reaction system, centrifuge briefly, and incubate in a 37℃ water bath for 2-4 hours for in vitro transcription reaction.

[0036] 2) Purification of mRNA: Removal of template DNA: After the transcription reaction is completed, add 1 μL of TurboDNase to the reaction system and incubate at 37°C for 15 minutes to remove residual template DNA.

[0037] 3) Purify mRNA by LiCl precipitation: Add 20 μL of enzyme-free water and 30 μL of 8M LiCl solution to the reaction system, mix thoroughly and place at -80°C overnight to precipitate mRNA. The next day, centrifuge the tube at 12000 rpm at 4°C for 15 minutes and carefully discard the supernatant. Wash the precipitate twice with 70% ethanol, centrifuge for 5 minutes each time, then carefully remove the ethanol and dry the precipitate. Finally, dissolve the mRNA precipitate with an appropriate amount of enzyme-free water to obtain purified Cas9 mRNA.

[0038] 4) mRNA quality detection: The concentration was detected by Nanodrop 2000 and a small amount of purified Cas9 mRNA was taken for agarose gel electrophoresis. After the quality was determined, it was placed in a -80°C refrigerator for future use. The complete Cas9 plasmid sequence is shown in SEQ ID NO: 2.

[0039] Cas9 protein was purchased from Invitrogen TM , A36499).

[0040] Example 2 Preparation of grass carp gene knockout mutants

[0041] The microinjection of grass carp fertilized eggs was divided into three groups and carried out separately. Group 1 was: gRNA and Cas9 mRNA were mixed in a volume ratio of 1:1, and the final concentrations were 500ng / μL and 500ng / μL, respectively. Group 2 was a mixture of gRNA and Cas9 protein in a volume ratio of 10:1, and the final concentrations were 500ng / μL and 100ng / μL, respectively. Group 3 was a mixture of gRNA, Cas9 mRNA and Cas9 protein in a volume ratio of 10:10:1, and the final concentrations were 500ng / μL, 500ng / μL and 100ng / μL, respectively. Phenol red with a final concentration of 1% was added to each group as an indicator. The grass carp fertilized eggs were placed in a sterile dish and injected at the 1-cell stage using a microinjection system. The injection dose was about 400-600pg mRNA for each fertilized egg. In order to ensure the efficiency of mutation, it was injected into the animal pole of the embryo. The injected fertilized eggs were placed in a flow-through incubation system for incubation. Each set of experiments was repeated more than 3 times.

[0042] Screening of mutation-positive fish and growth phenotype analysis:

[0043] After the injected fertilized eggs hatched, part of the fins of a single mutant fish were taken to extract genomic DNA using the phenol / chloroform method, and PCR amplification was performed using the designed amplification primers. At the same time, the genomic DNA of the wild-type individual was extracted and the target band was amplified. The target band was separated by 1.2% agarose gel electrophoresis and then recovered by gel. The recovered product was digested with T7 endonuclease, and the mutation type and mutation efficiency were determined by sequencing. The results are shown in Figure 2 When the mutant fish are raised to an appropriate age, the growth parameters of the mutant fish are analyzed by measuring body length, weight and other growth parameters, and compared with the wild type. The comparison of weight and body length of the three mutant combinations of mstnb mutant grass carp is shown in Figure 3 As shown, the co-use of Cas9 mRNA and Cas9 protein increased the mutation efficiency of the mstnb gene, resulting in a significant increase in the weight of the mutants in this combination, with the weight increased by 14% relative to the wild type, while the Cas9 mRNA group and Cas9 protein group only increased by 6% and 5%, respectively.

[0044] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution, which should be included in the scope of the claims of the present invention.

Claims

1. The mstnb gene editing composition is characterized by: The composition includes gRNA, Cas9 mRNA and cas9 protein, and the sequence of the gRNA is shown in SEQ ID NO:

1.

2. The composition according to claim 1, characterized in that: The Cas9 mRNA is transcribed and synthesized by a cas9 plasmid, and the nucleotide sequence of the cas9 plasmid is shown in SEQ ID NO:

2.

3. A method for preparing a mstnb gene editing composition, characterized in that: The preparation method steps are as follows: S1: gRNA synthesis, using the gRNA backbone plasmid as a template, using the primer set to perform PCR amplification and recover the fragment, and using T7 RNA polymerase to perform in vitro transcription to obtain gRNA; S2: Synthesis of Cas9 mRNA: extract the Cas9 plasmid and linearize the Cas9 plasmid with Xba I restriction endonuclease, and transcribe in vitro to obtain the Cas9 mRNA.

4. The method according to claim 3, characterized in that The gRNA backbone plasmid sequence in the S1 step is shown as SEQ ID NO:

3.

5. The method according to claim 3, characterized in that: The primer set sequences in step S1 are shown in SEQ ID NO:4 and SEQ ID NO:

5.

6. The use of the mstnb gene editing composition in preparing a grass carp mutant, characterized in that: The gene editing composition of claim 2 is microinjected into grass carp fertilized eggs.

7. The use according to claim 6, characterized in that: The concentration ratio of gRNA, Cas9 mRNA and Cas9 protein in the gene editing composition is 5:5:1.

Images