Barley HvCslf6 promoter element and application of barley HvCslf6 promoter element in regulating and controlling content of beta-glucan in barley grains

Abstract

The invention belongs to the technical field of biological gene engineering, and particularly relates to a barley HvCslf6 promoter element and application of the barley HvCslf6 promoter element in regulating and controlling the content of beta-glucan in barley grains, and the barley HvCslf6 promoter element is located at 295bp-300bp of the upstream of a barley HvCslf6 gene transcription start site; the nucleotide sequence of the HvCslf6 promoter element is CCGTTG, and the HvCslf6 promoter element belongs to a CCAAT-box element; the gene number of the HvCslf6 gene in the BARLEX Morex v3Gene Models is HORVU.MOREX.r3. 7HG0698110, and the gene number of the HvCslf6 gene in the BARLEX Morex v3Gene Models is HORVU.MOREX.r3. According to the invention, a key element which can influence the content of beta-glucan in barley grains is found in an upstream promoter region of a major gene HvCslf6 for synthesizing barley beta-glucan by utilizing a gene editing technology, and a set of method capable of preparing a transgenic plant with changed content of beta-glucan in barley grains is provided. And a new means and a new tool are provided for detecting and regulating the content of beta-glucan in barley grains.

Description

Technical Field

[0001] The invention belongs to the technical field of biological gene engineering, and particularly relates to a barley HvCslf6 promoter element and application thereof in regulating the beta-glucan content of barley grains. Background Art

[0002] Barley is one of the main crops in my country, playing an important role in ensuring food security and promoting the development of animal husbandry and beer industry. β-glucan is an important trait that affects the use and quality of barley, and this effect varies depending on the use of barley. When barley is used for livestock and poultry feed and beer production, the grain β-glucan is required to be low, because β-glucan will hinder the digestion and growth of livestock and poultry, reduce the filtration rate of wort and the leaching rate of malt, and cause beer turbidity and precipitation, deterioration of taste, etc. When barley is used as food, β-glucan is a beneficial ingredient that has the effects of lowering blood sugar and cholesterol in the human body, cleaning the intestines and improving immunity. The β-glucan people consume in their daily lives mainly comes from grains, but the β-glucan content of major grain crops such as rice, wheat and corn is low (less than 1%), while barley and oats are higher, especially barley, which is generally around 4%-5%, and can be as high as 8% or more.

[0003] At present, Cslf6 in barley has been confirmed to be a key gene controlling β-glucan synthesis (Garcia-Gimenez, G., Barakate, A., Smith, P., Stephens, J., Khor, SF, Doblin, MS, Hao, P., et al. (2020). Targeted mutation of barley (1, 3; 1, 4) -β-glucan synthases reveals complex relationships between the storage and cell wall polysaccharide content, Plant Journal, 104 (4): 1009-1022.), and there are a large number of transcription factor binding sites on its upstream promoter (Garcia-Gimenez Guillermo, Schreiber Miriam, Dimitroff George, Little Alan, Singh Rohan, Fincher Geoffrey B., Burton Rachel A., Waugh Robbie, Tucker Matthew R., Houston Kelly. (2022). Identification of candidate MYB transcription factors that influence CslF6 expression in barley grain. Frontiers in Plant Science, 13, 883139.), which may play an important role in regulating CslF6 gene expression. Therefore, gene editing of key cis-acting elements upstream of the CslF6 gene promoter can provide a new research method for in-depth understanding of the transcriptional regulation of the Cslf6 gene, and ultimately clarify the synthesis mechanism of (1,3;1,4)-β-glucan. However, there are few studies on the transcriptional regulation of the Cslf6 gene, and the effects and functions of these key cis-acting elements on the expression of the Cslf6 gene are still unclear. Summary of the invention

[0004] In view of the defect in the prior art that the effect of key cis-acting elements of barley on the expression of Cslf6 gene is unclear, the present invention provides a barley HvCslf6 promoter element and its application in regulating the β-glucan content in barley grains. The specific technical scheme is as follows:

[0005] In the first aspect, the present invention provides a barley HvCslf6 promoter element, which is located 295bp to 300bp upstream of the transcription start site of the barley HvCslf6 gene; the nucleotide sequence of the HvCslf6 promoter element is CCGTTG, which belongs to the CCAAT-box element; the gene number of the HvCslf6 gene in the BARLEX Morex v3 Gene Models is HORVU.MOREX.r3.7HG0698110.

[0006] In a second aspect, the present invention provides a biological material comprising the above-mentioned HvCslf6 promoter element, wherein the biological material is a recombinant vector and / or a genetically engineered bacterium.

[0007] In a third aspect, the present invention provides the use of the above-mentioned barley HvCslf6 promoter element or the above-mentioned biological material in regulating the β-glucan content in barley grains.

[0008] In a fourth aspect, the present invention provides a method for preparing a gene-edited plant with reduced β-glucan content in barley grains, comprising: using gene editing technology to edit a promoter element in a promoter region of a HvCslf6 gene to obtain a gene-edited plant with reduced β-glucan content in barley grains;

[0009] The gene number of the HvCslf6 gene in the BARLEX Morex v3 Gene Models is HORVU.MOREX.r3.7HG0698110.

[0010] Furthermore, the original nucleotide sequence of the upstream promoter region is shown as SEQ ID NO.1; the nucleotide sequence of the promoter element after gene editing is shown as SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4.

[0011] Furthermore, the editing target site of the promoter element comprises a sequence of a CCAAT-box element.

[0012] Furthermore, the promoter element is located 295 bp to 300 bp before the CDS region of the HvCslf6 gene, and the nucleotide sequence of the promoter element is CCGTTG, which belongs to a CCAAT-box element.

[0013] Furthermore, the method for preparing the gene-edited plant with reduced β-glucan content in barley grains comprises the following steps:

[0014] (1) Design sgRNA target sites targeting the key cis-acting elements in the 2Kbp promoter region upstream of the ATG of the HvCslf6 gene;

[0015] (2) preparing a CRISPR / Cas9 gene editing vector according to the sgRNA target site designed in step (1);

[0016] (3) A genetically engineered bacterium containing a CRISPR / Cas9 gene editing vector was constructed and transformed into barley genetic transformation materials. After screening of the vector marker gene, transgenic plants with significantly altered β-glucan content in barley grains without the presence of exogenous genes were obtained.

[0017] Furthermore, the nucleotide sequence of the sgRNA is shown in any one of SEQ ID NOs. 5 to 9.

[0018] Furthermore, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.7.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention uses gene editing technology to find key elements that affect the β-glucan content in barley grains in the upstream promoter region of the major gene for barley β-glucan synthesis, and thus provides a set of methods for preparing transgenic plants with altered β-glucan content in barley grains, providing new means and tools for detecting and regulating the β-glucan content in barley grains. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram of gene editing of Cslf6 promoter elements; wherein (a) shows the location of gene editing targets in the promoter region, and a total of 5 targets (T1-T5) were designed; (b) shows the types of mutations obtained at the five targets, which contain key cis-acting elements. Pro-Cslf6-CK represents wild-type barley GP, which is the control group. Pro-Cslf6-mT1-1 represents the first mutation type obtained at the first target T1 of the Cslf6 gene promoter, wherein the T1 target obtained 2 mutation types, the T2 target obtained 2 mutation types, the T3 target obtained 1 mutation type, the T4 target obtained 3 mutation types, and the T5 target obtained 1 mutation type.

[0022] Figure 2 Statistical graph of β-glucan content in mature grains of plants of various mutant types; among them, Pro-Cslf6-CK represents wild-type barley GP, which is the control group, and Pro-Cslf6-mT1-1 and others represent mutation types in the Cslf6 gene promoter; *, *, and *** indicate significance at P<0.05, P<0.01, and P<0.001 levels, respectively, and ns indicates no significance compared with the control.

[0023] Figure 3 Schematic diagram of the genotypes of the mutation sites in the three mutants at the wild-type barley GP and T3 target sites; among them, Pro-Cslf6-CK represents the wild-type barley GP, Pro-Cslf6-mT3-1 (1 bp-in) represents the insertion of a base A in the CCAAT-box of the barley promoter in the mutant; Pro-Cslf6-mT3-2 (1 bp-in) represents the insertion of a base T in the CCAAT-box of the barley promoter in the mutant; Pro-Cslf6-mT3-3 (2 bp-in) represents the insertion of two bases TT in the CCAAT-box of the barley promoter in the mutant.

[0024] Figure 4 It is a statistical chart of β-glucan content in wild-type and three mutant barley grains; among them, Pro-Cslf6-CK represents wild-type barley Golden Promise (GP), Pro-Cslf6-mT3-1, Pro-Cslf6-mT3-2 and Pro-Cslf6-mT3-3 represent three mutants at the T3 target site, DAF 21 represents detection at 21 days after flowering, DAF 28 represents detection at 28 days after flowering, and Mature represents detection after the grains are mature.

[0025] Figure 5 The relative expression level of Cslf6 in wild-type and three mutant barley grains is statistically shown; DAF 21 indicates detection 21 days after flowering, and Pro-Cslf6-CK indicates wild-type barley GP. DETAILED DESCRIPTION

[0026] In order to make those skilled in the art better understand the scheme of the present invention, the technical scheme of the present invention is clearly and completely described below in conjunction with specific embodiments. It should be noted that the following detailed descriptions are all exemplary and are only embodiments of a part of the present invention, rather than all embodiments.

[0027] Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative work should fall within the scope of protection of the present invention.

[0028] Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those of ordinary skill in the art to which this application belongs. The experimental materials used in the examples of the present invention are all conventional experimental materials in the art and can be purchased through commercial channels. Experimental methods without specifying detailed conditions were performed according to conventional experimental methods or according to the operating instructions recommended by the supplier.

[0029] The nucleotide sequence of the upstream promoter region of HvCslf6 is shown in SEQ ID NO.1. The upstream promoter region is located in front of the CDS region of the HvCslf6 gene and has a length of 2.0-kb; the nucleotide sequence of the promoter element provided in the present application is CCGTTG, which belongs to the CCAAT-box element. The nucleotide sequence of the upstream promoter after gene editing is shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4.

[0030] SEQ ID NO.1:

[0031]

[0032] SEQ ID NO.2:

[0033]

[0034] SEQ ID NO.3:

[0035]

[0036] SEQ ID NO.4:

[0037]

[0038] The barley variety used in the present invention is Golden Promise.

[0039] Example 1 Construction of knockout vectors for different promoter elements of Cslf6 gene and acquisition of transgenic plants

[0040] 1) Prediction of promoter elements of Cslf6 gene

[0041] The gene sequence of Cslf6 (HORVU.MOREX.r3.7HG0698110) was assembled using Geneious software, and the first 2.0 kb of its CDS region was selected as the promoter region of the gene. The promoter elements of the Cslf6 gene were predicted using PlantCARE (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html) online software. Five key cis-acting elements were selected for target design. Their positions on the promoter are as follows: Figure 1 As shown in (a) and (b) in the figure, the detailed information is shown in Table 1:

[0042] Table 1 Different promoter elements and their gene editing targets

[0043]

[0044] 2) Design of promoter element knockout sgRNA

[0045] The sgRNA target site was designed near the cis-acting element using the online website targetdesign (http: / / skl.scau.edu.cn / targetdesign / ), the target site was edited to include the sequence of each element, and then the off-target rate was detected on the website crispor (http: / / crispor.tefor.net / crispor.py), and the sgRNA sequence was determined by comprehensive knockout element and off-target detection (as shown in Table 1, SEQ ID NO. 5-9).

[0046] 3) Construction of promoter element knockout vector

[0047] ① The U6 vector was linearized using BsaIHF-V2 restriction endonuclease (R3733L, NEB, USA), and the digested product was rapidly dephosphorylated with CIP (M0525V, NEB, USA) to prevent the vector from self-ligation;

[0048] ② Design target primers according to the sequences of different promoter elements (as shown in Table 1);

[0049] ③ The target primers were dissolved in TE buffer to a final concentration of 100 μM / L and annealed at 90°C for 1-2 minutes using a PCR instrument;

[0050] ④ The target primer annealing product was phosphorylated by adding T4 PNK (M0201S, NEB, USA);

[0051] ⑤Use T4 ligase (M0202L, NEB, USA) to connect the U6 linearized vector and the annealed phosphorylated product to obtain knockout vectors with different promoter elements.

[0052] ⑥The above knockout vector was transformed into competent Escherichia coli DH5a, and sgF of each target primer was used as the F primer, and P2 (GCGATTAAGTTGGGTAACGC) was used as the universal R primer for single clone verification and sequencing.

[0053] After sequencing was correct, the plasmid was extracted to obtain different cas9-Pro-Cslf6 promoter editing vector plasmids Pro-Cslf6-mT1~T5.

[0054] 4) Obtaining transgenic plants

[0055] The constructed knockout vector positive plasmids were transformed into Agrobacterium by heat shock method, and commercial Agrobacterium competent cells AGL1 (AC1020S, Weidi Biotechnology, China) were used as the recipient strain. Agrobacterium was used to infect in vitro GP embryos for genetic transformation, and transgenic plants were obtained after hygromycin (HYG) screening and culture. 0 The DNA of leaves of transgenic plants and wild-type plants was sequenced using the following two pairs of primers to detect mutation types in the five target regions. The Pro-Cslf6-F1 / R1 primer was used to detect mutations in the T1-T4 target sites, and the Pro-Cslf6-F2 / R2 primer was used to detect mutations in the T5 target site. The amplification lengths were 799 bp and 657 bp, respectively. The primers are as follows:

[0056] Pro-Cslf6-F1: 5'-GCACAAGCTCACAAACCC-3';

[0057] Pro-Cslf6-R1: 5'-GGAGAACAGGTCCAAGGTCC-3';

[0058] Pro-Cslf6-F2: 5'-AGTCAAGGGGTGAGCTTGTG-3';

[0059] Pro-Cslf6-R2: 5'AGGAATGCATTGGTCCCCTG-3'.

[0060] Example 2 Determination and analysis of β-glucan content in transgenic plants

[0061] After the transgenic verification of T0 generation plants, a total of 10 different homozygous mutant types of plants were obtained, such as Figure 1 As shown in (b), gene editing of the T1 target site obtained two mutant types of plants, namely Pro-Cslf6-mT1-1 and Pro-Cslf6-mT1-2; similarly, two mutant types of plants were obtained at the T2 target site, one mutant type was obtained at the T3 target site, three mutant types were obtained at the T4 target site, and one mutant type was obtained at the T5 target site.

[0062] Then, the mature grains of each mutant type plant and the control group plant GP were harvested for determination and analysis of β-glucan content using the β-Glucan Assay Kit (Mixed Linkage) (K-BGLU, Megazyme).

[0063] The analysis results are as follows Figure 2 As shown in the figure, compared with the control plant Pro-Cslf6-CK, except for Pro-Cslf6-mT4-3, the β-glucan content in mature grains of the other mutants was significantly lower than that of the control, especially the Pro-Cslf6-mT3 mutant, which was the most significant, reaching 20.27%. This indicates that the cis-acting element CCAAT-box at this target site is the most critical to the final phenotype caused by this gene. Therefore, we will only study the variation at the T3 target site in the future.

[0064] To knock out the T3 target site, we continued to plant the remaining T0 generation heterozygous seeds harvested, extracted DNA from the T1 generation for sequencing analysis, and found two more mutation types at the T3 target site in addition to Pro-Cslf6-mT3. We named these three mutation types: Pro-Cslf6-mT3-1, Pro-Cslf6-mT3-2, and Pro-Cslf6-mT3-3. The genotypes of the mutation sites of the three mutants are as follows: Figure 3 shown.

[0065] The HYG and Cas9 screening markers were used simultaneously to screen for plants that did not contain both marker genes. The universal primers HYG-F / R and Cas9-F / R were used to detect the mutation sites, and finally transgenic plants that did not contain exogenous genes were screened. The universal primers are as follows:

[0066] HYG-F: 5'-TAAATAGCTGCGCCGATGGT-3';

[0067] HYG-R: 5'-GGCGACCTCGTATTGGGAAT-3';

[0068] Cas9-F: 5'-CCTGGCCCACATGATCAAGT-3';

[0069] Cas9-R: 5'-TGTACTTCTCAGGCAGCTGC-3';

[0070] T2 generation seeds can be used for subsequent steps after positive identification.

[0071] Similarly, the β-glucan content of mature grains of Pro-Cslf6-mT3-1, Pro-Cslf6-mT3-2 and Pro-Cslf6-mT3-3 mutants and Pro-Cslf6-CK plants was determined and analyzed using the β-Glucan Assay Kit (Mixed Linkage) (K-BGLU, Megazyme).

[0072] The analysis results are as follows Figure 4 As shown, compared with the control plant GP, the β-glucan content of Pro-Cslf6-mT3-1, Pro-Cslf6-mT3-2 and Pro-Cslf6-mT3-3 mutants at 21 days and 28 days after flowering and in mature grains was extremely significantly reduced, wherein at the mature stage, the β-glucan content of each mutant was significantly reduced by 36.8%, 13.0% and 10.9% relative to the control grains, respectively. It can be seen that the present invention successfully produced gene-edited plants with reduced β-glucan content in barley grains.

[0073] Example 3 Verification of Cslf6 gene expression

[0074] 1) Planting and sampling of barley materials

[0075] The control plant GP and mutants Pro-Cslf6-mT3-1, Pro-Cslf6-mT3-2, and Pro-Cslf6-mT3-3 were simultaneously planted in a plant growth chamber with a temperature of 22°C during the day and 18°C ​​at night, a photoperiod of 14 h during the day and 10 h at night, and a light intensity of 300 μm·m -2 s -1 The soil used for planting was a mixture of peat and vermiculite in a ratio of 9:1. Sampling was performed during the development of barley grains (21 days after flowering). After cutting the ears, the awns were removed and the grains were quickly placed in a 15 mL centrifuge tube pre-cooled with liquid nitrogen. After quick freezing with liquid nitrogen, the grains were stored at -80°C. RNA contamination was avoided during the sampling process.

[0076] 2) RNA extraction, reverse transcription and fluorescence quantitative PCR

[0077] Total RNA was extracted using the Quick RNA extraction kit (Huayueyang Biotechnology Co., Ltd., Beijing, China), and cDNA was synthesized according to the instructions of the reverse transcription kit (Takara, Japan). The housekeeping gene 3-glyceraldehyde phosphate dehydrogenase gene (GAPDH) was used as an internal reference to determine the expression level of the Cslf6 gene. The amplified sequence is shown below:

[0078] GAPDH-F: 5'-GTGAGGCTGGTGCTGATTACG-3';

[0079] GAPDH-R: 5'-TGGTGCAGCTAGCATTTGAGAC-3';

[0080] Cslf6-F: 5'-TGGGCATTCACCTTCGTCAT-3';

[0081] Cslf6-R: 5'-TGTCCGGGCAAACTCATCAA-3'.

[0082] Utilize TB Green TM PreMix Ex Taq TM II kit (Takara, Japan) and LightCycler 480 fluorescence quantitative PCR instrument (Roche, Switzerland) were used for qRT-PCR reaction. The reaction procedure was 95°C pre-denaturation for 90 s, 95°C denaturation for 5 s, 60°C annealing for 20 s, and 40 cycles. The response Ct value of each gene was determined according to the amplification curve. –ΔΔCt Methods The relative expression of genes was calculated (Schefe, JH, Lehmann, KE, Buschmann, IR, Unger, T. and Funke-Kaiser, H. (2006). Quantitative real-time RT-PCR data analysis: Current concepts and the novel "gene expression's CT difference" formula, Journal of Molecular Medicine, 84 (11): 901-910). Each value was measured with 4 biological replicates.

[0083] like Figure 5 As shown, the expression level of Cslf6 gene in the grains during the development process was significantly lower than that in the control wild-type GP, indicating that the reduction of β-glucan content in the grains of the mutants provided in the present application relative to the wild-type is caused by the reduction of Cslf6 gene expression.

Claims

1. Barley HvCslf6 promoter element, characterized in that The barley HvCslf6 promoter element is located 295bp to 300bp upstream of the transcription start site of the barley HvCslf6 gene; the nucleotide sequence of the HvCslf6 promoter element is CCGTTG, which belongs to the CCAAT-box element; the gene number of the HvCslf6 gene in the BARLEX Morex v3 Gene Models is HORVU.MOREX.r3.7HG0698110.

2. A biological material comprising the HvCslf6 promoter element according to claim 1, characterized in that: The biological material is a recombinant vector and / or a genetically engineered bacterium.

3. Use of the barley HvCslf6 promoter element according to claim 1 or the biological material according to claim 2 in regulating the β-glucan content in barley grains.

4. A method for preparing a gene-edited plant with reduced β-glucan content in barley grains, characterized in that: include: Gene editing technology was used to edit the promoter element in the promoter region of the HvCslf6 gene, and gene-edited plants with reduced β-glucan content in barley grains were obtained; The gene number of the HvCslf6 gene in the BARLEX Morex v3 Gene Models is HORVU.MOREX.r3.7HG0698110.

5. The method according to claim 4, characterized in that The original nucleotide sequence of the upstream promoter region is shown as SEQ ID NO.1; the nucleotide sequence of the promoter element after gene editing is shown as SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.

4.

6. The preparation method according to claim 4, characterized in that: The editing target of the promoter element comprises the sequence of the CCAAT-box element.

7. The preparation method according to claim 4, characterized in that: The promoter element is located at 295 bp to 300 bp before the CDS region of the HvCslf6 gene, and the nucleotide sequence of the promoter element is CCGTTG, which belongs to a CCAAT-box element.

8. The preparation method according to claim 4, characterized in that: The following steps are involved: (1) Designing sgRNA target sites for the promoter element in the 2Kbp promoter region upstream of the ATG of the HvCslf6 gene; (2) preparing a CRISPR / Cas9 gene editing vector according to the sgRNA target site designed in step (1); (3) A genetically engineered bacterium containing a CRISPR / Cas9 gene editing vector was constructed and transformed into barley genetic transformation materials. After screening of the vector marker gene, transgenic plants with significantly altered β-glucan content in barley grains without the presence of exogenous genes were obtained.

9. The preparation method according to claim 8, characterized in that: The nucleotide sequence of the sgRNA is shown in any one of SEQ ID NO.5 to 9.

Images