Cocaine aptamer, detection sensor prepared from cocaine aptamer and application of cocaine aptamer
By coupling cocaine aptamers with biotin-modified Fe3O4 in cocaine detection and introducing rolling ring amplification technology, the problem of low sensitivity and accuracy of traditional detection methods is solved, and high sensitivity and efficient and convenient cocaine detection is achieved.
Patent Information
- Application Number
- CN202510070768.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-16
- Publication Date
- 2025-04-01
Smart Images
Figure CN119736304A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of biological detection, and in particular relates to a cocaine aptamer, a detection sensor prepared by using the same and application thereof. Background Art
[0002] Cocaine, also known as cocaine, has a chemical name of benzylecgonine. It is mostly in the form of white crystals, odorless, bitter and numb. In medical treatment, it is used as a local anesthetic or vasoconstrictor. Due to its good anesthetic effect and strong penetration, it is mainly used for surface anesthesia, but it is not suitable for injection due to its strong toxicity. At the same time, it can be used as a strong natural central nervous system stimulant, but it is also abused due to its excitatory effect on the central nervous system. As a powerful central nervous system stimulant, it has a strong addictiveness, can cause damage to the nervous system, cardiovascular system and respiratory system, and seriously endangers human health. Therefore, for the safety of public life, it is urgent to develop a highly sensitive detection reagent for cocaine.
[0003] Traditional cocaine detection reagents detect cocaine through the principle of antigen-antibody binding. The lack of a signal amplification step in the detection process leads to low sensitivity and low accuracy in practical applications. Aptamers are a type of single-stranded oligonucleotide molecules that are screened in vitro by systematic evolution of ligands by exponential enrichment (SELEX) and can bind to specific molecules with high affinity and specificity, generally DNA or RNA. Compared with traditional antibodies, aptamers have the advantages of simple synthesis, low cost, high stability, non-immunogenicity, easy modification and labeling, and enzyme amplification, which makes aptamers have broad application prospects in analytical detection and biomedical fields.
[0004] Nucleic acid amplification technology can replicate target fragments exponentially in vitro and is widely used in analytical detection fields such as clinical diagnosis and pathogen detection. Rolling circle amplification (RCA) is a new type of constant temperature nucleic acid amplification technology, which uses a circular template to amplify the target primer under the action of polymerase, and can achieve signal amplification of the target; RCA is easy to operate and does not require temperature changes during the amplification process. Therefore, it is widely used in molecular biology, medicine, food testing and other fields. Summary of the invention
[0005] In order to solve the above technical problems, the present invention proposes a cocaine aptamer, a detection sensor prepared using the same and applications thereof. The detection sensor is prepared by coupling a cocaine aptamer bound to a complementary nucleic acid fragment and biotin-modified Fe3O4, and a rolling circle amplification system is introduced. The magnetic separation property of Fe3O4 is utilized to improve the specificity, high efficiency and convenience of in vitro detection of cocaine.
[0006] To achieve the above object, the present invention provides a cocaine aptamer, the nucleotide sequence of the cocaine aptamer is shown in SEQ ID NO.1.
[0007] Preferably, the cocaine aptamer also carries a detectable marker.
[0008] Further preferably, the detectable marker comprises one or more of biotin, a chemiluminescent group, a chemifluorescent group, a fluorescent protein, an enzyme, colloidal gold, a radioisotope, a latex particle, an antibody, a ligand, an antigen or a receptor.
[0009] The present invention also provides application of the cocaine aptamer in preparing a cocaine detection sensor.
[0010] The present invention also provides a cocaine detection sensor prepared by using the cocaine aptamer, wherein the cocaine detection sensor is prepared by the cocaine aptamer bound to a complementary nucleic acid fragment and biotin-modified Fe3O4; the nucleotide sequence of the complementary nucleic acid fragment is shown in SEQ ID NO.2.
[0011] The present invention also provides a method for preparing the cocaine detection sensor, comprising the following steps:
[0012] (1) 20 μL of a cocaine aptamer having a concentration of 0.1 to 10 μM and 20 μL of a complementary nucleic acid fragment having a concentration of 0.1 to 10 μM were mixed, and heated at 95° C. for 5 min to obtain a cocaine aptamer bound to the complementary nucleic acid fragment;
[0013] (2) 10 μL of 10 mg / mL biotin-modified Fe3O4 was washed twice with PBS buffer and then resuspended with 10 mM Tris-HCl buffer to obtain a 1 mg / mL biotin-modified Fe3O4 solution. The biotin-modified Fe3O4 solution was mixed with the cocaine aptamer bound to the complementary nucleic acid fragment obtained in step (1), and reacted at 15-35° C. for 0.5 h to obtain a cocaine detection sensor.
[0014] The invention also provides application of the cocaine detection sensor in preparing a cocaine detection reagent.
[0015] The present invention also provides a method for detecting cocaine using a cocaine detection sensor, comprising the following steps:
[0016] S1. The cocaine detection sensor is mixed with the sample to be tested, incubated at 15-35° C. for 30 min, and magnetically separated to obtain the sample supernatant. The sample supernatant is added to the rolling circle amplification system, amplified at 37° C. for 2 h, and fluorescence detection is performed to obtain the sample fluorescence value.
[0017] Preferably, the volume ratio of the cocaine detection sensor and the sample to be tested in S1 is 9:1.
[0018] Preferably, the rolling circle amplification system described in S1 is: 5 μL sample supernatant, 1.6 μL template, 0.6 μL Phi29 DNA polymerase, 1 μL Nt.BbvCI endonuclease, 1.8 μL dNTP, 2 μL 10xNEB buffer, 2 μL 10xPhi29 DNA polymerase buffer, 2 μL 10xrCutSmart buffer, 2 μL H2O, and 2 μL SYBR GreenⅡ.
[0019] The detection principle of the present invention: the cocaine detection system of the present invention mainly consists of a target recognition and signal amplification part. The principle is that when cocaine exists, it will preferentially bind to the cocaine aptamer, thereby competing for the complementary nucleic acid fragments that are complementary to the cocaine aptamer; after magnetic separation treatment, the complementary nucleic acid fragments exist in the supernatant, and the supernatant is added to the rolling circle amplification system to perform rolling circle amplification on the complementary nucleic acid fragments that have been competed, thereby amplifying the signal and realizing high-sensitivity detection of cocaine.
[0020] Compared with the prior art, the present invention has the following advantages and technical effects:
[0021] Compared with the traditional cocaine detection reagent, the present invention greatly improves the detection sensitivity of cocaine. In addition, the preparation of the cocaine aptamer is simple and inexpensive, which greatly reduces the cost of detection. The present invention introduces the cocaine aptamer to convert the detection signal from the substance to be detected (cocaine) into the nucleic acid signal of its corresponding competitor, i.e., the complementary nucleic acid fragment bound to the cocaine aptamer, and uses the rolling circle amplification technology (RCA) to amplify the nucleic acid signal, thereby greatly improving the detection sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0023] Figure 1 The present invention is a schematic diagram of the detection principle of cocaine;
[0024] Figure 2 The particle size potential diagram before and after coupling of Fe3O4@SA and cocaine aptamer bound to complementary nucleic acid fragments, where a is the particle size comparison diagram and b is the potential comparison diagram;
[0025] Figure 3Comparison of the reaction with Bio-FITC before and after coupling of Fe3O4@SA and cocaine aptamer bound to complementary nucleic acid fragments;
[0026] Figure 4 Preparing a rolling circle amplification template for the present invention;
[0027] Figure 5 is the electrophoretic band diagram of the rolling circle amplification product of the present invention;
[0028] Figure 6 Amplify fluorescence signals for detection of complementary fragments at different concentrations;
[0029] Figure 7 A diagram showing the detection of cocaine standard solutions with different concentrations. DETAILED DESCRIPTION
[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0031] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.
[0032] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.
[0033] Without departing from the scope or spirit of the present invention, various modifications and variations may be made to the specific embodiments of the present invention description, which will be apparent to those skilled in the art. Other embodiments obtained from the present invention description will be apparent to those skilled in the art. The present invention description and examples are merely exemplary. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available commodities.
[0034] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0035] Example 1
[0036] The cocaine aptamer is a cocaine aptamer with biotin modified at the 5' end. The nucleotide sequence of the cocaine aptamer is: 5'-ACTCATCTGTGATATCTC GGGAGACAAGGAAAATCCTTCAATGAAGTGGGTCTC CC-3' (SEQ ID NO. 1).
[0037] The nucleic acid sequence of the complementary nucleic acid fragment is: 5'- TCGAAGGATCATCCTTGTCTCCCGAG -3' (SEQ ID NO. 2).
[0038] PBS buffer and Tris-HCl buffer were purchased from Wuhan Sewell Biotechnology Co., Ltd.
[0039] (1) 20 μL of 1 μM cocaine aptamer and 20 μL of 1 μM complementary nucleic acid fragment were added to a 0.2 mL centrifuge tube, heated at 95° C. for 5 min, and cooled naturally to obtain the cocaine aptamer bound to the complementary nucleic acid fragment.
[0040] (2) 10 μL of 10 mg / mL streptavidin-modified Fe3O4 (Fe3O4@SA) was placed in a 1.5 mL centrifuge tube, washed twice with PBS buffer, and then resuspended with 10 mM Tris-HCl buffer to obtain a 1 mg / mL Fe3O4@SA solution. The cocaine aptamer bound to the complementary nucleic acid fragment was added to the 1.5 mL centrifuge tube containing the Fe3O4@SA solution, placed in a vortex machine for 30 seconds to fully mix, and reacted at 25°C for 0.5 h to obtain a cocaine detection sensor.
[0041] (3) Construction of rolling circle amplification template: 24 μL of 50 μM 5'-end phosphate-modified single-stranded template DNA (SEQ ID NO. 3) was placed in a 0.2 mL centrifuge tube, 30 μL of T4 DNA ligase buffer was added thereto, the mixture was heated at 95°C for 5 min, and naturally cooled; 2 μL of T4 DNA ligase was added to the above solution, the mixture was reacted at 37°C for 60 min, and after the reaction, 2 μL of exonuclease I and 2 μL of exonuclease III were added thereto, the mixture was reacted at 37°C for 120 min, and finally heated at 80°C for 20 min to obtain the template.
[0042] The nucleotide sequence of the single-stranded template DNA modified with 5'-end phosphate: 5'-P-GCGCGGCTGAGGCTCGGGAGAC AAGGATGATCCTTCGACGCGCGCGCGGCTGAGGCTCGGGAGACAAGGATGATCCTTCG ACGCGC-3' (SEQ ID NO. 3).
[0043] (4) The cocaine detection sensor and the sample to be tested were mixed in a volume ratio of 9:1, incubated at 25°C for 30 min, and magnetically separated to obtain the sample supernatant. 5 μL of the sample supernatant was added to a rolling circle amplification system (1.6 μL of a 5 μM template, 0.6 μL of Phi29 DNA polymerase, 1 μL of Nt.BbvCI endonuclease, 1.8 μL of dNTP, 2 μL of 10xNEB buffer, 2 μL of 10xPhi29 DNA polymerase buffer, 2 μL of 10xrCutSmart buffer, 2 μL of H2O, and 2 μL of SYBR GreenⅡ), amplified at 37°C for 2 h, and fluorescence detection was performed to obtain the sample fluorescence value.
[0044] 1. Determination of particle size potential before and after coupling of Fe3O4@SA and cocaine aptamer bound to complementary nucleic acid fragments
[0045] The Fe3O4@SA before and after coupling with the cocaine aptamer bound to the complementary nucleic acid fragment was prepared into a solution with a concentration of 1 mg / mL. The Fe3O4@SA before coupling and the Fe3O4@SA-DNA after coupling were tested using Nano ZS for particle size and potential.
[0046] The results are as follows Figure 2 As shown in the figure, the particle size hardly changed before and after modification; since DNA contains abundant phosphate groups, the potential of the magnetic bead surface decreased slightly after DNA modification.
[0047] 2. Determination of the Bio-FITC reaction before and after coupling of Fe3O4@SA and cocaine aptamers bound to complementary nucleic acid fragments
[0048] Take 2 mL of Biotin-Fitc with a concentration of 0.01 μg / mL in a four-way cuvette, add 300 μL of Fe3O4@SA with a concentration of 1 mg / mL, and detect the fluorescence every 5 seconds in kinetic mode.
[0049] Take 2 mL of Biotin-Fitc with a concentration of 0.01 μg / mL in a four-way cuvette, add 300 μL of Fe3O4@SA-DNA with a concentration of 1 mg / mL, and detect the fluorescence every 5 seconds in kinetic mode.
[0050] The results are as follows Figure 3As shown in the figure, at the beginning of adding Fe3O4@SA, the fluorescence signals of both groups of magnetic beads with and without DNA modification decreased. This is because the FRET effect between Fe3O4 and Biotin-Fitc caused the partial quenching of Biotin-Fitc fluorescence. However, when the fluorescence signal reached a stable state, the fluorescence signal of the Fe3O4@SA-DNA group was higher than that of Fe3O4@SA, which indicated that Biotin-Fitc combined with Fe3O4@SA, enhanced the FRET effect, and caused the fluorescence signal of this group to decrease. This result indicated the successful modification of DNA in the Fe3O4@SA-DNA group.
[0051] 3. Template preparation and target sequence amplification verification
[0052] Prepare 15% Page gel, transfer it to the electrophoresis tank after solidification, add electrophoresis buffer TBE, add the prepared sample to the channel, adjust the voltage to 120V and electrophoresis for 100 minutes. After the electrophoresis is completed, peel the gel from the glass plate and place it in a staining box containing YeaRedNucleic acid Gel Stain to soak and stain for 30 minutes, then soak it in pure water for 5 minutes for cleaning, and place the stained gel into the ChemiDoc XRS + Detection in the instrument.
[0053] The results are as follows Figure 4 As shown in the figure, in the channel without DNA ligase, the band of the unprocessed template can be seen; after adding DNA ligase, the DNA ligase connects the 5' end and 3' end of the unprocessed template to form a circular template, and the band is lower than the unprocessed template, which proves the successful preparation of the circular template; the prepared template is used for rolling circle amplification verification, as shown in the figure. Figure 5 As shown, compared with the standard sequence, the target sequence band can be observed after amplification, proving that the rolling circle amplification system can be used for the amplification of the target sequence.
[0054] IV. Detection of fluorescence signals of complementary nucleic acid fragments amplified at different concentrations
[0055] Take 1 μM of complementary nucleic acid fragments and dilute them to three concentrations of 1 nM, 2 nM and 5 nM respectively, take 5 μL of the four concentrations of complementary nucleic acid fragments and place them in PCR tubes, and add 1.6 μL of the prepared template with a concentration of 5 μM, 0.6 μL of Phi29 DNA polymerase, 1 μL of Nt.BbvCI nicking endonuclease, 1.8 μL of dNTP, 2 μL of 10xNEB buffer, 2 μL of 10xPhi29 DNA polymerase buffer, 2 μL of 10xrCutSmart buffer, 2 μL of H2O, and 2 μL of SYBR GreenⅡ, amplify at 37°C for 2 h, and use a fluorimeter for quantitative detection.
[0056] The results are as follows Figure 6 As shown, as the target concentration increases, the fluorescence signal becomes concentration-dependent, proving that the rolling circle amplification system can be used for target fragment detection.
[0057] 5. Testing cocaine standard solutions of different concentrations
[0058] The cocaine detection sensor was mixed with 1 nM cocaine standard solution, 5 nM cocaine standard solution, 20 nM cocaine standard solution, 50 nM cocaine standard solution or 200 nM cocaine standard solution at a volume ratio of 9:1, incubated at 25 °C for 30 min, and magnetically separated to obtain the supernatant of 1 nM cocaine standard solution, 5 nM cocaine standard solution, 20 nM cocaine standard solution, 50 nM cocaine standard solution and 200 nM cocaine standard solution. 5 μL of 1 nM cocaine standard solution supernatant, 5 nM cocaine standard solution supernatant, 20 nM cocaine standard solution supernatant, 50 nM cocaine standard solution supernatant and 200 nM cocaine standard solution supernatant were added to their respective rolling circle amplification systems (1.6 μL of 5 μM template, 0.6 μL of Phi29 DNA polymerase, 1 μL of Nt.BbvCI nicking endonuclease, 1.8 μL of dNTP, 2 μL of 10xNEB buffer, 2 μL of 10xPhi29 DNA polymerase buffer, 2 μL of 10xrCutSmart buffer, 2 μL of H2O, and 2 μL of SYBR GreenⅡ), amplified at 37°C for 2 h, and detected by fluorescence quantitative analysis.
[0059] The results are as follows Figure 7 As shown, the fluorescence signal showed concentration dependence as the concentration increased, proving that this system can be used for cocaine detection.
[0060] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.
Claims
1. A cocaine aptamer, characterized in that The nucleotide sequence of the cocaine aptamer is shown in SEQ ID NO.
1.
2. The cocaine aptamer according to claim 1, characterized in that The cocaine aptamer also carries a detectable label.
3. The cocaine aptamer according to claim 2, characterized in that The detectable marker includes one or more of biotin, chemiluminescent groups, chemical fluorescent groups, fluorescent proteins, enzymes, colloidal gold, radioisotopes, latex particles, antibodies, ligands, antigens or receptors.
4. Use of the cocaine aptamer according to any one of claims 1 to 3 in preparing a cocaine detection sensor.
5. A cocaine detection sensor prepared using the cocaine aptamer according to any one of claims 1 to 3, characterized in that: The cocaine detection sensor is prepared from a cocaine aptamer bound to a complementary nucleic acid fragment and biotin-modified Fe3O4; The nucleotide sequence of the complementary nucleic acid fragment is shown in SEQ ID NO.
2.
6. The method for preparing a cocaine detection sensor according to claim 5, characterized in that: The following steps are involved: (1) 20 μL of a cocaine aptamer having a concentration of 0.1 to 10 μM and 20 μL of a complementary nucleic acid fragment having a concentration of 0.1 to 10 μM were mixed, and heated at 95° C. for 5 min to obtain a cocaine aptamer bound to the complementary nucleic acid fragment; (2) 10 μL of 10 mg / mL biotin-modified Fe3O4 was washed twice with PBS buffer and then resuspended with 10 mM Tris-HCl buffer to obtain a 1 mg / mL biotin-modified Fe3O4 solution. The biotin-modified Fe3O4 solution was mixed with the cocaine aptamer bound to the complementary nucleic acid fragment obtained in step (1), and reacted at 15-35° C. for 0.5 h to obtain a cocaine detection sensor.
7. Use of the cocaine detection sensor according to claim 5 or the cocaine detection sensor prepared by the preparation method according to claim 6 in preparing a cocaine detection reagent.
8. A method for detecting cocaine using the cocaine detection sensor as claimed in claim 5, characterized in that: The following steps are involved: S1. The cocaine detection sensor is mixed with the sample to be tested, incubated at 15-35° C. for 30 min, and magnetically separated to obtain the sample supernatant. The sample supernatant is added to the rolling circle amplification system, amplified at 37° C. for 2 h, and fluorescence detection is performed to obtain the sample fluorescence value.
9. The method for detecting cocaine according to claim 8, characterized in that: The volume ratio of the cocaine detection sensor and the sample to be tested in S1 is 9:
1.
10. The method for detecting cocaine according to claim 8, characterized in that: The rolling circle amplification system described in S1 is: 5 μL sample supernatant, 1.6 μL template, 0.6 μL Phi29 DNA polymerase, 1 μL Nt.BbvCI endonuclease, 1.8 μL dNTP, 2 μL 10xNEB buffer, 2 μL 10xPhi29 DNA polymerase buffer, 2 μL 10xrCutSmart buffer, 2 μL H2O, and 2 μL SYBR GreenⅡ.