Santalwood auxin response factor SaARF7 and application thereof

Abstract

The application discloses a sandalwood auxin response factor SaARF7 and application thereof. A transcription factor SaARF7 (nucleotide sequence as shown in SQE ID NO. 1) responding to auxin in an early stage is screened and cloned by combining phenotype of auxin regulation of sandalwood seedling vascular tissue development with omics and molecular biology technical means, and application of the transcription factor SaARF7 is disclosed. Overexpression of the SaARF7 can increase above-ground stem and underground part biomass of a plant, promote secondary xylem maturation and not cause deformation; in a symbiotic process, the SaARF7 overexpression strain has promoting effects on the number of haustoria of a parasitic plant, plant height and fruit setting. Especially under a low-phosphorus condition, the SaARF7 and the parasitic plant accompanying the SaARF7 both have stronger adaptability. The above results provide a theoretical basis for studying functions of ARF family genes of sandalwood in a vascular development process, and also provide practical basis for subsequent culture of high-value parasitic plants under poor soil conditions (such as a low-phosphorus condition).

Description

Technical fields:

[0001] This invention belongs to the field of biotechnology, specifically relating to a sandalwood auxin response factor SaARF7 and its applications. Background technology:

[0002] Sandalwood (Santalum album L.) is one of the most economically valuable tree species in the genus Santalum, renowned worldwide for its mature roots and heartwood, and the high-quality sandalwood oil extracted from them. my country is not the country of origin for sandalwood. Years of cultivation experience have shown that, in addition to its long growth cycle, the semi-parasitic nature of its roots affects the development of its above-ground stems and underground parts, consequently impacting overall biomass accumulation and essential oil production. Slow wood development and semi-parasitic nature are direct factors restricting the quality and yield of sandalwood, significantly limiting its development and impacting the income and production enthusiasm of farmers.

[0003] As organs unique to parasitic plants, haustoria act as physiological bridges for transporting nutrients and water between the parasite and the host. Unlike holoparasites, the haustoria produced in sandalwood roots connect to the xylem inside the host root, absorbing water and inorganic salts from the host root. Plant growth and development are closely related to endogenous hormones, among which auxin, as a central hub connecting other hormone metabolic pathways and signaling molecule pathways, regulates multiple biological processes in plant development. Auxin concentration is regulated by various factors, including auxin synthesis and metabolic rates, and intracellular and extracellular transport. Auxin response factors (ARFs) are an important class of transcription factors that respond early to auxin signals. They can bind to specific auxin response element sequences, activating or inhibiting the expression of downstream genes, playing important roles in organogenesis and secondary vascular tissue development. The number of members in the ARF gene family varies considerably among different species, ranging from a dozen to several dozen, and the functional studies of different ARF subfamily genes or proteins within this family have received considerable attention. Previous studies on the function of ARF family gene members have focused on non-parasitic plants, while no relevant reports have been found on the function of ARF transcription factors in parasitic plants. Our previous research showed that auxin can effectively promote the development of lateral roots and haustoria in sandalwood. Combining omics and bioinformatics techniques, we screened a transcription factor SaARF7 that responds to auxin signals. We then used molecular biology, genetics, morphology, and histochemical staining techniques to study its function. The results showed that overexpression of SaARF7 can promote the accumulation of biomass in both aboveground and underground parts of the plant, accelerate the maturation of secondary xylem, and play an active role in the parasitic process. This information was not available in previous studies. Summary of the Invention:

[0004] This invention provides a gene SaARF7 that responds to auxin-regulated haustorium development and its applications.

[0005] This invention obtained a gene, SaARF7, that responds to auxin signals through screening and cloning. The SaARF7 gene shown in SEQ ID No. 1 was ligated into a plant expression vector to obtain a SaARF7 overexpression recombinant vector. This vector was then transformed into Agrobacterium to obtain an overexpression recombinant strain with a fusion flag, which was then transformed into plants.

[0006] The nucleotide sequence of the sandalwood auxin response factor SaARF7 of the present invention is shown in SEQ ID NO.1.

[0007] The present invention also provides a protein encoded by the sandalwood auxin response factor SaARF7, the amino acid sequence of which is shown in SEQ ID NO.2.

[0008] This invention also provides the application of the aforementioned sandalwood auxin response factor SaARF7 in regulating the biomass of the aboveground and underground parts of the plant and the maturation of the secondary xylem.

[0009] Preferred method is to overexpress the sandalwood auxin response factor SaARF7, which can increase the biomass of the aboveground and underground parts of the plant, promote the maturation of secondary xylem, and prevent malformation.

[0010] The plant can be any kind of plant, such as sterile Nicotiana benthamiana.

[0011] This invention also provides the application of the aforementioned sandalwood auxin response factor SaARF7 in regulating plant height and fruit set during the symbiotic process, thereby enhancing its ability to adapt to adversity.

[0012] Preferably, during the co-existence process, the overexpression of the sandalwood auxin response factor SaARF7 not only promotes the plant height and fruit set of the parasitic plant, but also results in relatively less impact from the parasitic plant itself. Under phosphorus-deficient culture conditions, both the parasitic plant co-existing with the overexpression of the sandalwood auxin response factor SaARF7 and the parasitic plant itself exhibit stronger adaptability.

[0013] The parasitic plant can be any parasitic plant that uses tobacco as its host, such as Artemisia argyi.

[0014] The present invention also provides a method for increasing the biomass of the aboveground and underground parts of a plant and promoting the maturation of secondary xylem without causing deformities, which is to overexpress the sandalwood auxin response factor SaARF7 in the plant.

[0015] The present invention also provides a method for promoting the plant height and fruit set of parasitic plants and improving their phosphorus deficiency adaptability, which involves overexpressing the santalin response factor SaARF7 in tobacco and then allowing the tobacco to coexist with the parasitic plant.

[0016] The parasitic plant can be any parasitic plant that uses tobacco as its host, such as Artemisia argyi.

[0017] This invention investigates the effects of auxin on the vascular tissue development of haustoria in sandalwood seedlings. A gene, SaARF7, responsive to auxin and highly expressed in haustoria and stems, was screened and cloned. Overexpression of SaARF7 increased the biomass of both aboveground and belowground parts of the plant, promoted secondary xylem maturation without causing malformation, and during symbiotic relationships, strains overexpressing SaARF7 not only promoted the height and fruit set of the parasitic plant but also showed relatively less influence from the parasitic plant itself. Particularly under phosphorus-deficient culture conditions, both the parasitic plant associated with the overexpressing SaARF7 strain and the strain itself exhibited stronger adaptability. This indicates that SaARF7 plays a positive role in parasitism. These results provide a theoretical basis for studying the function of ARF family genes in vascular development in sandalwood and also provide practical evidence for subsequent cultivation of high-value parasitic plants in phosphorus-deficient environments. Attached image description:

[0018] Figure 1 Phenotypic effects of auxin on haustorium vascular development in sandalwood seedlings.

[0019] A and B are morphological images of the underground parts of seedlings grown for 30 days under IAA and control conditions, respectively; C and D are microscopic sections (PAS stained) of the haustoria on the roots of IAA and control treatments, respectively. Figure 1 AB, scale: 2cm; Figure 1 CD, scale bar: 75μm.

[0020] Figure 2 Analysis of the expression pattern of the SaARF7 gene.

[0021] A shows the expression pattern of the SaARF7 gene in different organs and tissues of sandalwood; B shows the response of the SaARF7 gene in the haustorium to auxin.

[0022] Figure 3 This is a gel image of PCR amplification of the SaARF7 gene.

[0023] L1-L3 are the amplification products of the SaARF7 gene under annealing temperatures of 65℃, 60℃ and 57℃, respectively; M is the Trans2K marker.

[0024] Figure 4 This is a vector map of the SaARF7 gene overexpression plasmid.

[0025] Figure 5 For the identification and screening of transgenic strains.

[0026] A and B are gel images used to identify transgenic lines at the DNA level; C is a graph used to identify the expression level of the SaARF7 gene in transgenic lines at the mRNA level.

[0027] Figure 6 The image shows the microstructure of the stem of the SaARF7-OX3 transgenic line.

[0028] A, B, C, and D are phloroglucinol staining images of sections of wild-type IN10, overexpressing IN10, wild-type IN20, and overexpressing IN20, respectively; E is a statistical table of secondary xylem width, stem width, and aboveground and underground biomass. Figure 6 AD, scale bar: 200μm.

[0029] Figure 7 Morphological diagram of SaARF7-OX3 transgenic line in association with Artemisia argyi.

[0030] A shows the morphological characteristics of plants cultured under sterile conditions for 7 days; B shows the morphological characteristics of plants cultured under soil conditions for 50 days; C shows the morphological characteristics of Artemisia argyi seeds. Figure 7 A, Scale: 1cm; Figure 7 B, Scale: 4cm; Figure 7 C, scale bar: 400μm. Figure 8 The SaARF7-OX3 transgenic line responds to phosphorus deficiency. Scale bar: 3cm. Detailed implementation method:

[0031] Example 1: Effects of auxin on the development of sandalwood seedlings

[0032] Sandalwood seedlings of uniform development, approximately 20 days after sowing, were selected and treated with 10 μM IAA (treatment group reagent) and DMSO (control group reagent), respectively. Achera organs on the roots of both the control and treatment groups, after 30 days of growth, were fixed using a mixture of 2.5% glutaraldehyde (Aladdin) and 2% paraformaldehyde (AlfaAesar). After routine semi-thin section preparation and sectioning, the sections were stained with PAS staining solution. Preliminary phenotypic observation results showed that, compared with the control group seedlings, IAA promoted the development of lateral roots and haustoria in sandalwood. Figure 1 (A and B). Microscopic results showed that IAA treatment induced the premature formation and maturation of vascular tissue within the haustorium, resulting in a flattened disc-shaped haustorium anterior end; compared to the control, IAA treatment effectively promoted the accumulation of carbohydrates in the cortex interior and central region. Figure 1 (C and D).

[0033] Example 2: Cloning and Expression Pattern Analysis of the SaARF7 Gene

[0034] Based on transcriptomic data and auxin treatment data from early haustorium development, significantly differentially expressed genes potentially related to haustorium development were screened. One member of the ARF family was identified, showing an upregulated expression trend during the development of both young and mature haustoriums compared to roots. Following the naming rules based on homologous gene similarity, this gene was annotated as Sandalwood ARF7 (SaARF7).

[0035] RNA was extracted from the haustorium of one-year-old sandalwood trees. 1 μg of RNA was reverse transcribed into cDNA. The sequence was searched using an in-group database, and SaARF7 cloning primer pairs (SaARF7-F: 5'-ATGCCGGCGAGCGGCGGCTT-3'; SaARF7-R: 5'-TCAAGCGTTCCCACCGTCAGAGC-3') were designed for PCR amplification. The 20 μL amplification system consisted of: 10 μL Super Pfx mixture, 1 μL SaARF7-F, 1 μL SaARF7-R, 1 μL cDNA, and 7 μL Nuclease-free water. The amplification program was set as follows: 98℃ for 2 min; 98℃ for 10 s, 57℃ for 15 s, 72℃ for 1 min, for a total of 30 cycles; 72℃ for 10 min. Agarose gel electrophoresis showed that a gene band of the target size, approximately 3300 bp, was obtained. The amplification product was recovered using a gel extraction kit and ligated into the pEASY-Blunt Zero cloning vector (FullGold) to obtain pEASY-Blunt-zero-SaARF7. Sequencing revealed a 3300 bp nucleotide sequence (SEQ ID No. 1) and an 1100-amino acid protein sequence (SEQ ID No. 2) encoding the SaARF7 gene.

[0036]

[0037] GCATAGCTGCAGGAGGGGGGCAGTCAGGTTATACAGATGATGTTCCGTCTTGTTCCAC

[0038] GTCCCCTTCTGCAAACAACTGCCAAAATGGTGGTTCAATCAATGGTGAATGGTAGAACC

[0039] CATCCAAGCATGGTTGTGGGGGATGAGATTATTCAGTCATCTGCCACACTCTTGAGTCC

[0040] AAGTGGTTTAGAAACTATGACAACTACTGGTAACTTAATTAAGGATTTGCCACACAAG

[0041] TCTGATATCAAGCCTTCGTTAAACATACCAAAAGTCAAGGCCAAGGTGTTTTTGCCCA

[0042] ACAAGCATACTCGAATGTTGGTGGGGCCCCAATGGATTACTTGGATACGTCATCTTCGG

[0043] CTACTTCAGTAAGCCTTTCTCAGAATGATGCCCATTTGCAGCAAAATAACCCCCCACTG

[0044] TCATTTAACCAACAGCAACAGTCGATCCTGTTTAGAAGCACGAGTCAAGAAGTGGATA

[0045] CACAGGCTGATCAGAAGACAATGTTCATTTGGCACTAGCATTGATGGTCACCTGGG

[0046] AATACCCTTAGTTTCTGACACTTTACTAACGAAGGGCATGGGAGAGTCAGGCAAGGAT

[0047] TTTTCAAATACTCTTCGTTCAGGAGGGATGCTGTCCAACTTTGAAAACTCTAGAGATG

[0048] CTCAGCAGGAACTGTCATCCTCAATGGTTTCCCAATCCTTTGGAGTTCCAGATATTGCA

[0049] TTCAATTCGATTGATTCCACCTTAAACGATGAAAGCTTTGTGAATAGGGGCCCCTGGG

[0050] CCCCACCACCGCAACTTCCAAGAATGCGGACCTTTACCAAGGTATACAAGCGTGGAG

[0051] CTGTTGGTAGGTCCATTGATATCACCCGTTATTCAGGGTATGACGAACTTAAACAAGAT

[0052] CTGGCTCGTAGATTTGGGATAGAAGGGCAACTGGAAGACCAGCAGAGGATAGGCTGG

[0053] AAACTTGTGTACCTGGATCATGAGAATGACGTGCTGCTAGTGGGAGATGATCCTTGGG

[0054] AGGAGTTTGTGAATTGCGTCCGCTGCATCAGGATTTTGTCCCCTCAAGAAGTTCAGCA

[0055] GATGAGCTTAGATGGAGATTTCGGGAACAGTGTCCTTCCACATCAGGCATGCAGCAGC

[0056] TCTGACGGTGGGAACGCTTGA(SEQ ID No.1)

[0057]

[0058] To clarify the expression pattern of the SaARF7 gene in different organs and tissues and its response to auxin, RNA was extracted from the terminal buds, leaves, stem segments, flowers, roots, young haustoria, mature haustoria, and callus of *Santalum album* using a rapid RNA extraction kit. RNA was also extracted from haustoria treated with IAA for 0 h, 15 min, 1 h, 2 h, 6 h, and 18 h. cDNA synthesis for each sample used 1 μg of RNA, genomic DNA remover, and... The RT / RI enzyme mixing system (TransGen, Beijing, China) was used. The reaction volume was 20 μL, with 5 volumes of deionized water added and mixed thoroughly by pipetting. The mixture was then frozen at -20°C for later use. Gene expression levels were detected using an ABI 7500 qRT-PCR system. 2 μL of cDNA, gene-specific primers, and... were added sequentially to the 20 μL qRT-PCR system. Green qPCR SuperMix system. SaACTIN was used as an internal control, with three biological replicates per sample. Relative gene expression levels were measured using 23... -ΔΔCt Formula calculation.

[0059] The specific primer sequences are as follows:

[0060] qSaARF7-F: 5'-CAGCAGCAATCTTCTCCTCTT-3';

[0061] qSaARF7-R: 5'-GTGGTTGGTTATGGCCTAGAAT-3'.

[0062] qSaACTIN-F: 5'-GTCACACGGTGCCAATCTAT-3';

[0063] qSaACTIN-R: 5'-TACCCTCTCTCAGTCAGAATCTT-3'.

[0064] Experimental results showed that, compared with other organs and tissues, the SaARF7 gene was highly expressed in stems, young haustoria, and mature haustoria. Figure 2 A); and SaARF7 gene expression is induced by IAA ( Figure 2 B).

[0065] Example 3: Construction of SaARF7 gene overexpression vector

[0066] 50 μL system: Using pEASY-Blunt-zero-SaARF7 sequencing plasmid as a template, add F1 and R1 primers of the pBWA(V)BS-3×flag-ccdB vector repeat sequence, 2×Biorun Pfu PCR Mix, and Nuclease-free to amplify the target fragment. After 1% agarose gel electrophoresis, excise the target band (approximately 3300 bp). Figure 3 It was then recovered, and the recovered product was labeled as rSaARF7.

[0067] The primer sequences are as follows:

[0068] F1: 5'-gattataaagatgatgatgatgataaaATGCCGGCGAGCGGCGGCTT-3';

[0069] R1: 5'-gtactgaagacagagctagttacaTCAAGCGTTCCCACCGTCAGAGC-3'.

[0070] The pBWA(V)BS-3×flag-ccdB vector (Biorun) was digested with BsaI in a 20 μL system and incubated at 37 °C for 1 h. The digested product was then purified using a PCR purification kit and labeled as pBWA(V)BS-3×flag-ccdB(D).

[0071] Using the Seamless Cloning Kit (#RDA01), rSaARF7 and pBWA(V)BS-3×flag-ccdB(D) were recombined, and 5 μL of the ligation product was transformed into DH5α *E. coli* competent cells (Biorun). Transformation was performed according to the manufacturer's instructions, and the cells were plated on kanamycin-resistant LB agar plates and incubated at 37°C for 12 h. Single colonies were picked for inoculation and subsequent PCR identification. The following primers were used for identification:

[0072] 35seq-F:5'-TTCATTTGGAGAGAACACGGGGGAC-3';

[0073] SaARF7-1R:5'-CCGAAAGCCTCTTTCCACT-3'.

[0074] The target band is approximately 731 bp. Bacterial cultures corresponding to 1-3 positive bands are sent to the company for sequencing. The plasmids with correctly sequenced bands are retained and named pBWA(V)BS-3×flag-SaARF7 plasmid. Figure 4 The plasmid, abbreviated as SaARF7-OX, is a fusion of SaARF7 and FLAG.

[0075] Example 4: Genetic transformation of SaARF7-OX plasmid and identification and screening of positive lines

[0076] Add 1 μL of SaARF7-OX plasmid to 50 μL of GV3101 Agrobacterium competent cells, mix thoroughly, and then transfer to an electroporation cuvette. After electroporation, add 1 mL of LB liquid medium, mix thoroughly, and then transfer to a 1.5 mL centrifuge tube. Incubate at 30°C and 180 rpm for 30 min with shaking. Inoculate 50 μL of the activated Agrobacterium culture onto resistant LB solid medium and incubate in the dark at 30°C for 48 h. Select single colonies for colony PCR. Positive control and detection colonies should have clear and correctly sized bands on electrophoresis, while the negative control should have no band. Select positive single colonies for activation, amplification, and subsequent transformation. Transformation was performed using the conventional leaf disc method. Following co-culture (MS + 2 mg / L 6-BA + 0.2 mg / L NAA), resistance selection (MS + 2 mg / L 6-BA + 0.2 mg / L NAA + 15 mg / L Basta + 300 mg / L cephalosporin), shoot induction culture (MS + 0.2 mg / L 6-BA + 0.1 mg / L NAA + 15 mg / L Basta + 300 mg / L cephalosporin), and rooting culture (1 / 2 MS + 15 mg / L Basta + 100 mg / L cephalosporin), a batch of plants for identification was obtained. Thirty-eight transgenic plants, approximately 8 cm in length and with vigorous root growth, were labeled with corresponding numbers No. 1-No. 38. Genomic DNA was extracted from the terminal lobes of mature leaves using the CTAB method and analyzed by PCR. T0 generation positive seedlings were initially screened using BAS-F and BAS-R. BAS-F: 5'-CGGCGACGAGCCAGGGATA-3'; BAS-R: 5'-GCACCATCGTCAACCACTACAT-3'. Agarose gel electrophoresis results showed that 25 samples (25 / 38) had clear bands at the target location. Figure 5 A). Transplant T0 generation positive seedlings into pots containing sterile soil and vermiculite (volume ratio 1:1) for cultivation until they produce mature seeds.

[0077] A suitable amount of collected T0 generation positive seedlings were first soaked in 75% alcohol for 30 seconds in a clean bench, followed by treatment with 6% sodium hypochlorite for 5 minutes. After brief centrifugation and removal of the supernatant, the seeds were washed four times with sterile water. After drying on sterile filter paper, the seeds were evenly scattered onto MS medium containing herbicide resistance (15 mg / L) using pipette tips. After approximately 10 days, seedlings with green leaves and normal development were selected and transplanted into pots containing sterile nutrient soil for further cultivation. After two rounds of screening and planting, the T3 generation transgenic lines and wild-type were used as materials for subsequent research.

[0078] DNA was extracted from T3 generation SaARF7 transgenic leaves and wild-type tobacco leaves, and primers were identified using 35seq- and SaARF7-1R. Figure 5 B). RNA was extracted from T3 generation SaARF7 transgenic tobacco leaves and wild-type tobacco leaves, and reverse transcribed into cDNA. Wild-type Nicotiana benthamiana was used as a control, and the NbACTIN gene was used as an internal control. The sequence is as follows:

[0079] qNbACTIN-F:5'-TGCAAAGACCAGCTCTTCTG-3';

[0080] qNbACTIN-R:5'-ATTCCTGCAGCTTCCATTCC-3'.

[0081] The expression level of the SaARF7 gene in transgenic lines was detected using qRT-PCR. The results showed that the relative expression level of the gene was highest in the transgenic line SaARF7-OX3 compared to other samples. Figure 5 C).

[0082] Example 5: Overexpression of SaARF7 induces secondary xylem thickening

[0083] To investigate the effects of SaARF7 gene overexpression on plant growth and development, the stably expressing SaARF7-OX3 line was selected for further research. Plant height, stem diameter, and number of lateral roots were measured in transgenic and wild-type lines after two months of growth. Statistical results showed that compared to the wild-type (WT) line, the SaARF7-OX3 line showed no significant change in plant height, but a significantly increased number of lateral roots; the middle and basal stems were generally wider than those of the WT line. To further clarify its effect on stem width, freehand sections of the 10th and 20th nodes of the SaARF7-OX3 and WT lines were prepared, with a section thickness of approximately 30 μm. Preliminary morphological observations indicated that SaARF7 overexpression affects secondary xylem formation. The cross-sections of each sample section were stained with 1% phloroglucinol. After staining for 30 seconds, 1-2 drops of 25% hydrochloric acid were added, and the sections were covered with coverslips and observed under a microscope. Figure 6 As shown in AD, the results of phloroglucinol staining were consistent with the preliminary observations. Compared with WT, the secondary xylem regions of the 10th and 20th nodes of the stem of the SaARF7-OX3 strain were significantly larger, approximately 1.2 and 1.5 times the width of WT, respectively; the stem width of the SaARF7-OX3 strain was 1.47 and 1.5 times that of WT, respectively. Figure 6 E). In addition, compared with WT, the SaARF7-OX3 line accumulated more upper stem and underground root biomass (dry weight).

[0084] Example 6: Function of SaARF7-OX3 in the Parasitic Process

[0085] Using the herbaceous parasitic plant Artemisia argyi as the parasitic plant, and SaARF7-OX3 and wild-type tobacco as the hosts, the effects of SaARF7 gene overexpression on the development and parasitism process of the parasitic plants were studied. The specific implementation methods are as follows:

[0086] Take an appropriate amount of Artemisia argyi seeds, treat with 0.6% sodium hypochlorite for 5 minutes, rinse 4-5 times with sterile water, dry on sterile filter paper, and inoculate into 1 / 2 MS medium. Take an appropriate amount of SaARF7-OX3 seeds, and disinfect and screen them as described in Example 4. After culturing for 8 days, transfer Artemisia argyi, SaARF7-OX3 seedlings, and WT seedlings to a medium containing only agar and water for pre-culturing for 2 days. Divide the above materials into two batches, one batch for aseptic culture and the other batch for soil culture.

[0087] Aseptic culture involved transferring Artemisia argyi and tobacco to 1 / 2 MS solid plates, and then placing the root tips of Artemisia argyi in contact with the root tips of SaARF7-OX3 and WT plants for co-cultivation. Soil culture involved transplanting the aforementioned Artemisia argyi and tobacco plants, which had been pre-cultured for 2 days and had their root tips in contact, together into a square pot containing sterile nutrient soil and vermiculite (volume ratio 1:1) for co-cultivation.

[0088] like Figure 7 As shown, after 7 days of aseptic culture under normal conditions, the root length and number of lateral roots of the SaARF7-OX3 strain were superior to those of the wild type. The number of haustoria associated with SaARF7-OX3 was 8, of which 4 had established vascular connections with the roots of SaARF7-OX3. Figure 7 A). Considering the relatively abundant nutrients in the early stages of cultivation, and given that *Artemisia argyi* is a semi-parasitic plant, in addition to absorbing nutrients through parasitism with tobacco, its roots can also directly absorb some nutrients from the culture medium at this stage. We maintained continuous observation of the various strains cultured in soil as an adjoining culture. The results are as follows: Figure 7 As shown in Figure B, there were significant differences between *Artemisia argyi* and its various strains after 50 days of companion culture. *Artemisia argyi* grown with WT tobacco was inferior in both plant height and fruit set. Figure 7 B) As the parasitic relationship gradually establishes and nutrients become scarce, *Artemisia argyi* needs to absorb more nutrients from the host, resulting in overall stunted growth and poor development in WT tobacco. However, *Artemisia argyi* plants associated with SaARF7-OX3 exhibit generally greener leaves, larger pods, and more abundant, plump seeds. Figure 7 C); The SaARF7-OX plant itself has a certain resistance to parasitic plants, and its well-developed secondary xylem and root system can obtain more nutrients from the soil to meet its needs. After two months of companion growth, the SaARF7-OX3 plant height is approximately twice the WT ( Figure 7 B).

[0089] Example 7: Response of the SaARF7-OX3 strain to phosphorus deficiency

[0090] In the early stages of Artemisia annua cultivation, it was observed that if no additional fertilizer was applied during the later stages of soil cultivation, the leaves tended to turn purple, suggesting that its development might be affected by soil phosphorus content. Based on data obtained under previous stress conditions, compared with WT, the expression levels of genes responding to phosphorus deficiency and stress resistance genes in the SaARF7-OX3 strain were significantly upregulated. To investigate the effect of the SaARF7-OX3 strain on phosphorus deficiency during companion cultivation, we selected Artemisia annua cultured under aseptic conditions for 7 days (Example 6) and various strains as materials. These were transferred to a medium containing 1 / 3 phosphorus for 20 days and then transplanted into pots containing vermiculite, watered every 3 days. The results showed that WT tobacco and Artemisia annua plants grown alongside WT tobacco were generally stunted, with purple leaves; the leaves of Artemisia annua grown alongside SaARF7-OX3 tobacco were partially greenish, and the plant height was approximately twice that of the former. Figure 8 This indicates that the SaARF7-OX3 strain can not only adapt to short-term phosphorus-deficient environments but also plays a positive role in helping associated parasitic plants resist phosphorus deficiency.

Claims

1. Sandalwood auxin response factor SaARF7, characterized in that, The nucleotide sequence is shown in SEQ ID NO.

1.

2. The protein encoded by the sandalwood auxin response factor SaARF7 according to claim 1, characterized in that, The amino acid sequence is shown in SEQ ID NO.

2.

3. The application of overexpression of the sandalwood auxin response factor SaARF7 as described in claim 1 to increase the biomass of tobacco aboveground and underground parts, and to increase the width of secondary xylem in the middle stem, the width of the middle stem, the width of secondary xylem in the basal stem, and the width of the basal stem.

4. A method for promoting the plant height and fruit set of the parasitic plant Artemisia annua and improving its phosphorus deficiency tolerance, characterized in that, The method involves overexpressing the sandalwood auxin response factor SaARF7 as described in claim 1 in tobacco, and then subjecting the tobacco to symbiosis with the parasitic plant Artemisia argyi.

Images