Primer combination, reagent combination, kit, and application and method for identifying Echinococcus granulosus G1 type and Echinococcus multilocularis

Abstract

The present invention relates to the field of biotechnology, and in particular to primer combinations, reagent combinations, kits, and their applications and methods in identifying Echinococcus granulosus G1 type and Echinococcus multilocularis. The present invention is based on the principle of recombinase polymerase amplification combined with lateral flow chromatography test strips, designs specific primers for the mitochondrial genomes of Echinococcus granulosus G1 type and Echinococcus multilocularis, and achieves accurate identification of Echinococcus granulosus G1 type and Echinococcus multilocularis by optimizing the concentrations of relevant reagents and reaction conditions. The present invention has high sensitivity, strong specificity, high accuracy, and good repeatability. In addition, the entire detection process is convenient and fast, requiring only a constant temperature heating instrument and no other expensive instruments. The present invention greatly shortens the detection time of pathogens and reduces the equipment conditions required for detection, thereby meeting the needs of rapid detection of Echinococcus granulosus G1 type and Echinococcus multilocularis on-site or at grassroots units, and has broad application prospects.

Description

Technical Field

[0001] The present invention relates to the field of detection technology, and in particular to a primer combination, a reagent combination, a kit, and their applications and methods in identifying Echinococcus granulosus G1 type and Echinococcus multilocularis. Background Art

[0002] Echinococcus, commonly known as hydatid disease, is a chronic zoonotic parasitic disease caused by the larvae of the tapeworm Echinococcus. It is one of the 17 neglected tropical diseases (NTDs) designated by the World Health Organization (WHO). Cystic echinococcosis (CE), caused by Echinococcus granulosus, and alveolar echinococcosis (AE), caused by Echinococcus multilocularis, are the two most common types of the disease. They are widely distributed worldwide and pose serious risks to public health and economic development.

[0003] Detection and diagnosis of Echinococcus and echinococcosis primarily utilize etiological, imaging, immunological, and molecular biological methods. Etiological testing is the classic method for confirming Echinococcus infection or echinococcosis. The WHO recommends the arecoline catharsis method and autopsy as the "gold standard" for testing. While highly accurate, these tests are time-consuming and labor-intensive, and may not comply with animal protection regulations. Imaging methods are more intuitive and reliable for diagnosing echinococcosis than other methods, making them an ideal option. While intuitive and effective, imaging methods require large equipment, are expensive, and have strict operating requirements. The diagnostic value of immunological methods for echinococcosis lies primarily in their ability to facilitate early diagnosis and large-scale epidemiological surveys. Currently, the most commonly used test for echinococcosis is the ELISA, which plays a crucial role in early detection. While immunological methods offer high sensitivity, they can produce false positives during antigen-antibody binding and can easily cross-react with other tapeworms (such as Echinococcus granulosus and Echinococcus multilocularis) or with other tapeworms (such as Taenia solium), resulting in reduced specificity and inability to distinguish or identify the type of echinococcosis infection. Among molecular biological techniques, PCR is widely used for echinococcosis detection, playing a crucial role in species identification and molecular epidemiological surveys. Methods such as nested PCR, real-time quantitative PCR, and PCR-RFLP are also crucial. While PCR methods demonstrate high sensitivity and specificity, they require specialized temperature-controlled equipment and have long reaction times, making them inadequate for efficient and effective detection. Summary of the Invention

[0004] In light of this, the present invention provides primer combinations, reagent combinations, kits, and their applications and methods for identifying Echinococcus granulosus G1 and Echinococcus multilocularis. Based on the principles of recombinase polymerase amplification combined with lateral flow chromatography test strips, the present invention designs specific primers for the mitochondrial genomes of Echinococcus granulosus G1 and Echinococcus multilocularis, enabling accurate identification of Echinococcus granulosus G1 and Echinococcus multilocularis.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] In a first aspect, the present invention provides a primer combination, comprising a first primer combination and a second primer combination;

[0007] The first primer combination is used to identify Echinococcus granulosus G1 type; the second primer combination is used to identify Echinococcus multilocularis;

[0008] The first primer combination has:

[0009] (I), the upstream primer has the nucleotide sequence shown in SEQ ID No. 1; and

[0010] The downstream primer has the nucleotide sequence shown in SEQ ID No. 2;

[0011] (II) A sequence in which one or more nucleotides are substituted, deleted, added and / or replaced based on the nucleotide sequence shown in (I); or

[0012] (III) a nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology to the nucleotide sequence as shown in any one of (I) or (II);

[0013] and / or

[0014] The second primer combination has:

[0015] (I), the upstream primer has the nucleotide sequence shown in SEQ ID No. 3; and

[0016] The downstream primer has the nucleotide sequence shown in SEQ ID No. 4;

[0017] (II) A sequence in which one or more nucleotides are substituted, deleted, added and / or replaced based on the nucleotide sequence shown in (I); or

[0018] (III) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleotide sequence shown in any one of (I) or (II).

[0019] In some embodiments of the present invention, the 5' end of the nucleotide sequence of the primer combination is modified with a chemical group;

[0020] The chemical group includes any one of Biotin, FAM fluorescent group, Digoxin and TAMRA fluorescent group;

[0021] The 5' end of the nucleotide sequence of the upstream primer of the first primer combination is modified by the biotin;

[0022] The 5' end of the nucleotide sequence of the downstream primer of the first primer combination is modified by the FAM fluorescent group;

[0023] The 5' end of the nucleotide sequence of the upstream primer of the second primer combination is modified by the Digoxin;

[0024] The 5' end of the nucleotide sequence of the downstream primer of the second primer combination is modified with the TAMRA fluorescent group.

[0025] In a second aspect, the present invention also provides use of the primer combination in preparing a reagent or kit for identifying Echinococcus granulosus G1 type and / or Echinococcus multilocularis.

[0026] In a third aspect, the present invention also provides a reagent combination, including the primer combination.

[0027] In some specific embodiments of the present invention, the reagent combination further comprises a reaction buffer, a standard positive control, a standard negative control, a starter, and RPA lyophilized powder;

[0028] The reaction buffer includes a rehydration buffer (TwistDx nfo Kit, Cambridge, United Kingdom);

[0029] The standard positive controls include Echinococcus granulosus G1 type DNA and Echinococcus multilocularis DNA;

[0030] The standard negative control includes nucleic acid-free ddH2O;

[0031] The initiator includes magnesium acetate; the concentration of the magnesium acetate is 280 mmol / L;

[0032] The RPA lyophilized powder is a commercially available product (from the TwistAmp™ Basic kit);

[0033] The concentration of the upstream primer of the first primer combination is 10 μmol / L;

[0034] The concentration of the downstream primer of the first primer combination is 10 μmol / L;

[0035] The concentration of the upstream primer of the second primer combination is 10 μmol / L;

[0036] The concentration of the downstream primer of the second primer combination is 10 μmol / L;

[0037] The concentration of the genomic DNA of Echinococcus granulosus G1 type is 50 ng / μL;

[0038] The concentration of the Echinococcus multilocularis genomic DNA is 50 ng / μL.

[0039] In some specific embodiments of the present invention, the reagent combination includes the following components based on 50 μL:

[0040] 30 μL of the reaction buffer;

[0041] 2.4 μL of the genomic DNA of the Echinococcus granulosus G1 type or the Echinococcus multilocularis;

[0042] 1.4 μL of the upstream primer in the first primer combination;

[0043] 1.4 μL of the downstream primer in the first primer combination;

[0044] 1.0 μL of the upstream primer in the second primer combination;

[0045] 1.0 μL of the downstream primer in the second primer combination;

[0046] 9.8 μL of the ddH2O;

[0047] 3 μL of the initiator.

[0048] In a fourth aspect, the present invention also provides a kit comprising the primer combination or the reagent combination.

[0049] In a fifth aspect, the present invention further provides the use of any of the following items in identifying Echinococcus granulosus G1 type and / or Echinococcus multilocularis:

[0050] (i), the primer combination; and / or

[0051] (ii), the reagent combination; and / or

[0052] (iii) the kit.

[0053] In a sixth aspect, the present invention further provides a method for identifying Echinococcus granulosus G1 and / or Echinococcus multilocularis, comprising extracting genomic DNA from a sample to be tested, amplifying it by any of the following methods, detecting it, and determining the result;

[0054] (i), the primer combination; and / or

[0055] (ii), the reagent combination; and / or

[0056] (iii) the kit.

[0057] In some specific embodiments of the present invention, the amplification temperature is 38° C., and the amplification time is 20 min;

[0058] The determination result is:

[0059] If the quality control line and any test line show color at the same time, it is determined to be positive, that is, the sample to be tested contains the Echinococcus granulosus G1 type DNA and / or the Echinococcus multilocularis DNA;

[0060] If the control line develops color but the test line does not, it is determined to be negative, that is, the sample to be tested does not contain the Echinococcus granulosus G1 type DNA and / or the Echinococcus multilocularis DNA;

[0061] If the quality control line does not show color, the experiment is judged to be invalid and the test results are invalid.

[0062] In some specific embodiments of the present invention, the method comprises the steps of:

[0063] Step 1, DNA extraction: extracting the genomic DNA of the sample to be tested in the reagent;

[0064] Step 2. Prepare the reaction system: Premix the following solutions in 50 μL:

[0065] 30 μL of the reaction buffer in the reagents;

[0066] 2.4 μL of the genomic DNA of the Echinococcus granulosus G1 type or the Echinococcus multilocularis;

[0067] 1.4 μL of the Echinococcus granulosus G1 upstream primer in the first primer combination;

[0068] 1.4 μL of the Echinococcus granulosus G1 type downstream primer in the first primer combination;

[0069] 1.0 μL of the Echinococcus multilocularis upstream primer in the second primer combination;

[0070] 1.0 μL of the Echinococcus multilocularis downstream primer in the second primer combination;

[0071] 9.8 μL of the ddH2O in the reagent.

[0072] After premixing, add the RPA lyophilized powder in the reagent to the reaction tube. After fully dissolved, add 3 μL of the starter in the reagent to obtain a prepared reaction system;

[0073] Step 3, amplification: performing constant temperature amplification on the prepared reaction system to obtain an amplified product;

[0074] Step 4, detection: dilute the amplified product with a buffer solution and dropwise add it onto the sample pad of a lateral flow chromatography test strip and let it stand;

[0075] Step 5. Determine the result: After standing, observe the lateral flow chromatography test strip. If the control line and any test line show color at the same time, it is determined to be positive, that is, the sample to be tested contains the Echinococcus granulosus G1 type DNA and / or the Echinococcus multilocularis DNA; if the control line shows color but the test line does not show color, it is determined to be negative, that is, the sample to be tested does not contain the Echinococcus granulosus G1 type DNA and / or the Echinococcus multilocularis DNA; if the control line does not show color, the experiment is determined to be invalid and the test result is invalid.

[0076] In some specific embodiments of the present invention, the sample to be tested includes but is not limited to dog feces or grass.

[0077] In some specific embodiments of the present invention, the buffer in step 4 includes but is not limited to PBST buffer; the dilution factor includes but is not limited to 50 times; and the added volume includes but is not limited to 40 μL.

[0078] In some specific embodiments of the present invention, the standing time in step 4 is 5 min.

[0079] The present invention provides primers, reagents, kits, and applications for identifying Echinococcus granulosus G1 and Echinococcus multilocularis. Sequences unique to Echinococcus granulosus G1 and Echinococcus multilocularis were identified through sequence alignment. These two unique sequences were used as candidate primer regions. Multiple RPA primers were designed and then used in PCR experiments. DNA extracted from the parasites served as the template DNA for amplification. The reaction system included template DNA, primers, dNTPs, Taq DNA polymerase, and buffer. The reaction procedure involved pre-denaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation, annealing, and extension, and a final extension at 72°C for 7 minutes. The PCR amplification products were analyzed by agarose gel electrophoresis to determine their size and specificity. It was observed that one set of primers for Eg showed a single clear band and had no cross-reactivity with Em, and subsequent specificity experiments also showed no cross-reactivity with other parasites; one set of primers for Em showed a single clear band and had no cross-reactivity with Eg, and subsequent specificity experiments also showed no cross-reactivity with other parasites. Then, a set of primers with strong specificity, high sensitivity, and the ability to quickly and effectively detect the genomic DNA of Echinococcus granulosus G1 type and Echinococcus multilocularis were screened out, and a dual RPA-LFD detection method was established by modifying the primers. The present invention provides an effective technical means for the rapid visual detection of Echinococcus granulosus G1 type and Echinococcus multilocularis, overcoming the problem that some grassroots testing laboratories are unable to conduct on-site testing due to backward equipment. The primers and probes designed by the present invention have strong specificity, can be used for the accurate diagnosis of Echinococcus granulosus G1 type and Echinococcus multilocularis, and have no cross-reaction with other types of parasites; they have high sensitivity, and the minimum nucleic acid detection limit is 10 2 copies / μL. BRIEF DESCRIPTION OF THE DRAWINGS

[0080] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the embodiments or the prior art.

[0081] Figure 1 The figure shows the results of PCR screening of Echinococcus granulosus G1 type; where M is DNA marker; F1R1 to F7R7 are primers used to amplify Echinococcus granulosus G1 type DNA, Echinococcus multilocularis DNA, and ddH2O, respectively;

[0082] Figure 2 The figure shows the results of PCR screening of Echinococcus multilocularis; M: DNA Marker; F1R1~F5R5: primers F1R1~F5R5 were used to amplify Echinococcus granulosus G1 type DNA, Echinococcus multilocularis DNA and ddH2O respectively;

[0083] Figure 3The specificity analysis of PCR results using specific primers for Echinococcus granulosus G1 and Echinococcus multilocularis is shown; where M: DNA Marker; 1-13: 1, Echinococcus granulosus; 2, Echinococcus multilocularis; 3, Taenia solium; 4, Taenia multiceps; 5, Taenia asiatica; 6, Taenia saginata; 7, Fasciola hepatica; 8, Cryptosporidium; 9, Mesorchis orientalis; 10, Clonorchis sinensis; 11, Toxoplasma gondii; 12, Cysticercus; 13, negative control;

[0084] Figure 4 The specificity analysis of RPA results using specific primers for Echinococcus granulosus G1 and Echinococcus multilocularis is shown; M: DNA Marker; 1-13: 1, Echinococcus granulosus; 2, Echinococcus multilocularis; 3, Taenia solium; 4, Taenia multiceps; 5, Taenia asiatica; 6, Taenia saginata; 7, Fasciola hepatica; 8, Cryptosporidium; 9, Mesorchis orientalis; 10, Clonorchis sinensis; 11, Toxoplasma gondii; 12, Cysticercus; 13, negative control;

[0085] Figure 5 Schematic diagram showing the condition optimization of the dual RPA-LFD of the present invention; wherein, T1 is the detection line of Echinococcus granulosus G1 type; T2 is the detection line of Echinococcus multilocularis; C is the quality control line;

[0086] The upper left corner shows a schematic diagram of the optimized reaction temperature conditions; from left to right, they are 34°C, 36°C, 38°C, 40°C, and 42°C;

[0087] The upper right corner shows a schematic diagram of the reaction time optimization conditions; from left to right, they are 16 min, 18 min, 20 min, 22 min, and 24 min;

[0088] The lower left corner shows a schematic diagram of primer ratio optimization conditions; from left to right, the ratios of Echinococcus granulosus G1 type primers / Echinococcus multilocularis primers are 1.6 / 0.8, 1.4 / 1.0, 1.2 / 1.2, 1.0 / 1.4, and 0.8 / 1.6;

[0089] The lower right corner shows a schematic diagram of sample dilution optimization conditions; from left to right, the sample is diluted 25 times, 50 times, 100 times, and 200 times;

[0090] Figure 6 Schematic diagram of the dual RPA-LFD test result determination of the present invention; wherein, T1 is the detection line of Echinococcus granulosus G1 type; T2 is the detection line of Echinococcus multilocularis; C is the quality control line; from left to right are the schematic diagram of positive result; schematic diagram of negative result; schematic diagram of invalid result; the right figure is the actual test situation corresponding to the left figure;

[0091] Figure 7Figure 2 shows the dual RPA-LFD specificity analysis of the present invention; wherein, T1 is the detection line of Echinococcus granulosus G1 type; T2 is the detection line of Echinococcus multilocularis; C is the quality control line; from left to right: Echinococcus granulosus + Echinococcus multilocularis; Echinococcus granulosus; Echinococcus multilocularis; Taenia solium; Taenia multiceps; Taenia asiatica; Taenia saginata; Fasciola hepatica; Cryptosporidium; Mesorchidism orientalis; Clonorchis sinensis; Toxoplasma gondii; Cysticercus; NC (NC is the negative control);

[0092] Figure 8 The sensitivity analysis of the dual RPA-LFD of the present invention is shown; T1 is the detection line of Echinococcus granulosus G1 type; T2 is the detection line of Echinococcus multilocularis; C is the quality control line; the concentrations from left to right are 10 8 ~10 1 copies / μL, NC (NC is the negative control). DETAILED DESCRIPTION

[0093] The present invention discloses primer combinations, reagent combinations, kits, and their applications and methods for identifying Echinococcus granulosus G1 and Echinococcus multilocularis. Those skilled in the art can refer to the disclosure herein and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications obvious to those skilled in the art are considered encompassed by the present invention. The methods and applications of the present invention have been described using preferred embodiments. It is obvious that those skilled in the art can modify, adapt, and combine the methods and applications described herein to implement and apply the technology of the present invention without departing from the content, spirit, and scope of the present invention.

[0094] Recombinase polymerase amplification combined with lateral flow chromatography (RPA-LFD) is an isothermal DNA amplification technology that relies primarily on recombinase, single-stranded binding protein (SSB), and DNA polymerase to amplify target genes at a constant temperature. This method can complete target gene amplification within 20 minutes. Compared with traditional PCR methods, the entire process does not require high-temperature denaturation and low-temperature annealing steps. It is simple to operate and takes a short time. It has been widely used in the diagnosis of viruses, bacteria, and parasites. In addition, RPA amplification products can be further combined with testing equipment such as test strips to easily read test results, making endpoint analysis more flexible and achieving accurate, rapid, and visual detection goals. This overcomes the problem that some grassroots testing laboratories are unable to conduct on-site testing due to outdated equipment.

[0095] The first object of the present invention is to provide specific primers and a detection kit thereof for identifying Echinococcus granulosus G1 type and Echinococcus multilocularis based on dual RPA-LFD.

[0096] The second object of the present invention is to provide an application of the above detection kit.

[0097] The present invention is achieved through the following technical solutions:

[0098] 1. Recombinase polymerase isothermal amplification primers for detecting and identifying Echinococcus granulosus G1 and Echinococcus multilocularis based on dual RPA-LFD, comprising:

[0099] Echinococcus granulosus G1 type upstream primer: Eg-T1-F: 5'-Biotin-TTTTTTGAGAAGTTTGTTTATGTATGTT-3'

[0100] Echinococcus granulosus G1 downstream primer: Eg-T1-R: 5'-FAM-CCACGAGACCAAGGATACCCAAAACCCA-3'

[0101] Echinococcus multilocularis upstream primer: Em-T2-F: 5'-Digoxin-CGGCGTCGCCTAAGCGGCTTGACCCTTT-3'

[0102] Echinococcus multilocularis downstream primer: Em-T2-R: 5′-TAMRA-TTAATTTATCTTGACTATTCCATTTTCT-3′;

[0103] Among them, the molecular formula of Biotin is C 10 H 16 N2O3S; the molecular formula of FAM is C 27 H 18 N2O8; the molecular formula of Digoxin is C 41 H 64 O 14 ;The molecular formula of TAMRA is C 31 H 28 N4O6.

[0104] 2. Design and preparation of the aforementioned specific primers. The design method included the following steps: obtaining the complete mitochondrial genome sequence of the Echinococcus family published in Genbank; using MEGA X software to align and analyze the sequences, selecting sequences unique to Echinococcus granulosus G1 and Echinococcus multilocularis as candidate primer regions; and screening RPA primers using Primer Explorer V5 online software (http: / / primerexplorer.jp / e / ). The preparation method is as follows: the upstream primer of Echinococcus granulosus G1 type is modified by Biotin at the 5' end in the primer sequence of TTTTTTGAGAAGTTTGTTTATGTATGTT, and the downstream primer of Echinococcus granulosus G1 type is modified by FAM fluorescent group at the 5' end in the primer sequence of CCACGAGACCAAGGATACCCAAAACCCA; the upstream primer of Echinococcus multilocularis is modified by Digoxin at the 5' end in the primer sequence of CGGCGTCGCCTAAGCGGCTTGACCCTTT, and the downstream primer of Echinococcus multilocularis is modified by TAMRA fluorescent group at the 5' end in the primer sequence of TTAATTTATCTTGACTATTCCATTTTCT.

[0105] Components of the above-mentioned detection kit for identifying Echinococcus granulosus G1 and Echinococcus multilocularis include: lyophilized RPA powder, 280 mmol / L magnesium acetate, rehydration buffer (TwistDx nfoKit, Cambridge, United Kingdom), a standard positive control, and a standard negative control. The standard positive control is genomic DNA of Echinococcus granulosus G1 and Echinococcus multilocularis (50 ng / μL), and the standard negative control is nuclease-free ddH2O.

[0106] IV. Application of the above-mentioned detection kit for the detection and identification of Echinococcus granulosus G1 and Echinococcus multilocularis. Genomic DNA is extracted from the sample to be tested (e.g., dog feces, forage) using a lysis buffer such as guanidine hydrochloride. The DNA is then amplified using the detection kit for the identification of Echinococcus granulosus G1 and Echinococcus multilocularis.

[0107] The amplification reaction system (50 μL) consisted of: 30 μL reaction buffer, 2.4 μL genomic DNA of the sample to be tested, 1.4 μL of 10 μmol / L Echinococcus granulosus G1 upstream primer, 1.4 μL of 10 μmol / L Echinococcus granulosus G1 downstream primer, 1.0 μL of 10 μmol / L Echinococcus multilocularis upstream primer, 1.0 μL of 10 μmol / L Echinococcus multilocularis downstream primer, 9.8 μL ddH2O, and 3 μL 280 mmol / L magnesium acetate.

[0108] Amplification reaction conditions: 38°C constant temperature amplification for 20 minutes. RPA can complete target gene amplification at a constant temperature of approximately 38°C. The entire process does not require high-temperature denaturation and low-temperature annealing steps, nor does it require expensive equipment (such as PCR machines). This overcomes the problem of some grassroots testing sites being unable to conduct on-site testing due to outdated equipment.

[0109] The judgment result is as follows Figure 3 If the control line and any test line develop color simultaneously, the test is considered positive and the sample contains Echinococcus granulosus G1 or Echinococcus multilocularis genomic DNA. If the control line develops color and the test line does not, the test is considered negative and the sample does not contain Echinococcus granulosus G1 or Echinococcus multilocularis genomic DNA. If the control line does not develop color, the experiment is considered unsuccessful and the test result is invalid.

[0110] The technical benefits of the above scheme are as follows: Compared with existing technologies, the primers disclosed in this invention are derived from gene sequences unique to Echinococcus granulosus G1 and Echinococcus multilocularis, selected after comparison and analysis with the mitochondrial genome of the Echinococcus family. These primers offer specific, sensitive, and efficient detection, while also being simple to operate: the enzymes and reagents required for amplification are placed in separate reaction tubes in powder form and can be stored at room temperature. Amplification only requires the addition of the appropriate buffer, primers, template, and initiator to initiate the reaction, requiring minimal operator input and making it suitable for on-site screening at grassroots testing sites. This detection kit is rapid, efficient, reproducible, and highly accurate. Compared to traditional methods, it requires no expensive instrumentation, shortens amplification time, and enables precise identification and characterization of Echinococcus granulosus G1 and Echinococcus multilocularis pathogens. Most grassroots units use PCR for testing. Compared with the PCR method, this method does not require additional temperature-changing instruments and personnel training, saving costs; compared with the 1.5h~2h detection time of the PCR method, this method can complete the detection in 0.5h at isothermal temperature, meeting the requirements of rapid on-site detection.

[0111] The comparison with other methods is shown in Table 1:

[0112] Table 1 Comparison results of various methods

[0113]

[0114] The primers, reagents, and kit for identifying Echinococcus granulosus G1 type and Echinococcus multilocularis provided by the present invention, as well as the raw materials and reagents used in their application, can all be purchased from the market.

[0115] The present invention will be further described below in conjunction with the embodiments:

[0116] Example 1

[0117] Design of RPA-specific primers for Echinococcus granulosus G1 and Echinococcus multilocularis

[0118] The complete mitochondrial genome sequences of Echinococcus granulosus published in GenBank were obtained (GenBank accession numbers: AB018440.2, AB208064.1, AB208545.1, AB208546.1, AB208063.1, AB235846.1, AB786665.1, AB732958.1, MH300929.1, MH300955.1, MK774655.1). Sequence alignment and analysis were performed using MEGA X software, and sequences unique to Echinococcus granulosus G1 (eg) and Echinococcus multilocularis (em) were selected as candidate primers. Primer Explorer V5 online software (http: / / primerexplorer.jp / e / ) was used to screen primers. A total of seven primer pairs were designed for Echinococcus granulosus G1, with Eg DNA, Em DNA, and Eg DNA as the primers. DNA and ddH2O were used as templates for PCR experiments, and the results were as follows: Figure 1 As shown, only the F7R7 group Eg had amplified bands without mixed bands and no cross-reactivity with Em. Subsequent specificity experiments also showed no cross-reactivity with other parasites. Five pairs of primers were designed for Echinococcus multilocularis. PCR experiments were performed using Eg DNA, Em DNA, and ddH2O as templates, respectively. The results are shown in Figure 1. Figure 2 As shown, only the Em in the F5R5 group had an amplified band without any mixed bands and no cross-reactivity with Eg. Subsequent specificity experiments also showed no cross-reactivity with other parasites.

[0119] The primers initially screened were used for PCR specificity experiments. The TIANGEN blood / cell / tissue genomic DNA extraction kit (DP304) was used to extract genomic DNA of Echinococcus granulosus G1 type, Echinococcus multilocularis, Taenia solium, Taenia multiceps, Taenia asiatica, Taenia saginata, Fasciola hepatica, Cryptosporidium, Mesorchidism orientalis, Clonorchis sinensis, Toxoplasma gondii, and Cysticercus truncatus (all of the above parasites were from the laboratory of the applicant of the present invention) and ddH2O as template DNA for PCR amplification reaction. The reaction system included template DNA, primers, dNTPs, Taq DNA polymerase, buffer, etc. The reaction procedure was pre-denaturation at 95℃ for 5 min, followed by 30 cycles of denaturation, annealing, and extension, and finally extension at 72℃ for 7 min. The PCR amplification products were detected by agarose gel electrophoresis to observe the size and specificity of the amplified products. The results are as follows. Figure 3As shown, primer F7R7 was observed to produce a single clear band only in the eg group, indicating no cross-reactivity with other parasites; primer F5R5 was observed to produce a single clear band only in the em group, indicating no cross-reactivity with other parasites. Subsequently, RPA specificity experiments were performed, and the reactants were added according to the above system for RPA amplification, and amplification was performed at 38°C for 20 minutes. The RPA amplification products were detected by agarose gel electrophoresis to observe the size and specificity of the amplified products. The results are shown in Figure 1. Figure 4 As shown, primer F7R7 produced a single, clear band only in the eg group, indicating no cross-reactivity with other parasites. Primer F5R5 produced a single, clear band only in the em group, indicating no cross-reactivity with other parasites. Both demonstrate the conserved and highly specific nature of these primers.

[0120] The upstream and downstream primers for Echinococcus granulosus G1 type screened were EG-T1-F / R, and the upstream and downstream primers for Echinococcus multilocularis were EM-T1-F / R, respectively. The primer sequences are shown in Table 2.

[0121] Table 2 RPA primer sequences for Echinococcus granulosus G1 and Echinococcus multilocularis designed by the present invention

[0122]

[0123] Example 2

[0124] Specific primer preparation method based on dual RPA-LFD

[0125] The upstream primer for Echinococcus granulosus G1 was modified with Biotin at the 5' end of the RPA primer sequence TTTTTTGAGAAGTTTGTTTATGTATGTT. The downstream primer for Echinococcus granulosus G1 was modified with a FAM fluorescent group at the 5' end of the RPA primer sequence CCACGAGACCAAGGATACCCAAAACCCA. The upstream primer for Echinococcus multilocularis was modified with Digoxin at the 5' end of the RPA primer sequence CGGCGTCGCCTAAGCGGCTTGACCCTTT. The downstream primer for Echinococcus multilocularis was modified with a TAMRA fluorescent group at the 5' end of the RPA primer sequence TTAATTTATCTTGACTATTCCATTTTCT. Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0126] Among them, the molecular formula of Biotin is C 10 H 16 N2O3S, the chemical formula is shown in Formula I;

[0127] Formula I

[0128] The molecular formula of FAM is C 21 H 12 O7, chemical formula is shown in formula II;

[0129] Formula II

[0130] The molecular formula of Digoxin is C 41 H 64 O 14 , the chemical formula is shown in Formula III;

[0131] Formula III

[0132] The molecular formula of TAMRA is C 25 H 22 N2O5, chemical formula is shown in formula IV;

[0133] Formula IV

[0134] Example 3

[0135] Establishment of dual RPA-LFD detection method

[0136] 1. Experimental steps

[0137] 1. Extraction of parasite genome: The Echinococcus granulosus G1 and Echinococcus multilocularis strains used in the present invention were preserved in the applicant's laboratory. Genomic DNA was extracted using the TIANamp Genomic DNA Kit (TIANGEN), dissolved in TE, and stored at -20°C.

[0138] 2. Establishment of RPA-LFD reaction system and optimization of conditions

[0139] The basic reaction system of 50 μL includes: 30 μL rehydration buffer (TwistDxnfo Kit, Cambridge, United Kingdom), 2.4 μL genomic DNA of the sample to be tested, 1.2 μL of 10 μmol / L Echinococcus granulosus G1 upstream primer, 1.2 μL of 10 μmol / L Echinococcus granulosus G1 downstream primer, 1.2 μL of 10 μmol / L Echinococcus multilocularis upstream primer, 1.2 μL of 10 μmol / L Echinococcus multilocularis downstream primer, 9.8 μL ddH2O, and 3 μL of 280 mmol / L magnesium acetate.

[0140] (1) Optimization of primer ratio in RPA-LFD-2 reaction system:

[0141] Primer ratio: Echinococcus granulosus G1 primer and Echinococcus multilocularis primer

[0142] 1.6 / 0.8 1.6 μL each of upstream and downstream primers 0.8 μL each of upstream and downstream primers

[0143] 1.4 / 1.0 1.4 μL each of upstream and downstream primers 1.0 μL each of upstream and downstream primers

[0144] 1.2 / 1.2 1.2 μL upstream and downstream primers 1.2 μL upstream and downstream primers

[0145] 1.0 / 1.4 1.0 μL each of upstream and downstream primers 1.4 μL each of upstream and downstream primers

[0146] 0.8 / 1.6 0.8 μL each of upstream and downstream primers 1.6 μL each of upstream and downstream primers

[0147] Keeping other conditions in the basic reaction system unchanged, perform RPA amplification reaction with different primer ratios. After the reaction is completed, dilute the amplified product 50 times with PBST, draw 40 μL and drop it onto the sample pad. After standing at room temperature for 5 minutes, observe the color development results of the test strip. Figure 5 As shown in the figure, the primer ratio combination with the most obvious color development effect was selected, and 1.4 Echinococcus granulosus G1 type primers / 1.0 Echinococcus multilocularis primers were the best primer ratio combination.

[0148] (2) Optimization of RPA amplification temperature for RPA-LFD-2 reaction system:

[0149] Keeping other conditions in the reaction system the same, perform RPA amplification reaction at 34°C, 36°C, 38°C, 40°C, and 42°C. After the reaction, dilute the amplified product 50-fold with PBST, pipette 40 μL and drop it onto the sample pad. After standing at room temperature for 5 minutes, observe the color development results of the test strip. Figure 5 As shown in the figure, the temperature with the most obvious color development effect was selected, and 38°C was the optimal reaction temperature.

[0150] (3) Optimization of RPA reaction time of RPA-LFD-2 reaction system:

[0151] Keeping other conditions in the reaction system the same, the RPA amplification reaction was performed for 16 min, 18 min, 20 min, 22 min, and 24 min, respectively. After the reaction, the amplified product was diluted 50 times with PBST, 40 μL was aspirated and dropped onto the sample pad, and the color development results of the test strip were observed after standing at room temperature for 5 min. Figure 5 As shown in the figure, the time that consumes less time and has obvious color development effect is selected, and 20 min is the optimal reaction time.

[0152] (4) Optimization of sample dilution ratio for RPA-LFD-2 reaction system:

[0153] Perform RPA amplification reaction according to the reaction system. After the reaction is completed, dilute the amplified product 25 times, 50 times, 100 times, and 200 times with PBST, draw 40 μL and drop it on the sample pad on the test strip. After standing at room temperature for 5 minutes, observe the color development results of the test strip. Figure 5 As shown in the figure, the sample dilution factor with obvious color development effect was selected, and 50 times was the best sample dilution factor.

[0154] The optimized reaction system was 50 μL: 30 μL rehydration buffer (TwistDxnfo Kit, Cambridge, United Kingdom), 2.4 μL genomic DNA of the sample to be tested, 1.4 μL of 10 μmol / L Echinococcus granulosus G1 upstream primer, 1.4 μL of 10 μmol / L Echinococcus granulosus G1 downstream primer, 1.0 μL of 10 μmol / L Echinococcus multilocularis upstream primer, 1.0 μL of 10 μmol / L Echinococcus multilocularis downstream primer, 9.8 μL ddH2O, and 3 μL of 280 mmol / L magnesium acetate.

[0155] Premix 47 μL of the reaction reagents, excluding the initiator, and add them to a separate reaction tube containing lyophilized RPA powder (RPA Reaction Kit, TwistAmp™ Basic Kit). After complete dissolution, add 3 μL of the initiator. The RPA amplification reaction temperature was 38°C, the reaction time was 20 min, and the sample was diluted 50-fold.

[0156] 3. Detection of RPA amplification products

[0157] The lateral flow chromatography test strips used in this invention (Tiosbio dual-labeled nucleic acid detection test strips (JY209)) contain a sample pad, a chromatography pad, and a water-absorbing pad in the order of the chromatography direction during sample detection on the bottom plate. They are dried at 37°C for 2-3 hours and sealed for storage. The amplification product is diluted 50-fold with PBST buffer, 40 μL is aspirated and dropped onto the sample pad, and the result is determined after 5 minutes. The determination result is as follows: Figure 6 If the control line and any test line develop color simultaneously, the test is considered positive and the sample contains Echinococcus granulosus G1 or Echinococcus multilocularis genomic DNA. If the control line develops color and the test line does not, the test is considered negative and the sample does not contain Echinococcus granulosus G1 or Echinococcus multilocularis genomic DNA. If the control line does not develop color, the experiment is considered unsuccessful and the test result is invalid.

[0158] Specificity Detection

[0159] The TIANGEN blood / cell / tissue genomic DNA extraction kit (DP304) was used to extract genomic DNA of Echinococcus granulosus G1 type, Echinococcus multilocularis, Taenia solium, Taenia multiceps, Taenia asiatica, Taenia saginata, Fasciola hepatica, Cryptosporidium, Mesorchidism orientalis, Clonorchis sinensis, Toxoplasma gondii, and Cysticercus truncatus. The ddH2O was used as a template (all the above parasites were from the laboratory of the applicant of the present invention). The reactants were added according to the above system for RPA detection, and the amplification was carried out at a constant temperature of 38°C for 20 minutes. After the amplification, the amplified product was diluted 50 times with PBST, 40 μL was aspirated and dropped on the sample pad, and the results were determined within 5 minutes. The results are as follows. Figure 7 As shown in the figure, only the genomic DNA of Echinococcus granulosus G1 type and Echinococcus multilocularis can be amplified well, and the test strips are positive, while the others are negative, indicating that this method has certain conservatism and strong specificity for detecting Echinococcus granulosus G1 type and Echinococcus multilocularis.

[0160] 3. Sensitivity test

[0161] The genomic DNA of Echinococcus granulosus G1 type and Echinococcus multilocularis were collected according to 10 8 ~10 1 The samples were serially diluted 10-fold and used as templates for RPA reaction, respectively, and amplified at 38°C for 20 min. After amplification, the amplified products were diluted 50-fold with PBST, 40 μL was aspirated and dropped onto the sample pad, and the results were determined within 5 min. Figure 8 As shown, when the genomic DNA concentration was 10 2 copies / μL, a positive signal can still be seen on the detection line. 1 There was no positive signal on the detection line when the detection limit was 10 copies / μL, indicating that the minimum detection limit of nucleic acid in the present invention was 10 2 copies / μL.

[0162] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer combination, characterized in that The primer combination includes a first primer combination and a second primer combination; the first primer combination is used to identify Echinococcus granulosus G1 type; the second primer combination is used to identify Echinococcus multilocularis; The nucleotide sequence of the upstream primer of the first primer combination is shown in SEQ ID No. 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 2; The nucleotide sequence of the upstream primer of the second primer combination is shown as SEQ ID No. 3, and the nucleotide sequence of the downstream primer is shown as SEQ ID No.

4.

2. The primer combination according to claim 1, wherein The 5' end of the nucleotide sequence of the primer combination is modified by a chemical group; the chemical group includes any one of Biotin, FAM fluorescent group, Digoxin and TAMRA fluorescent group; the 5' end of the nucleotide sequence of the upstream primer of the first primer combination is modified by the Biotin; the 5' end of the nucleotide sequence of the downstream primer of the first primer combination is modified by the FAM fluorescent group; the 5' end of the nucleotide sequence of the upstream primer of the second primer combination is modified by the Digoxin; the 5' end of the nucleotide sequence of the downstream primer of the second primer combination is modified by the TAMRA fluorescent group.

3. Use of the primer combination according to claim 1 or 2 in the preparation of a reagent or kit for identifying Echinococcus granulosus G1 and Echinococcus multilocularis.

4. A reagent combination, characterized in that Comprising the primer combination according to claim 1 or 2.

5. A kit, characterized in that The method comprises the primer combination according to claim 1 or 2 or the reagent combination according to claim 4.

Images