An InDel molecular marker, primer and application for identifying high palmitic acid content in soybean

By designing InDel molecular marker primers, combined with PCR amplification and electrophoresis detection, the problem of identifying high palmitic acid content in soybeans is solved, fast and accurate breeding effects are achieved, and crop breeding efficiency is improved.

CN119736429BActive Publication Date: 2025-08-12INST OF CEREAL & OIL CROPS HEBEI ACAD OF AGRI & FORESTRY SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510069962.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-16
Publication Date
2025-08-12
Estimated Expiration
2045-01-16

AI Technical Summary

Technical Problem

The prior art is difficult to quickly and accurately identify the high palmitic acid content of soybeans, which affects the efficiency and success rate of crop breeding.

Method used

InDel molecular marker primers were designed, and the detection was performed by PCR amplification and agarose gel electrophoresis. The high palmitic acid content of soybeans was identified using InDel molecular marker primers, InDel molecular marker was developed for the preparation of detection kits and genomic chips, and the construction of soybean InDel fingerprint map.

Benefits of technology

It has achieved rapid and accurate selection and breeding of soybean varieties with high palmitic acid content, and improved the efficiency and success rate of crop breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119736429B_ABST
    Figure CN119736429B_ABST
Patent Text Reader

Abstract

The present invention discloses an InDel molecular marker, primers, and applications for identifying soybeans with high palmitic acid content. The upstream primer nucleotide sequence of the InDel molecular marker primer is shown in SEQ ID NO.1, and the downstream primer nucleotide sequence is shown in SEQ ID NO.2. The present invention targets the QTLqPA_2_2 interval, combines parental resequencing data, screens out Indel sites with differential bases greater than 15 bp, and designs an InDel molecular marker for the base deletion at Chr02_46466018. Based on the InDel molecular marker, an InDel primer sequence is designed, PCR amplification is performed, and the test results are observed to identify the palmitic acid content phenotype. The primers of the present invention can be used to identify and screen the palmitic acid content phenotype of soybeans, and can quickly, accurately, and effectively breed soybean varieties with high palmitic acid content, accelerate the crop breeding process, and improve the efficiency and success rate of breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to an InDel molecular marker, a primer and an application thereof for identifying soybeans with high palmitic acid content. Background Art

[0002] Soybeans are the primary source of vegetable oil and contain five key fatty acid components: palmitic acid (PA), stearic acid (SA), oleic acid (OA), linoleic acid (LA), and linolenic acid (LNA). Palmitic acid and stearic acid are saturated fatty acids, while oleic acid, linoleic acid, and linolenic acid are unsaturated fatty acids. The ratio of the various fatty acid components in soybean oil directly determines its flavor, shelf life, and nutritional value. As living standards improve, dietary requirements become increasingly stringent, and people pursue healthier foods. Saturated fats are fatty acids without double bonds, and excessive intake can lead to sudden increases in high blood pressure, cholesterol, and coronary heart disease.

[0003] Soybean seed quality traits are regulated by multiple genes and are quantitative traits with complex genetic mechanisms and are susceptible to environmental influences. Many researchers, both domestically and internationally, have conducted QTL mapping studies on soybean protein, fat, and fatty acid composition. However, the QTLs detected vary across different environments or genetic backgrounds, and few have been reproducibly identified.

[0004] This study, using a RIL population constructed from the "Jidou 17 x Jidou 12" strain, mapped QTLs for protein, fat, and fatty acid composition in soybean grains harvested over two years in Shijiazhuang, identifying stable genetic loci. Correlations between fatty acid components were analyzed, identifying major genetic loci regulating soybean fatty acid content and analyzing interactions between these loci. This study lays the foundation for molecular marker-assisted breeding of high-quality soybeans, which is of great significance for ensuring national food security and promoting sustainable agricultural development. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide an InDel molecular marker, primers and applications for identifying soybeans with high palmitic acid content.

[0006] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0007] An InDel molecular marker primer for identifying soybeans with high palmitic acid content, wherein the upstream primer nucleotide sequence of the InDel molecular marker primer is shown as SEQ ID NO.1, and the downstream primer nucleotide sequence is shown as SEQ ID NO.2.

[0008] The application of InDel molecular marker primers with the upstream primer nucleotide sequence shown as SEQ ID NO.1 and the downstream primer nucleotide sequence shown as SEQ ID NO.2 in identifying soybeans with high palmitic acid content.

[0009] An InDel molecular marker for identifying soybeans with high palmitic acid content, wherein the InDel molecular marker is a sequence amplified using an InDel molecular marker primer using a soybean genome as a template; the upstream primer nucleotide sequence of the InDel molecular marker primer is shown in SEQ ID NO.1, and the downstream primer nucleotide sequence is shown in SEQ ID NO.2; the nucleotide sequences amplified using the InDel molecular marker primer are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0010] The InDel molecular marker primer is used in preparing soybean detection reagents, kits, genome chips or liquid phase probes.

[0011] Application of the InDel molecular marker primers in constructing soybean InDel fingerprint map.

[0012] The method for identifying soybeans with high palmitic acid content using an InDel molecular marker primer having an upstream primer nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer nucleotide sequence as shown in SEQ ID NO.2 comprises the following steps:

[0013] (1) Using the DNA of the soybean material to be tested as a template, PCR amplification is performed using InDel molecular marker primers to obtain PCR amplification products;

[0014] (2) Detect the amplified product by agarose gel electrophoresis and observe the electrophoresis detection results.

[0015] Further preferably, the reaction system for PCR amplification in step (1) is as follows: in a 20 μL reaction system, 2 μL of DNA template, 1 μL each of forward primer and reverse primer, 6 μL of ddH2O and 10 μL of 2×Mix

[0016] Further preferably, when the length of the amplified product is 340bp, the gene marker band type of the soybean to be tested is A; when the length of the amplified product is 309bp, the gene marker band type of the soybean to be tested is B; the palmitic acid content is: soybeans with gene marker band type A are greater than or are candidate greater than soybeans with gene marker band type B.

[0017] Application of the InDel molecular marker primers having an upstream primer nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer nucleotide sequence as shown in SEQ ID NO.2 or the InDel molecular marker according to claim 3 in soybean molecular marker-assisted breeding.

[0018] A method for Indel molecular marker of soybean with high palmitic acid content, comprising: using the Indel molecular marker primers described in claim 1 to perform PCR amplification on high-generation materials of an RIL population; the amplification results in three types of fragments: a long fragment indicates the insertion of the InDel, which is recorded as band type A and represents a plant with high palmitic acid content; a short fragment indicates the deletion of the InDel, which is recorded as band type B and represents a plant with low palmitic acid content; and a hybrid fragment having both fragments, which is recorded as H and represents a plant with high palmitic acid content.

[0019] The beneficial effects of the above technical solution are as follows: The present invention, based on the QTLqPA_2_2 interval and combined with parental resequencing data, screens for Indel sites with base differences greater than 15 base pairs, and designs an InDel molecular marker for the base deletion at Chr02_46466018. Based on the InDel molecular marker, InDel primer sequences are designed, PCR amplification is performed, and the test results are observed to identify the palmitic acid content phenotype. Using the primers of the present invention, it is possible to identify and screen soybean palmitic acid content phenotypes, and rapidly, accurately, and effectively breed soybean varieties with high palmitic acid content, accelerating the crop breeding process and improving breeding efficiency and success rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the palmitic acid content histogram of the Shijiazhuang 2022 and 2023 parents;

[0021] Figure 2 This is a schematic diagram of the distribution of palmitic acid content in the Shijiazhuang RIL population, where Skew shows the skewness of the population distribution relative to the mean; Kurt shows the peak value of the population data;

[0022] Figure 3 This is a schematic diagram of the electrophoresis results of materials 1 to 53, among which materials 1, 13, 15, 24 and 30 were not detected;

[0023] Figure 4 This is a schematic diagram of the electrophoresis results of materials 54 to 107, among which materials 59, 69, 90, 81, 90 and 99 were not detected;

[0024] Figure 5 is a schematic diagram of the electrophoresis results of materials 108 to 159, among which materials 125, 128, 131, and 146 were not detected;

[0025] Figure 6This is a schematic diagram of the electrophoresis results of materials 160 to 196, among which materials 177-189 and 191 were not detected;

[0026] Figure 7 This is a schematic diagram of the Indel marker typing of the RIL population and the results of the palmitic acid content in the grains;

[0027] Figure 8 It is the QTL positioning of protein, fat and fatty acid content on chromosome Chr02 of the RIL population, where pro: protein content; oil: fat content; PA: palmitic acid content. DETAILED DESCRIPTION

[0028] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are conventional commercial products and can be directly obtained through commercial purchase. The experimental methods used in the following examples are all conventional methods unless otherwise specified.

[0029] It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of described features, integers, steps, operations, elements and / or components, but does not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components and / or collections thereof.

[0030] It will also be understood that the term "and / or" used in this specification and the appended claims refers to and includes any and all possible combinations of one or more of the associated listed items.

[0031] References to "one embodiment" or "some embodiments" in this specification mean that a particular feature, structure, or characteristic described in conjunction with that embodiment is included in one or more embodiments of the present application. Thus, phrases such as "in one embodiment," "in some embodiments," "in other embodiments," and "in other embodiments" appearing in various places in this specification do not necessarily refer to the same embodiment, but rather mean "one or more but not all embodiments," unless otherwise specifically emphasized. The terms "including," "comprising," "having," and variations thereof all mean "including but not limited to," unless otherwise specifically emphasized.

[0032] In addition, in the description of the present application specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the descriptions and cannot be understood as indicating or implying relative importance.

[0033] The following will be combined with specific embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0034] Example 1: Extraction of soybean fatty acid components

[0035] Select dry, undamaged, uniformly sized, and plump soybean seeds. Grind 10 seeds from each plant. Wash each sample after grinding to prevent contamination. Weigh 0.1 g of ground soybean powder into a 2 mL centrifuge tube and set aside.

[0036] Fatty acid extraction steps:

[0037] (1) Add 1 mL of petroleum ether to the centrifuge tube containing soybean powder and shake for 1 hour;

[0038] (2) Centrifuge for 10 minutes at 4000 rpm, then aspirate 800 μL of supernatant into a 10 mL centrifuge tube, add 1.5 mL of methanol / KOH, mix thoroughly, and let stand for 1 hour;

[0039] (3) After standing, add 5 mL of distilled water to separate the oil;

[0040] (4) Pipette 150 μL of the upper layer of oil into a 2.0 mL sample bottle, and then add 450 mL of petroleum ether to make up the volume for testing.

[0041] Example 2: Detection of fatty acid components by gas chromatograph

[0042] This study used an Agilent 6890 gas chromatograph for detection. The chromatographic column model was Agilent DB-23 capillary column (30m×0.25mm, 0.25μm); the injection method was automatic injection; the injection needle specification was 10μL, and the injection volume was 2μL each time; the split ratio was 20:1; the column oven temperature was set to 180-220℃; the front inlet temperature was set to 250℃ and the front inlet pressure was set to 5.4psi; the total front inlet flow rate was 17mL / min; the carrier gas was nitrogen 25mL / min, hydrogen: 30mL / min, and air: 400mL / min; the heating method adopted programmed heating: initial temperature 150℃, equilibration time 2min, heating to 220℃ at 5℃ / min-1 and holding for 11min; the detector was a flame ionization detector (FID) at a temperature of 250℃; each sample was tested for 18min, with a sample detection interval of 1min, and the data sampling frequency was 20Hz / 0.1min.

[0043] The output spectra were analyzed by Agilent Chem Station software equipped with an Agilent 6890 gas chromatograph. The relative contents (%) of the five fatty acids were calculated based on the ratio of the target fatty acid signal peak area to the total area of ​​the fatty acid signal peaks using the area normalization method. Each material was tested in duplicate three times.

[0044] Example 3, result analysis

[0045] (1) Analysis of differences in palmitic acid content between the two parental materials

[0046] The palmitic acid content of the parental grains from different years and different environments was analyzed. Figure 1 -A shows a comparison of the fatty acid contents of the two parents planted in Shijiazhuang in 2022. The palmitic acid content of the female parent Jidou 17 is 11.27%, and the palmitic acid content of the male parent Jidou 12 is 12.8%. Compared with the female parent Jidou 17, the palmitic acid content of the male parent Jidou 12 is significantly higher by 1.53 percentage points; the comparison of the fatty acid content of the parents planted in Shijiazhuang in 2023 shows as follows Figure 1 -B shows that the palmitic acid content of the female parent Jidou 17 is 11.72%, and the palmitic acid content of the male parent Jidou 12 is 13.09%. Compared with the female parent Jidou 17, the palmitic acid content of the male parent Jidou 12 is significantly higher by 1.37 percentage points, indicating that there is a difference in palmitic acid content between the parents.

[0047] (2) Phenotypic variation and genetic analysis of fatty acid content in RIL populations

[0048] As shown in Table 1, the palmitic acid content in the RIL population harvested in Shijiazhuang in 2022 reached a maximum of 13.28%, a minimum of 10.21%, an average of 11.94%, an inter-population standard deviation of 0.55, and a coefficient of variation of 4.65%. The palmitic acid content in the RIL population harvested in Shijiazhuang in 2023 reached a maximum of 13.61%, a minimum of 10.63%, an average of 12.09%, and an inter-population standard deviation of 0.51. The coefficient of variation of palmitic acid was 4.20%. The heritability of palmitic acid in the RIL population planted in Shijiazhuang from 2022 to 2023 was 0.83.

[0049] The above data results indicate that the palmitic acid content of this population is subject to genetic regulation, so QTL positioning analysis can be performed on the palmitic acid content in the seeds of the RIL population.

[0050] Table 1 Phenotypic variation and genetic analysis of palmitic acid content in Shijiazhuang RIL population from 2022 to 2023

[0051]

[0052] The distribution of palmitic acid content in the 2022 population was 0.30 with a skewness of -0.05, and the distribution of palmitic acid content in the 2023 population was 0.22 with a skewness of -0.30. The fatty acid content of the RIL population in both years showed an approximately normal distribution, which is a typical quantitative trait, such as Figure 2 shown.

[0053] Example 4: QTL mapping of fatty acid composition in RIL populations

[0054] To further elucidate the genetic basis of soybean fatty acid composition, this study analyzed palmitic acid content in soybean seeds grown in Shijiazhuang from 2022 to 2023 using a RIL population constructed from cultivars Jidou 17 and Jidou 12. Based on the constructed map, QTL IciMapping 4.1 was used to locate QTLs for fatty acid content in the RIL population.

[0055] The results are shown in Table 2. Using QTL IciMapping 4.1, six QTLs related to palmitic acid content were mapped in Shijiazhuang in 2022-2023. LOD values ​​ranged from 2.93 to 6.64, with contributions of 5.07% to 12.54%. These QTLs were located on chromosomes 2, 3, 8, 9, and 12, respectively. Among them, qPA_2_2, located from Chr02_46571256 bp to Chr02_47262439 bp on chromosome 2, was repeatedly detected in Shijiazhuang in 2022-2023. LOD values ​​were 4.51 and 3.94 in both years, respectively, and the genetic contributions to the explained phenotype were 8.50% and 7.70%, respectively.

[0056] Table 2 QTL mapping results of palmitic acid content in RIL population (QTL Mapping 4.1)

[0057]

[0058]

[0059] Example 5. Development and Application of Indel Markers

[0060] like Figure 8 As shown, for the qPA_2_2 interval, combined with the parental resequencing data, we screened for indel sites with base differences greater than 15 bp, and designed primers based on the flanking sequences. The results showed that between the parents, there were 10 indel sites with base differences greater than 15 bp within the 46571256-47262439 bp interval on chromosome Chr02.

[0061] Table 3 Detailed information of the 10 Indel sites in the interval

[0062]

[0063] PCR primers were designed for amplification and analyzed in combination with phenotypic data.

[0064] The reaction system and amplification conditions of PCR amplification are as follows:

[0065] Table 4 PCR amplification reaction system

[0066]

[0067]

[0068] Table 5 PCR amplification conditions are as follows:

[0069]

[0070] To prepare agarose gel: Take 6g of agarose powder, add 100ml of 1× TAE buffer, and heat in a microwave oven until fully melted. Set the electrophoresis instrument voltage to 130V and run for approximately three and a half hours.

[0071] The results showed that the Indel at Chr02_46466018 was TAAATCAATTTCAT (SEQ ID NO. 13) / TAAATCAATTTCATGAAATGTGTGCTGTAAAGAAATCAATTTCAT (SEQ ID NO. 14). PCR primers were designed based on the flanking sequences as follows: Chr02_46466018 FP: CTATACATAAGACTGGGTCTGGTT (SEQ ID NO. 1); Chr02_46466018 FP: TCAGCATAACCTCATTCGTT (SEQ ID NO. 2).

[0072] When the length of the amplified product is 340 bp, the gene marker band type of the soybean to be tested is A, and the nucleotide sequence of 340 bp is shown as SEQ ID NO.3;

[0073] When the length of the amplified product is 309 bp, the gene marker band type of the soybean to be tested is B, and the nucleotide sequence of 309 bp is shown as SEQ ID NO.4; the palmitic acid content is as follows: the soybean with gene marker band type A is greater than or is candidate greater than the soybean with gene marker band type B.

[0074] The Indel marker developed in this study was used to perform PCR amplification and electrophoresis on the high-generation materials of this RIL population, and the electrophoresis detection results were observed. For details, see the attached Figure 3-6 .

[0075] This marker was used to perform typing on 196 materials in the Jidou17×Jidou12 population. The banding pattern consistent with that of the parent Jidou12 was marked as A, the banding pattern consistent with that of the parent Jidou17 was marked as B, and H was the heterozygous type.

[0076] It should be noted that the RIL population Indel marker typing specific phenotypic data table in this invention is shared with the Chinese application with application number 202411751550.7. The Chinese application with application number 202411751550.7 and the present invention are researched by the same research group, but the QTL loci Indel molecular markers discovered in the research and the Indel molecular marker primers developed are different.

[0077] like Figure 7 As shown in Tables 6 and 7, combined with the phenotypic data, the results showed that among the 72 accessions with banding A in 2022, palmitic acid was detected in 65 of them, with a corresponding mean palmitic acid content of 0.1205. Among the 91 accessions with banding B, the corresponding mean palmitic acid content was 0.1176. There was a significant difference between groups A and B, with a P value of 0.015. Among the 72 accessions with banding A in 2023, palmitic acid was detected in 71 of them, with a corresponding palmitic acid content of 0.1219. There was a significant difference between groups A and B, with a P value of 0.0011.

[0078] Table 6 Specific results of Indel marker typing in RIL population

[0079]

[0080]

[0081]

[0082]

[0083]

[0084] Table 7 Indel marker typing of RIL population and association analysis results with grain palmitic acid content

[0085]

[0086]

[0087] The analysis results in Table 7 showed that the differences in palmitic acid content between the two gene marker bands formed in the subpopulations composed of 2022-band type and 2023-band type soybeans reached a significant level (P<0.05).

[0088] This marker can effectively distinguish two gene marker band types and has a co-dominant characteristic; this marker can be used to assist in screening soybean offspring materials with high palmitic acid content.

[0089] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to these examples without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

[0090] In the above embodiments, the description of each embodiment has its own focus. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant description of other embodiments.

[0091] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. These modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention, and should all be included in the scope of protection of the present invention.

Claims

1. An InDel molecular marker primer for identifying soybeans with high palmitic acid content, characterized in that: The nucleotide sequence of the upstream primer of the InDel molecular marker primer is shown in SEQ ID NO. 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

2.

2. Use of the InDel molecular marker primer according to claim 1 in identifying soybeans with high palmitic acid content.

3. An InDel molecular marker for identifying soybeans with high palmitic acid content, characterized in that: The InDel molecular marker is a sequence amplified using the soybean genome as a template and the InDel molecular marker primer; the upstream primer nucleotide sequence of the InDel molecular marker primer is shown in SEQ ID NO. 1, and the downstream primer nucleotide sequence is shown in SEQ ID NO. 2; the nucleotide sequence amplified by the InDel molecular marker primer is shown in SEQ ID NO.

3.

4. Use of the InDel molecular marker primer according to claim 1 in preparing a detection reagent, a kit, a genomic chip or a liquid phase probe for high palmitic acid content soybeans.

5. A method for identifying soybeans with high palmitic acid content using the InDel molecular marker primers according to claim 1, characterized in that: The following steps are involved: (1) Using the DNA of the soybean material to be tested as a template, PCR amplification is performed using InDel molecular marker primers to obtain PCR amplification products; (2) Detecting the amplified product by agarose gel electrophoresis and observing the electrophoresis detection results; The reaction system for PCR amplification in step (1) is as follows: 2 µL DNA template, 1 µL forward primer, 1 µL reverse primer, 6 µL ddH2O, and 10 µL 2×Mix in a 20 µL reaction system; When the length of the amplified product is 340 bp, the gene marker band type of the soybean to be tested is A; when the length of the amplified product is 309 bp, the gene marker band type of the soybean to be tested is B; the palmitic acid content is as follows: soybeans with gene marker band type A are greater than or are candidate greater than soybeans with gene marker band type B.

6. Use of the InDel molecular marker primer according to claim 1 in molecular marker identification of soybean with high palmitic acid content.

7. A method for detecting soybean Indel molecular markers with high palmitic acid content, characterized by: PCR amplification is performed on high-generation materials of the RIL population using the Indel molecular marker primers described in claim 1. The amplification results are three types of fragments. The long fragment indicates the insertion of InDel, which is recorded as band type A and is a plant with a high palmitic acid content; the short fragment indicates the deletion of InDel, which is recorded as band type B and is a plant with a low palmitic acid content; the fragment with both fragments is a hybrid fragment, which is recorded as H.

Citation Information

Patent Citations

  • InDel molecular marker primer for identifying soybeans with high palmitic acid content and application of InDel molecular marker primer

    CN119307649A