Bifunctional peptide modified nano-drug delivery system as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of medicines, and particularly relates to a bifunctional peptide modified nano-drug delivery system as well as a preparation method and application thereof. In order to realize efficient and targeted drug delivery, a smart strategy that TAT and GE11 peptides are used for performing bifunctional modification on membrane skeleton protein of the lipid nanodisk is adopted, a fusion membrane skeleton protein GMT is obtained by virtue of a prokaryotic expression system, a nanodisk drug delivery carrier ND (GMT) (at) DOX-PA is constructed based on the fusion membrane skeleton protein GMT, and research finds that the fusion membrane skeleton protein GMT and the fusion membrane skeleton protein GMT (at) DOX-PA have a broad application prospect. Compared with free DOX, the nanodisk drug delivery carrier has the advantages that the cellular uptake is obviously improved, and particularly, the targeting property of the nanodisk drug delivery carrier is obviously enhanced through modification of fusion membrane skeleton protein GMT. In addition, compared with other carriers, the nano-carrier has the highest tumor growth inhibition effect, and the IC50 value of the nano-carrier is about 0.5 mu M and is close to that of free DOX. In general, common modification of the cell penetrating peptide TAT and the EGFR targeting ligand GE11 effectively improves the tumor targeting property and the anti-tumor activity of the nanodisk carrier.

Description

Technical Field

[0001] The present invention belongs to the field of medical technology, and specifically relates to a bifunctional peptide modified nano drug delivery system and a preparation method and application thereof. Background Art

[0002] As a barrier between the intracellular and extracellular environments, the cell membrane is highly selective, which hinders the effective transmembrane transport of most macromolecular drugs. Although small molecule drugs can enter cells through ion channels or receptors, macromolecular drugs (such as proteins, nucleic acids, etc.) are difficult to enter cells through these pathways, thus limiting their clinical therapeutic effects. Therefore, exploring the mechanism or tools to promote these macromolecular drugs to cross the cell membrane and enter the cell is an urgent problem to be solved.

[0003] Nano drug delivery technology is a revolutionary development in the field of medicine, which plays an important role in improving the efficacy of drugs and reducing their side effects. However, the main challenge faced by traditional drug delivery strategies is that drug molecules are difficult to effectively penetrate cell membranes, especially large molecule drugs such as proteins and nucleic acids, which restricts the clinical application and efficacy of these drugs.

[0004] In recent years, technologies such as computer-aided design (CAD) and molecular dynamics simulation (MD) have played an increasingly important role in the research and development of drug delivery systems and have been widely used in the structural design and performance prediction of nano drug carriers. Through these computer-aided technologies, researchers can accurately control the size, shape and surface properties of drug carriers at the nanoscale, thereby achieving precise control of the drug delivery process. Not only can nanocarriers with specific characteristics be designed, but also the most suitable nanocarrier structure can be designed according to the physicochemical properties and therapeutic goals of the drug. These carriers can protect drug molecules from damage in the body environment and improve the ability of drug molecules to penetrate cell membranes. Moreover, by simulating the release and distribution process of drugs in the body, the efficacy and potential toxic side effects of drugs can be predicted, thereby optimizing drug delivery strategies. For example, CAD technology can help design nanocarriers with specific geometric shapes to optimize their kinetic behavior in vivo. MD simulation can be used to predict the stability and drug release behavior of nanocarriers in complex biological environments. Although technologies such as CAD and MD have shown great potential in the design of drug delivery systems, existing technologies still need to be further improved, especially in achieving efficient and targeted drug delivery.

[0005] At present, lipid-based nanocarriers have become an effective tool for delivering drugs and vaccines, with many advantages, such as high biocompatibility, high bioavailability and stability, and functional modification. Among them, lipid nanodiscs are oblate disc-shaped nanocarriers composed of membrane skeleton proteins and phospholipids. Due to their non-spherical structure, they have stronger anisotropy, longer blood circulation half-life, and higher cellular internalization.

[0006] In summary, if we can introduce computer-aided technology and combine the excellent properties of lipid nanodiscs as nanocarriers to design and develop an MSP nanodrug delivery system that can efficiently and accurately deliver macromolecular drugs to the interior of tumors, it will surely have broad application prospects. Summary of the invention

[0007] In order to overcome the deficiencies of the above-mentioned prior art, the present invention adopts an ingenious strategy of using TAT and GE11 peptides for bifunctional modification on the membrane skeleton protein of lipid nanodiscs, aiming to utilize the high penetration ability of TAT and the targeting of GE11 to construct a nanodrug delivery system that can both efficiently penetrate the cell membrane and has tumor cell targeting.

[0008] In order to achieve the above object, the technical solution adopted by the present invention is:

[0009] The first aspect of the present invention provides a method for preparing a bifunctional peptide modified nano drug delivery system, the method comprising the following steps:

[0010] S1. The nucleotide sequence of the fusion membrane skeleton protein GMT shown in SEQ ID No: 5 was cloned into the pET28a(+) plasmid, and the plasmid was transformed into Escherichia coli BL21(DE3) for protein expression to obtain the fusion membrane skeleton protein GMT shown in SEQ ID No: 1;

[0011] S2, adding doxorubicin hydrochloride and palmitic acid hydrazide to a solvent, mixing at room temperature in the dark, then adding trifluoroacetic acid, heating and refluxing, removing the solvent, and then redissolving, crystallizing, washing and drying to obtain the prodrug DOX-PA shown below;

[0012]

[0013] S3. The fusion membrane skeleton protein GMT prepared by S1 and the prodrug DOX-PA prepared by S2 are mixed in the form of a stock solution, and then msp buffer, sodium cholate stock solution and phospholipid stock solution are added. The resulting self-assembled mixed system is incubated at 41°C for 1-3 hours, and then beads are added for further incubation. After the incubation, the reaction system is separated from the beads, and then the encapsulated and unencapsulated drugs in the reaction system are separated to obtain a bifunctional peptide-modified nanodrug delivery system (ND(GMT)@DOX-PA).

[0014] In order to achieve efficient and targeted drug delivery. The present invention uses computer-aided design to achieve the delivery of nano-drugs based on the targeting ability of membrane-active peptides (MAPs) in a non-destructive membrane-penetrating manner, and thus provides a lipid nanodisc membrane skeleton protein MSP ( Figure 1 ). The MSP can effectively deliver drugs into cells, improve the therapeutic efficiency of drugs, reduce systemic toxicity, and further modify MSP with functional peptides to construct a nano drug delivery system that can efficiently penetrate cell membranes and has tumor cell targeting. The present invention solves the following key technical problems:

[0015] (1) Cell membrane permeability: Due to their molecular size and polarity, macromolecular drugs are difficult to penetrate the cell membrane, which limits their application in clinical treatment. The nanocarrier developed by the present invention can promote the effective penetration of macromolecular drugs into the cell membrane. (2) Drug release control: The release rate and location of the drug in the body are crucial to the therapeutic effect. The nanodrug delivery system designed by the present invention can accurately control the release location of the drug. (3) Targeting: In order to reduce the toxic and side effects of drugs on normal cells, it is necessary to improve the targeting of drugs to diseased cells. The highly targeted nanodrug delivery system developed by the present invention can achieve precise treatment of specific cells or tissues, thereby reducing systemic toxicity. (4) Stability and biocompatibility: The stability and biocompatibility of the nanodrug delivery system in the body directly affect its safety and effectiveness. The nanocarrier designed by the present invention has good stability and biocompatibility. (5) Computer-aided design optimization: The present invention uses computer-aided design and simulation technology to optimize the nanodrug delivery system, including the shape, size, surface properties, and drug loading and release mechanism of the nanocarrier.

[0016] Preferably, the mass ratio of doxorubicin hydrochloride to palmitic acid hydrazide in S1 is 5-6:7-8.

[0017] Preferably, the usage ratio of doxorubicin hydrochloride to trifluoroacetic acid (TFA) in S1 is 50-60 mg: 7-10 μL.

[0018] Preferably, the temperature of the heating reflux reaction in S2 is 50-70°C and the time is 4-6h.

[0019] Preferably, in S3, the stock solution of the prodrug DOX-PA is a 15-25 mM DOX-PA DMSO solution, and the stock solution of the fusion membrane skeleton protein GMT is a 400-600 μM GMT sodium cholate solution.

[0020] Preferably, in S3, a microcolumn centrifugation method is used to separate encapsulated drugs and unencapsulated drugs, and the microcolumn is a Sephadex G-50 microcolumn.

[0021] Preferably, in S3, beads are added twice with an interval of 1-3 hours in between, and after the last addition of beads, incubation is continued for 2-4 hours to fully remove sodium cholate.

[0022] More preferably, the beads need to be pre-treated: soak in methanol for 7-15 min, wash with deionized water for 3-5 times, and wash with MSP buffer for 1-2 times.

[0023] The second aspect of the present invention provides a bifunctional peptide modified nano drug delivery system prepared by the preparation method described in the first aspect.

[0024] The third aspect of the present invention provides the use of the bifunctional peptide modified nano drug delivery system described in the second aspect in the preparation of anti-tumor preparations.

[0025] Preferably, the tumor includes but is not limited to non-small cell lung cancer.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The present invention combines the excellent properties of lipid nanodiscs as nanocarriers, utilizes the high penetration ability of TAT and the targeting of GE11, and uses TAT ​​and GE11 peptides to perform bifunctional modification on the membrane skeleton protein of lipid nanodiscs. With the help of a prokaryotic expression system, a fusion membrane skeleton protein GMT is obtained, and based on this, a nanodisc drug delivery carrier ND (GMT) @ DOX-PA is constructed, thereby obtaining a nano drug delivery system that can both efficiently penetrate the cell membrane and has tumor cell targeting. Further studies have found that the particle size of the bifunctional peptide-modified nano drug delivery system is between 10-15nm, and the morphology is an oblate disc-shaped structure, with the upper and lower surfaces often stacked on each other, an encapsulation rate between 50%-60%, and a drug loading of about 3%. Compared with free DOX, it shows significantly improved cellular uptake and tumor growth inhibition, and its IC 50The value is about 0.5 μM, which is close to free DOX. It can be seen that the present invention uses the cell penetrating peptide TAT and the EGFR targeting ligand GE11 for co-modification, which greatly improves the anti-tumor effect of the nanodisc drug delivery carrier. Specifically, the present invention has the following advantages:

[0028] (1) High-efficiency transmembrane transport capability: The present invention significantly improves the cellular uptake efficiency of the nano-drug delivery carrier by constructing a lipid nano-disc MSP nano-delivery system, especially in cases where it is difficult to cross the membrane, effectively promoting the transmembrane transport of macromolecular drugs. (2) Precise targeting: The nano-drug delivery system can effectively identify and bind to specific tumor cells, thereby achieving precise drug delivery and reducing toxic side effects on normal cells. (3) No impact on the anti-tumor effect of the drug: After the nano-drug delivery carrier is loaded with DOX, the growth inhibition effect in tumor cells is equivalent to that of the free drug group, indicating that the lipid nano-disc MSP will not reduce the efficacy of the loaded drug while improving the targeting. (4) Longer blood circulation half-life: Due to the anisotropy and non-spherical characteristics of the nano-disc structure, the nano-drug delivery system of the present invention exhibits a longer blood circulation time, which helps to improve the stability and bioavailability of the drug in the body. (5) Drug release control: Through careful design, the nano-drug delivery system can achieve precise release of drugs at specific locations, optimize therapeutic effects and reduce side effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of the preparation method and application of nano drug delivery system MSP;

[0030] Figure 2 Provide a technical roadmap for bifunctional peptide-modified nano-drug delivery systems;

[0031] Figure 3 For the fusion membrane skeleton protein plasmid map: the constructed plasmid maps pET28a-GMT (A), pET28a-GM (B), pET28a-MT (C), pET28a-MSP (D) can be used to induce the expression of fusion membrane skeleton proteins GMT, GM, MT, MSP respectively;

[0032] Figure 4 Schematic diagram of the full gene synthesis and expression vector construction of fusion membrane skeleton protein;

[0033] Figure 5-8 These are the gene sequencing results of fusion membrane skeleton proteins pET28a-GMT, pET28a-GM, pET28a-MT, and pET28a-MSP;

[0034] Fig. 9 For the expression of fusion membrane skeleton proteins in prokaryotic systems;

[0035] Fig.10 Affinity chromatography purification of target proteins: (A) GMT protein (B) GM protein (C) MT protein (D) SDS-PAGE gel electrophoresis diagram of MSP protein. In A and D, lane 1 is the flow-through, lanes 2-4 are the eluents with an imidazole concentration of 300mM, and lanes 5-8 are the eluents with an imidazole concentration of 500mM; in B, lane 1 is the flow-through, lanes 2-3 are the eluents with an imidazole concentration of 200mM, and lanes 4-9 are the eluents with an imidazole concentration of 500mM; in C, lane 1 is the flow-through, lane 2 is the eluent with an imidazole concentration of 200mM, and lanes 3-9 are the eluents with an imidazole concentration of 500mM.

[0036] Fig.11 SDS-PAGE gel verification (A) and Western blot verification (B) of the target protein;

[0037] Fig.12 This is the synthetic reaction route of the prodrug DOX-PA;

[0038] Fig.13 is the mass spectrum of the prodrug DOX-PA;

[0039] Fig.14 The particle size of the nanodisc delivery vehicle before drug loading (A) and after drug loading (B);

[0040] Fig.15 Transmission electron microscopy characteristics of nanodisc delivery vectors: Transmission electron microscopy characteristics of nanodisc delivery vectors ND(GMT)@DOX-PA(A), ND(GM)@DOX-PA(B), ND(MT)@DOX-PA(C), and ND(MSP)@DOX-PA(D), negatively stained with 2% sodium phosphotungstate for 2 minutes.

[0041] Fig.16 is the UV absorption spectrum of DOX;

[0042] Fig.17 is the standard curve of DOX;

[0043] Fig.18 Figure 3 Growth inhibition curves of A549 cells by nanodisc delivery vectors and free DOX: inhibitory activity of ND(GMT)@DOX-PA (A), ND(GM)@DOX-PA (B), DOX (C), ND(MT)@DOX-PA (D) and ND(MSP)@DOX-PA (E) on A549 cells; and the difference in inhibitory activity between each nanodisc drug delivery system and free DOX on A549 cells at the same drug concentration (F).

[0044] Fig.19Confocal microscopy analysis of cellular uptake: Normal adherent A549 cells were treated with free DOX and nanocarriers for 10 h. The drug concentration was 6 μM as DOX and 100 μM as free peptide GE11. The cell nuclei were stained with DAPI. The scale bar is 20 μm.

[0045] Fig. 20 Flow cytometric analysis of cellular uptake of nanodisc drug delivery vehicles and free DOX. The uptake of nanodisc drug delivery vehicles and free DOX in A549 cells after treatment with (A) ND(GMT)@DOX-PA, (B) ND(MSP)@DOX-PA, (C) DOX, (D) ND(MT)@DOX-PA and (E) ND(GM)@DOX-PA at the same drug concentration (6 μM) changes over time; (F) The difference in cellular uptake between the groups at the same time; (G) The difference in cellular uptake between the groups when the treatment time is 2 h. DETAILED DESCRIPTION

[0046] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in each embodiment of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0047] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0048] The present invention provides a dual-functional peptide-modified nano drug delivery system that can efficiently penetrate cell membranes and has tumor cell targeting properties, such as Figure 2As shown, the gene encoding the fusion membrane skeleton protein was constructed into the pET28a(+) plasmid using molecular cloning technology. After sequencing verification, the plasmid was transformed into Escherichia coli BL21(DE3) for protein expression. The purified fusion membrane skeleton proteins GE11-MSP-TAT(GMT), GE11-MSP(GM), MSP-TAT(MT) and MSP were analyzed by SDS-PAGE and Western Blot to ensure the correct expression and purification of the protein. Subsequently, the above-mentioned fusion membrane skeleton proteins and doxorubicin (DOX) prodrug DOX-PA were used to construct nano drug delivery systems ND(GMT)@DOX-PA, ND(GM)@DOX-PA, ND(MT)@DOX-PA and ND(MSP)@DOX-PA, and their particle size, morphology, etc. were characterized. Transmission Electron Microscopy (TEM) and Dynamic Light Scattering (DLS) were used to detect the particle size distribution and morphology of the nano drug delivery system to ensure its stability and uniformity. Finally, the targeting and penetration of the nano drug delivery system were verified by in vitro cell experiments, and EGFR-overexpressing non-small cell lung cancer A549 cells were selected as an experimental model to evaluate the targeting, cell uptake efficiency and cytotoxicity of the nanodisc drug delivery carrier.

[0049] The following is a detailed description of the bifunctional peptide modified nano drug delivery system of the present invention and its preparation method and use by way of Example 1 and Example 2:

[0050] Example 1: Prokaryotic expression and purification of fusion membrane skeleton protein

[0051] 1. Experimental Materials and Methods

[0052] 1.1. The reagents used are as follows:

[0053] LB medium, agar, kanamycin sulfate, isopropyl-β-D-thiogalactopyranoside (IPTG), Sangon Biotech (Shanghai) Co., Ltd.; sodium dihydrogen phosphate, disodium hydrogen phosphate, imidazole, sodium chloride, anhydrous ethanol, Tween-20, Shanghai MacLean Biochemical Technology Co., Ltd.; Triton X-100, Beijing Solebow Technology Co., Ltd.; PMSF, mouse anti-His-HRP monoclonal antibody, Shanghai Bio-Technology Co., Ltd.; Ni-NTA resin, Changzhou Tiandirenhe Biotechnology Co., Ltd.; TrisBase, glycine, SDS, Guangzhou Saiguo Biotechnology Co., Ltd.; 15% SDS-PAGE gel kit, Shanghai Yazyme Biopharmaceutical Technology Co., Ltd.; low molecular weight prestained protein marker, Thermo Fisher Scientific; 5× Loading buffer, Coomassie Brilliant Blue Fast Stain, chemiluminescent substrate (ECL), Shanghai Yazyme Biopharmaceutical Technology Co., Ltd.; PVDF membrane, Bio-Rad, USA.

[0054] 1.2. The instruments used are as follows:

[0055] Clean bench, Shanghai Yiheng Scientific Instrument Co., Ltd.; ZQZY-CS8 oscillating culture shaker, Shanghai Zhichu Instrument Co., Ltd.; SCIENTZ-950E ultrasonic cell crusher, Ningbo Xinzhi Biotechnology Co., Ltd.; Xiangyi H2050R refrigerated high-speed centrifuge, Hunan Xiangyi Laboratory Instrument Development Co., Ltd.; EPS-600 electrophoresis instrument, Shanghai Tianneng Life Science Co., Ltd.; Western fast semi-dry transfer instrument, Bio-Rad Bio-Rad, USA; UVP ChemStudio 815 multi-function imager, Jena, USA; horizontal decolorization shaker, Hangzhou Qiwei Instrument Co., Ltd.; 1 / 10,000 electronic balance, Sartorius; ultrasonic cleaning machine, Kunshan Ultrasonic Instrument Co., Ltd.; constant temperature magnetic stirrer, Shenzhen Broad Jingke Biotechnology Co., Ltd.; pH meter, Shanghai Leici Instrument Co., Ltd.

[0056] 1.3. Solution preparation:

[0057] (1) LB liquid medium: Weigh 25 g of LB medium solid powder, dissolve it in 1000 mL of deionized water, and sterilize it at 121°C for 20 min. The solid LB medium is prepared by adding Agar powder at a ratio of 15 g / L to the LB liquid medium, dissolving it fully, and sterilizing it at 121°C for 20 min. After sterilization, wait until the temperature drops below 60°C, add kanamycin sulfate to a final concentration of 100 μg / mL, mix well, be careful not to generate bubbles, pour it into a plate, cool and solidify, seal it with paraffin film, and store it at 4°C.

[0058] (2) 100 mg / mL kanamycin sulfate: Accurately weigh 1 g of kanamycin sulfate powder, dissolve it in ultrapure water and make up to 10 mL. After sterilization by filtration through a 0.22 μm polyethersulfone filter, aliquot, label, and store at -20°C.

[0059] (3) 0.5 M IPTG: Accurately weigh 1.1915 g of IPTG powder, dissolve it in appropriate amount of ultrapure water, and make up to 10 mL. After sterilization by filtration through a 0.22 μm PES filter membrane, divide the volume into 1 mL / tubes, label them, and store them at -20°C.

[0060] (4) Binding buffer 1: The components include 20 mM phosphate and 500 mM sodium chloride. Weigh 0.4559 g of sodium dihydrogen phosphate, 2.2997 g of disodium hydrogen phosphate, and 29.22 g of sodium chloride respectively, dissolve them with appropriate amount of ultrapure water, and dissolve them with ultrasonic aid. After they are completely dissolved, adjust the pH to 7.4 with concentrated hydrochloric acid and 1 M sodium hydroxide solution, make the volume to 1 L, filter through a 0.22 μm filter membrane, and store at 4°C.

[0061] (5) Binding buffer 2: Based on Binding buffer 1, add TritonX-100 to a final concentration of 1%. Add protease inhibitor PMSF according to the instructions and prepare for immediate use.

[0062] (6) Elution buffer: Add imidazole to Binding buffer 1 to a final concentration of 500 mM, adjust the pH to 7.4 with concentrated hydrochloric acid, make up to 1 L, filter through a 0.22 μm filter membrane, and store at 4°C.

[0063] (7) Running buffer (5×): The components include 25 mM Tris, 250 mM glycine and 0.1% SDS. Weigh 15.15 g Tris, 72.2 g glycine and 5 g SDS respectively, dissolve them in appropriate amount of ultrapure water, sonicate to make up to 1 L, and store at room temperature.

[0064] (8) Transfer buffer: The components include 48 mM Tris, 39 mM glycine and 20% ethanol, pH = 9.2. Weigh 2.907 g of Tris and 1.464 g of glycine respectively, dissolve them in appropriate amount of ultrapure water, add 100 mL of anhydrous ethanol, adjust the pH to 9.2, make up to 500 mL, and store at room temperature.

[0065] (9) TBST 1: The components include 20 mM Tris, 150 mM NaCl and 0.1% Tween 20, pH = 7.5. Weigh 4.39 g of sodium chloride, dissolve it in an appropriate amount of ultrapure water, add 10 mL of 1 M Tris-HCl and 500 μL of Tween 20, mix thoroughly, adjust the volume to 500 mL, and store at room temperature.

[0066] (10) TBST 2: The composition is TBST 1 containing 3% BSA. Weigh 1.5 g BSA into 50 mL TBST 1, dissolve it with ultrasonic aid, store it at 4°C, and use it immediately after preparation.

[0067] (11) Mouse anti-His-HRP: The monoclonal antibody working solution was diluted into TBST2 solution at a ratio of 1:2000.

[0068] 1.4. Plasmid construction: target gene and vector cloning

[0069] First, the amino acid sequence of GMT / GM / MT / MSP polypeptide was converted into the corresponding gene coding sequence using SnapGene software, and the CDS sequence (see Figure 5-8 ) were added to the upstream and downstream of the pET28a(+) vector, respectively, so that the target gene could be cloned into the expression vector. In addition, in order to improve the translation speed and protein expression efficiency of the expression vector in BL21(DE3), the CDS sequence with the introduced restriction sites was codon optimized. At the same time, the introduction of new XhoI and NcoI restriction sites in the target gene sequence should be avoided. The GC content (GC%) and codon adaptability index (CAI) of the optimized DNA sequence were as follows: GMT: GC = 53.10%, CAI = 0.90; GM: GC = 52.17%, CAI = 0.90; MT: GC = 52.67%, CAI = 0.87; MSP: GC = 52.67%, CAI = 0.87. The optimized CDS sequence was cloned into the multiple cloning site of pET28a(+) with the help of SnapGene software, as shown in Figure 2. Figure 3 As shown in the red part of the plasmid map, plasmids pET28a-GMT, pET28a-GM, pET28a-MT, and pET28a-MSP were obtained by whole gene synthesis and then introduced into BL21 (DE3) for induced expression. Among them, the whole gene synthesis and sequencing verification of the target gene were completed by Guangzhou Ruibo Biotechnology Co., Ltd. (Fusion membrane skeleton protein whole gene synthesis and expression vector construction are shown in Figure 4 shown).

[0070] Fusion membrane skeleton protein amino acid sequence:

[0071]

[0072]

[0073] GM( GE11 -MSP, SEQ ID No: 2):

[0074] YHWYGYTPQNVI GGGGSGGGGSLEELWEKLRQKLEELREKLRPLLEELWEKLRQKLEELREKLRPLLEELWEKLRQKLEELREKLRPLLEELWEKLRQKLEELREKLRPLLEELWEKLRQKLEELREKLRPLLEELWEKLRQKLEELREKLRPLHHHHHH;

[0075]

[0076]

[0077] MSP (membrane skeleton protein, membrane skeleton protein, SEQ ID No: 4):

[0078] LEELWEKLRQKLEELREKLRPLLEELWEKLRQKLEELREKLRPLLEELWEKLRQKLEELREKLRPLLEELWEKLRQKLEELREKLRPLLEELWEKLRQKLEELREKLRPLLEELWEKLRQKLEELREKLRPLHHHHHH。

[0079] Fusion membrane skeleton protein coding sequence (Coding Sequence, CDS sequence):

[0080]

[0081]

[0082] GM( GE11 -MSP, SEQ ID No: 6):

[0083] 5’-CTCGAGTCAGTGGTGGTGGTGGTGGTGCAGTGGACGCAGTTTTTCACGCAGCTC TTCCAGTTTCTGACGCAGTTTTTCCCACAGTTCTTCCAGCAGAGGACGCAGTTTTTCGCGCAGCTCCTCCAGTTTCTGACGCAGCTTCTCCCACAGTTCTTCCAGCAGCGGACGCAGTTTTTCACGCAGTTCTTCCAGCTTCTGGCGCAGTTTTTCCCACAGCTCTTCCAGCAGCGGACGCAGTTTTTCACGCAGTTCTTCCAGTTTCTGACGCAGCTTTTCCCACAGTTCTTCCAGCAGTGGACGCAGTTTTTCACGCAGTTCTTCCAGTTTTTGACGCAGCTTTTCCCACAGTTCTTCCAGCAGCGGACGCAGTTTTTCGCGCAGTTCTTCCAGTTTCTGACGCAGTTTTTCCCACAGTTCCTCCAGGCTACCACCACCACC AGAACC ACCACCGCCGATAACGTTCTGCGGAGTATAACCGTACCAGTGGTAACCCA TGG-3’;

[0084]

[0085]

[0086] GCCATA CAGCGGGCGCAGTTTTTCACGCAGTTCTTCCAGTTTCTGGCGCAGCTTTTCCCA

[0087] CAGTTCCTCCAGCAGCGGACGCAGTTTTTCGCGCAGTTCTTCCAGTTTCTGACGCAGTTT

[0088] TTCCCACAGTTCTTCCAGCAGCGGACGCAGTTTTTCGCGCAGTTCTTCCAGTTTCTGGCG

[0089] CAGTTTCTCCCACAGTTCTTCCAGCAGCGGACGCAGCTTCTCACGCAGTTCTTCCAGTTT

[0090] CTGACGCAGTTTTTCCCACAGTTCTTCCAGCAGCGGACGCAGTTTTTCACGCAGTTCTTC

[0091] CAGCTTCTGGCGCAGTTTTTCCCACAGTTCTTCCAGCAGCGGGCGCAGTTTTTCGCGCAGCTCTTCCAGCTTTTGACGCAGTTTTTCCCACAGTTCTTCCAGACCCATGG-3';

[0092] MSP (SEQ ID No: 8):

[0093] 5'-CTCGAGTCAGTGGTGGTGGTGGTGGTGCAGTGGACGCAGCTTCTCACGCAGTTC CTCCAGTTTTGACGCAGCTTTTCCCACAGTTCTTCCAGCAGCGGACGCAGTTTTTCACGCAGTTCTTCCAGTTTCTGGCGCAGTTTTTCCCACAGTTCCTCCAGCAGCGGACGCAGTTTCTCACGCAGCTCTTCCAGTTTCTGACGCAGTTTTTCCCACAGCTCTTCCAGCAGAGGGCGCAGTTTTTCG CGCAGTTCTTCCAGTTTCTGACGCAGTTTTTCCCACAGTTCTTCCAGCAGCGGACGCAGTTTCTCACGCAGTTCTTCCAGCTTCTGACGCAGTTTTTCCCACAGTTCTTCCAGCAGCGGACGCAGTTTTTCGCGCAGTTCTTCCAGTTTTTGACGCAGTTTTTCCCACAGTTCTTCCAGACCCATGG-3'.

[0094] 1.5. Prokaryotic expression of fusion membrane skeleton protein:

[0095] (1) Preparation of competent E. coli BL21 (DE3): ① Use a sterilized toothpick to pick a single colony from the inverted plate into a sterile conical flask containing 60 mL of fresh LB medium and culture at 37°C, 200 rpm for 3 h. ② In a clean bench, transfer 50 mL of the cultured bacterial solution to a 50 mL centrifuge tube. ③ Centrifuge at 4°C, 5000 rpm for 10 min to collect the bacterial precipitate. ④ Discard the supernatant and remove as much residual culture medium as possible. ⑤ Resuspend the bacterial precipitate with pre-cooled 0.1 M calcium chloride solution, wash thoroughly, centrifuge, and discard the supernatant. ⑥ Resuspend the bacterial precipitate with 2 mL of pre-cooled 0.1 M calcium chloride solution containing 25% glycerol. ⑦ After the cell suspension is fully mixed, aliquot into 100 μL / tubes, label, and freeze at -80°C.

[0096] (2) Transformation of E. coli BL21 (DE3) with recombinant plasmids: ① Take out 4 competent BL21 (DE3) cells from -80℃ and slowly thaw them on ice. ② Add 25ng of pET28a-GMT, pET28a-GM, pET28a-MT, and pET28a-MSP plasmids to the thawed competent cells and mix well. ③ Ice bath for 30min, heat shock at 42℃ for 90s, and ice bath for 2min. ④ Add 0.5mL of fresh LB medium to each tube, and then culture at 37℃ and 200rpm for 1h. ⑤ Take 10μL of bacterial solution from each tube, apply it on a fresh LB plate containing 100μg / mL kanamycin prepared in advance, and mark it. ⑥ Culture in an incubator at 37℃ for 16-20h.

[0097] (3) Induced expression of fusion membrane skeleton protein: ① Take four sterile 50mL centrifuge tubes and add 10mL of fresh LB medium containing 100μg / mL kanamycin to each of them. ② Use a sterile toothpick to pick one pET28a-GMT, pET28a-GM, pET28a-MT, and pET28a-MSP monoclonal colony in the above centrifuge tubes. ③ Culture at 37℃, 180rpm for 16-20h to obtain the primary culture solution. ④ Take four 2L pre-sterilized conical flasks and add 500mL of fresh LB medium containing 100μg / mL kanamycin to each of them. ⑤ Inoculate the above primary culture solution into the conical flask at a ratio of 1:100 in a clean bench. ⑥ Culture in a shaker at 37℃, 180rpm until OD 600 is 0.6-0.8. ⑦ Take out 2mL of bacterial solution from the above conical flasks into ep tubes, centrifuge at 7000rpm for 3min, discard the supernatant, and temporarily store the bacterial pellet at -20℃ as a blank control. ⑧ Add IPTG to the conical flask to a final concentration of 0.5mM and continue to culture for 4h. ⑨ After the culture is completed, the bacterial solution in the conical flask is divided into 50mL centrifuge tubes, centrifuge at 12000rpm for 10min, discard the supernatant, combine the bacterial pellets into a centrifuge tube, mark, and temporarily store at -20℃. ⑩ Take out the above-mentioned samples induced for 0-4h from -20℃, add 500μL 8M urea solution, and mix well. Take 20 μL of each sample into eight rows of tubes, add 5 μL of 5x loading buffer, and incubate in a 100°C water bath for 15 min. Use 15% SDS-PAGE separation gel, load 10 μL, 120V, and run for 75 min. After electrophoresis, the concentrated gel was cut off, and the separation gel was stained with Coomassie Brilliant Blue staining solution for 1 h, and photographed and recorded.

[0098] 1.6. Large-scale expression and purification of fusion membrane skeleton protein:

[0099] (1) Fermentation of engineered bacteria: ① Take four sterile 50mL centrifuge tubes and add 10mL of fresh LB medium containing 100μg / mL kanamycin to each of them. ② Use a sterile toothpick to pick one pET28a-GMT, pET28a-GM, pET28a-MT, and pET28a-MSP monoclonal colony in each of the above centrifuge tubes. ③ Culture at 37℃, 180rpm for 16-20h to obtain the primary culture solution. ④ Take four 2L pre-sterilized conical flasks and add 1L of fresh LB medium containing 100μg / mL kanamycin to each of them. ⑤ Inoculate the primary culture solution into each conical flask at a ratio of 1:100 and culture at 37℃, 180rpm. ⑥ Culture until OD 600 When the pH value is 0.6-0.8, add IPTG to a final concentration of 0.5 mM and continue culturing for 4 hours under the same conditions. ⑦ After the culture is completed, divide the bacterial solution into 50 mL centrifuge tubes, centrifuge at 12000 rpm, 4°C for 10 minutes, and collect the bacteria. ⑧ Combine the bacterial precipitates in each tube into one centrifuge tube, remove the supernatant as much as possible, mark, and temporarily store at -80°C.

[0100] (2) Ultrasonic disruption of bacteria: ① Take out the bacterial precipitate at -80℃, add pre-cooled Binding buffer 1 at a ratio of 30mL / tube, resuspend and wash thoroughly, centrifuge at 4℃, 12000rpm for 10min, and discard the supernatant. ② Add the same volume of Binding buffer 1 to the bacterial precipitate for washing, and repeat 2-3 times. ③ Weigh the bacterial precipitate obtained for the last time, and add Binding buffer 2 to the wet bacteria at a ratio of 5mL / g to resuspend the bacteria. ④ Place in an ice bath, ultrasonically disrupt, power is 200W, 3s on, 6s off, and ultrasonically disrupt for a total of 40min. ⑤ After the disruption is completed, centrifuge at 12000rpm, 40min, 4℃, collect the supernatant, and store at 4℃.

[0101] (3) Affinity chromatography purification of fusion membrane skeleton protein: ① Place an appropriate amount of Ni-NTA resin in the chromatography column. After the liquid is drained, rinse the resin with 10-15 column volumes of deionized water. ② Equilibrate the resin with 5 column volumes of Binding buffer 1. ③ Pass the collected supernatant through a 0.45 μm filter membrane after ultrasonic disruption, add the filtrate to the equilibrated chromatography column, mix thoroughly, and incubate at 4°C for 1-2 hours to allow the target protein to fully bind to the resin. ④ Collect the flow-through. ⑤ Wash the chromatography resin with 20 column volumes of Binding buffer 1, taking care not to damage the resin surface. ⑥ Perform gradient elution with Elution buffer with different imidazole concentrations and collect the eluate. ⑦ After elution, wash the chromatography column with Elution buffer (500 mM) containing the maximum imidazole concentration. ⑧ Wash the chromatography column with deionized water. ⑨ Store the washed chromatography column at 4°C with 20% ethanol.

[0102] 1.7. Electrophoresis identification of fusion membrane skeleton protein:

[0103] ① Take 20μL of the flow-through and elution obtained in the previous step respectively into eight rows of tubes, add 5μL of 5×loading buffer, incubate at 100℃ for 15min, and centrifuge. ② Select 15% SDS-PAGE gel, add 1×Running buffer, and load 10μL / well. ③120V, electrophoresis for 75min. ④ After the electrophoresis, cut off the concentrated gel, add appropriate amount of non-decolorizing Coomassie brilliant blue staining solution for 1h, and take photos for record.

[0104] 1.8. Obtaining lyophilized powder of fusion membrane skeleton protein:

[0105] ①According to the electrophoresis results of the previous step, collect and combine the eluate containing the target protein. ②Freeze dry with a freeze dryer to obtain a protein freeze-dried powder containing salt. ③After dissolving the freeze-dried powder with an appropriate amount of deionized water, add it to a dialysis bag (MWCO7000Da) and dialyze at a ratio of 1:1000. ④Replace the dialysis fluid (deionized water) after 2h, 5h, 12h, 24h, and 36h of dialysis. ⑤After the dialysis is completed, transfer the protein solution in the dialysis bag into a 50mL centrifuge tube, freeze-dry and obtain the target protein freeze-dried powder. ⑥Take an appropriate amount of the obtained freeze-dried powder and dissolve it with 200μL Binding buffer 1, take 20μL and add it to eight rows of tubes, add 5μL5xloadingbuffer, water bath at 100℃ for 15min, and centrifuge.

[0106] 1.9. Western blot identification of fusion membrane skeleton protein:

[0107] ①After the electrophoresis is completed, remove the gel, cut off the concentrated gel, and wash with deionized water. ②Take 4 filter papers and 1 PVDF membrane that match the size of the gel. The PVDF membrane is pre-activated with 75% ethanol and then soaked in deionized water for 2 minutes. The filter paper and gel are pre-moistened with Transfer buffer. ③Place them in the electrophoresis tank in the order of filter paper-gel-PVDF membrane-filter paper, and remove bubbles. The PVDF membrane is at the positive electrode and the SDS-PAGE gel is at the negative electrode. ④The voltage is 25V or the current is 1A, and the semi-dry transfer method is used for 30 minutes. ⑤After the transfer is completed, take out the PVDF membrane, face up, add an appropriate amount of TBST solution containing 3% BSA, and block at room temperature for 1 hour. ⑥Add an appropriate amount of antibody solution (mouse anti-His-HRP monoclonal antibody, 1:2000) to the blocked PVDF membrane, incubate at room temperature for 1 hour, and recover the antibody. ⑦After the incubation is completed, wash the membrane with TBST solution 3-4 times, 10 minutes each time. ⑧ Freshly prepared ECL chemiluminescent solution was evenly added onto the PVDF membrane, and then developed and analyzed on a multifunctional gel imaging system.

[0108] 2. Experimental results

[0109] 2.1. Construction and identification of prokaryotic expression vector:

[0110] The target gene fragments in the pET28a-GMT, pET28a-GM, pET28a-MT, and pET28a-MSP expression vectors were sequenced and analyzed. The gene sequence in the sequencing results completely matched the expected target gene sequence ( Figure 5-8 ), indicating that the prokaryotic expression vectors of the above four fusion membrane skeleton proteins were successfully constructed.

[0111] 2.2. Inducible expression of fusion membrane skeleton protein:

[0112] The constructed pET28a-GMT, pET28a-GM, pET28a-MT, and pET28a-MSP were introduced into BL21 (DE3) competent cells, and the expression system to be induced was obtained after pouring plates, picking single colonies, and expanding the culture. 600 When the pH value reached 0.6-0.8, IPTG was added to each system to a final concentration of 0.5 mM, and the target protein was induced to express for 4 h at 37°C. The protein content in the whole bacteria was detected by 15% SDS-PAGE gel to verify whether the target protein was expressed. The results are as follows: Fig. 9As shown. The molecular weights of the four target proteins are Mw(GMT): 21.7kD; Mw(GM): 20.2kD; Mw(MT): 19.6kD; Mw(MSP): 18.0kD. From the figure, we can see that the target protein bands appear in the target molecular weight range (15-25kD), indicated by red arrows. This shows that the above four target proteins can be expressed normally in the constructed expression system. It is worth noting that the theoretical molecular weight of MT protein is lower than that of GM, but it shows opposite bands on the SDS-PAGE graph. It may be because the MT protein molecule itself carries too much charge, which leads to deviation in the gel results.

[0113] 2.3. Large-scale expression and purification of fusion membrane skeleton protein:

[0114] BL21(DE3) engineering bacteria were cultured in large quantities at OD 600 =0.6-0.8, add IPTG, and induce at 37℃ for 4h. Collect the cells by centrifugation, wash thoroughly, add lysis buffer, ultrasonically lyse, and centrifuge to obtain the supernatant containing the target protein. Because the target proteins all carry 6x His tags, Ni-NTA affinity chromatography resin is used to purify the target proteins. Elution buffer containing different imidazole concentrations is used for elution to separate the impurities from the target protein as much as possible, collect the eluate at each imidazole concentration, and then use 15% SDS-PAGE gel for electrophoresis verification. The results are shown in Fig.10 As shown. The fusion membrane skeleton proteins GMT and MSP were eluted at an imidazole concentration of 300 mM ( Fig.10 A, D), and GMT has a stronger affinity with the resin than MSP, making it more difficult to elute. GM was eluted at an imidazole concentration of 200 mM ( Fig.10 B), MT was eluted in large quantities at an imidazole concentration of 500 mM ( Fig.10 C), indicating that MT has a higher affinity for the resin than GM and is not easy to elute. As the elution proceeds, the target protein remaining on the resin gradually decreases. The band eluted with low imidazole concentration is darker in color and has some miscellaneous bands, indicating that the concentration of the target protein is high but the purity is low. The band eluted with high concentration is light in color and single, indicating that the concentration of the target protein is low but the purity is high. All four target proteins are within the target molecular weight range.

[0115] 2.4. Western blot identification of fusion membrane skeleton protein:

[0116] After large-scale expression and purification of the target protein, a saline solution of the target protein was obtained, which was then freeze-dried, dialyzed, and freeze-dried to obtain freeze-dried powder of the target protein. In order to detect whether the target protein was degraded during this series of processes, SDS-PAGE and Western blot identification of the target protein were performed. The experimental results are shown in Figure 2. Fig.11 As shown. From the SDS-PAGE experimental results ( Fig.11 A) It can be seen that the molecular weights of the four target proteins are in line with the expected range (15-25kD), and this result was further verified in the WB experimental results ( Fig.11 B). This indicates that the target protein obtained by freeze-drying has not been significantly degraded and can be used for subsequent experiments.

[0117] In summary, in order to obtain the fusion membrane skeleton protein modified by MSP and TAT or (and) GE11, the present embodiment first utilizes molecular cloning technology to carry out artificial recombination of the gene encoding membrane skeleton protein, and then clones the recombinant gene into pET28a (+) plasmid, obtains the plasmid pET28a-GMT, pET28a-GM, pET28a-MT, pET28a-MSP containing each fusion membrane skeleton protein gene, and then uses the prokaryotic expression system BL21 (DE3) to carry out the expression preparation of fusion membrane skeleton protein. In the embodiment, firstly, whether plasmid pET28a-GMT, pET28a-GM, pET28a-MT, pET28a-MSP can correctly express fusion membrane skeleton protein GMT, GM, MT, MSP by SDS-PAGE gel electrophoresis. SDS-PAGE results show that four kinds of fusion membrane skeleton proteins are correctly expressed. Afterwards, to meet the needs of subsequent experiments, a large amount of expression and purification of target protein are carried out, and the target protein obtained is desalted and lyophilized. Before conducting further experiments, the obtained fusion membrane skeleton protein freeze-dried powder was reconfirmed by SDS-PAGE gel electrophoresis and WB experiments. The experimental results showed that the expressed and purified fusion membrane skeleton protein did not undergo obvious degradation after freeze-drying, dialysis and freeze-drying operations, and could be used for subsequent experiments.

[0118] Example 2: Construction and anti-tumor application of targeted nano-drug delivery system

[0119] 1. Experimental Materials and Methods

[0120] 1.1. The reagents used are as follows:

[0121] Dipalmitoylphosphatidylcholine (DPPC), Avanti Polar Lipids; Sodium cholate, TCI (Shanghai) Chemical Industry Development Co., Ltd.; Palmitic acid hydrazide (PA), 1M Tris-HCl, dimethyl sulfoxide (DMSO), doxorubicin hydrochloride (DOX), anhydrous methanol, acetonitrile, trifluoroacetic acid (TFA), Shanghai Aladdin Biochemical Technology Co., Ltd.; EDTA, Guangzhou Saiguo Biotechnology Co., Ltd.; Sodium chloride, Shanghai MacLean Biochemical Technology Co., Ltd.; Sodium phosphotungstate, Merck Sigma-Aldrich (Shanghai); PBS, DMEM, 0.25% trypsin (containing EDTA), fetal bovine serum (FBS), Thermo Fisher Scientific (GIBCO); CCK-8, Abbkine Scientific Co., Ltd.; DAPI, Beijing Solebao Technology Co., Ltd.; 100× penicillin-streptomycin, anti-fluorescence quenching mounting medium, Shanghai Bio-Technology Co., Ltd.

[0122] 1.2. The instruments used are as follows:

[0123] FreeZone 2.5L-50 freeze dryer, LABCONCO, USA; ultrasonic cleaner, Kunshan Ultrasonic Instrument Co., Ltd.; 1 / 10,000 electronic balance, Sartorius; constant temperature water bath shaker, Shanghai Hetian Scientific Instrument Co., Ltd.; Airstream A2 type secondary biological safety cabinet, Yishike (Shanghai) Enterprise Development Co., Ltd.; Eclips TS2 inverted fluorescence microscope, Nikon, Japan; Thermo Fisher BB150 cell culture incubator, Thermo Fisher Scientific; Malvern laser particle size analyzer, Malvern, UK; Xiangyi H2050R refrigerated high-speed centrifuge, Hunan Xiangyi Laboratory Instrument Development Co., Ltd.; CytoFLEX flow cytometer, Beckman Coulter Co., Ltd.; LSM 880 confocal laser scanning microscope, ZEISS, Germany; transmission electron microscope Tecnai G2spirit 120kV, FEI Company.

[0124] 1.3. Solution preparation:

[0125] (1) MSP buffer components: 20 mM Tris-HCl, 100 mM NaCl, 0.5 mM EDTA. Weigh 5.8440 g of sodium chloride and 0.1461 g of EDTA respectively, dissolve them in ultrapure water, sonicate, add 20 mL of 1 M Tris-HCl (pH 7.5), and after fully dissolving, adjust the volume to 1 L, filter through a 0.22 μm filter, and store at 4°C.

[0126] (2) Sodium cholate stock solution composition: 100 mM sodium cholate. Weigh 430.56 mg sodium cholate and dissolve it in 10 mL msp buffer. Sodium cholate is dissolved by ultrasound. After it is completely dissolved, it is stored at 4°C.

[0127] (3) Phospholipid stock solution components: 50 mM DPPC (dipalmitoylphosphatidylcholine), 100 mM sodium cholate. Weigh 36.7 mg DPPC and dissolve it in 1 mL 100 mM sodium cholate solution. Incubate at 41°C for 10 min, sonicate to assist dissolution, and store at 4°C after complete dissolution.

[0128] (4) DOX-PA stock solution composition: 20 mM DOX-PA DMSO solution. Weigh 8.3 mg of DOX-PA and dissolve it in 0.5 mL of DMSO. After it is completely dissolved, store it at 4°C.

[0129] (5) Membrane skeleton protein stock solution (msp) composition: 500 μM GMT / GM / MT / MSP. The molecular weights of the proteins are: MW(GMT)=21.7 kDa, MW(GM)=20.2 kDa, MW(MT)=19.6 kDa, MW(MSP)=18.0 kDa. Weigh 10.85 mg of protein lyophilized powder GMT, 10.1 mg of GM, 9.8 mg of MT, and 9.0 mg of MSP, respectively, and dissolve them in 1 mL of 100 mM sodium cholate solution. Sonicate and dissolve them completely, and store them at 4°C.

[0130] (6) 2% sodium phosphotungstate solution: 2% sodium phosphotungstate in PBS. Weigh 0.2 g of sodium phosphotungstate and dissolve it in 10 mL of PBS. After it is fully dissolved, store it at room temperature away from light.

[0131] 1.4. Synthesis and confirmation of prodrug DOX-PA:

[0132] The reaction route for preparing pH-responsive prodrug DOX-PA is as follows: Fig.12 As shown, the synthesis process is as follows: ① Weigh 52.4 mg of doxorubicin hydrochloride and 74.6 mg of palmitic acid hydrazide into a 50 mL fully dried round-bottom flask. ② Use a syringe to add 15 mL of anhydrous methanol to the round-bottom flask, and mix for 30 min at room temperature and away from light with a magnetic stirrer. ③ After completion, add 9 μL TFA to the reaction system with a glass microsyringe, and reflux for 5 h at 60 ° C in an oil bath. ④ After the reaction is completed, remove the reaction solvent on a rotary evaporator to obtain a red solid. ⑤ Add 5 mL of anhydrous methanol, redissolve the solid, and sonicate to assist dissolution. ⑥ Add 40 mL of acetonitrile and refrigerate at 4 ° C for recrystallization. ⑦ Filter, wash the solid with acetonitrile several times, and after sufficient drying, weigh, mark, and store at -20 ° C away from light. ⑧ Take an appropriate amount of the above-mentioned dried product, dissolve it with methanol, filter it with a 0.22 μm filter membrane, and identify it by mass spectrometry.

[0133] 1.5. Construction of Nanodisc Drug Delivery Vehicles:

[0134] ① According to the description under the solution preparation item, prepare msp buffer, sodium cholate stock solution, membrane skeleton protein stock solution, phospholipid stock solution, and DOX-PA stock solution in sequence. ② Add msp buffer, sodium cholate stock solution, phospholipid stock solution, membrane skeleton protein stock solution, and Drug stock solution in sequence. The proportion of each component is shown in Table 1, where msp buffer: 1000μL, phospholipid (DPPC): 300μL, membrane skeleton protein: 1000μL, DOX-PA: 125μL, the ratio of the self-assembly system is Lipid: msp: DOX-PA = 30: 1: 5, and the total volume is 2425μL. ③ The self-assembly mixed system is incubated in a water bath at 41°C (the phase transition temperature of DPPC) and 120rpm for 2h. ④ Add 0.4g of pre-wetted Bio-beads to the self-assembled mixed system, the amount added is Bio-beads / mL mixed system, and add twice, with a 2h interval in between (Bio-beads need to be pre-treated: soak in methanol for 10min, wash with deionized water 3-5 times, and wash with mspbuffer 1-2 times). ⑤ After the last addition of Bio-beads, continue incubation for 3h under the same conditions to fully remove sodium cholate. ⑥ After the incubation, separate the reaction system from the Bio-beads with a pipette. ⑦ Use microcolumn centrifugation to separate encapsulated and unencapsulated drugs. ⑧ Pretreatment of dextran gel G-50 microcolumn. Take 5mL of pre-swollen dextran gel G-50 resin and add it to a microcolumn with a volume of 12mL. Centrifuge at 5000rpm for 15min to remove the protective solution of 20% ethanol, wash with an appropriate amount of deionized water 3-4 times, and then balance with msp buffer 1-2 times. ⑨ Add 2 mL of the self-assembled system to the microcolumn, centrifuge at 5000 rpm for 15 min, and collect the filtrate. ⑩ After the filtrate passes through a 0.22 μm filter membrane, it is labeled as ND(GMT)@DOX-PA, ND(GM)@DOX-PA, ND(MT)@DOX-PA, and ND(MSP)@DOX-PA, and stored at 4°C in the dark.

[0135] Table 1 The ratio of each component in the nanodisk self-assembly system

[0136]

[0137]

[0138] Note: The concentration of each component is shown in the solution preparation section.

[0139] 1.6. Particle size and morphology characterization:

[0140] ① Particle size determination: Before the determination, each nanosystem was filtered through a 0.22μm filter membrane and degassed (ultrasound for 1-2 minutes) to eliminate interference as much as possible. After the sample pool was washed 2-3 times with anhydrous ethanol, deionized water, and msp buffer, an appropriate amount of the sample to be tested was added and tested on the machine. After the test, the sample was recovered. ② Morphological characterization: Take the nanodisk prepared above, dilute it appropriately with msp buffer, take 10μL of the sample and drop it on the carbon surface of the copper mesh, evaporate it naturally to a semi-dry state, absorb the remaining liquid with filter paper, add 2% sodium phosphotungstate aqueous solution for negative staining for 1-2 minutes, absorb the excess negative staining liquid with filter paper, and observe it with a 120kV transmission electron microscope after drying.

[0141] 1.7. DOX standard curve establishment:

[0142] First, the absorption spectrum of DOX in PBS was measured by an ELISA instrument to determine its maximum absorption wavelength in PBS. In order to determine the encapsulation efficiency and drug loading of DOX in the nanosystem, a standard curve of DOX absorbance changing with concentration was established. The DOX stock solution was diluted with PBS to a series of gradient concentrations (0.0000, 0.0500, 0.0625, 0.1000, 0.1250, 0.2000, 0.2500, 0.4000, 0.5000 mM), and the absorbance at the maximum absorption wavelength was measured by an ELISA instrument. After deducting the background absorption, a linear regression was performed.

[0143] 1.8. Determination of drug loading (DL%) and encapsulation efficiency (EE%):

[0144] After the nanosystem was centrifuged by microcolumn to remove the unencapsulated drug, 500 μL of the nanosystem was added to 500 μL of PBS containing 1% TritonX-100 to release the encapsulated drug. An equal volume mixture of PBS containing mspbuffer and 1% TritonX-100 was used as a blank control, and the absorbance at 480 nm was measured by an enzyme reader. The concentration of DOX was obtained from the standard curve, and the encapsulation efficiency EE% was calculated according to formula (3-1). The nanosystem after microcolumn centrifugation was dried on a freeze dryer to obtain a solid powder. 15 mg was weighed and dissolved in 1 mL of PBS containing 1% Triton X-100. After gradient dilution, the absorbance at the maximum absorption wavelength was measured by an enzyme reader. The concentration of DOX was obtained from the standard curve, and the drug loading DL% was calculated according to formula (3-2).

[0145] Formula (3–1):

[0146] D e ——Mass of encapsulated DOX, mg;

[0147] D t——Total DOX mass input, mg;

[0148] Formula (3–2):

[0149] W drug ——DOX mass in carrier, mg;

[0150] W carrier ——Mass of carrier, mg.

[0151] 1.9 Cell lines and cell culture:

[0152] The cells used were human non-small cell lung cancer cells A549, which were cultured at 37°C and 5% CO2. The proportions of the complete culture medium used were: 89% DMEM + 10% FBS + 1% double antibody (penicillin / streptomycin 100×). The cells were passaged when they reached 80% confluence, with a passage ratio of 1:3, and cells in the logarithmic growth phase were used for subsequent experiments.

[0153] 1.10. Cell proliferation toxicity analysis:

[0154] CCK-8 assay was used to detect the cytotoxic effects of ND(GMT)@DOX-PA, ND(GM)@DOX-PA, ND(MT)@DOX-PA, and ND(MSP)@DOX-PA on A549 cells, with free DOX as a positive control. A549 cells in the logarithmic growth phase were seeded into a 96-well plate at a density of 4000 / well, and 6 replicate wells were set up. 100 μL / well of sterile PBS was added to the outermost circle of the 96-well plate, and cultured for 24 hours at 37°C and 5% CO2 to allow full adhesion. After that, the old culture medium was discarded and replaced with fresh culture medium containing different concentrations of ND(GMT)@DOX-PA, ND(GM)@DOX-PA, ND(MT)@DOX-PA, ND(MSP)@DOX-PA and free DOX (the concentration converted to DOX was: 0.0000, 0.0391, 0.0781, 0.1563, 0.6250, 2.5000, 5.0000, 10.0000, 100.0000 μM), and the culture was continued for 48 h. After the culture was completed, the culture medium was discarded, each well was washed once with sterile PBS, and then fresh culture medium containing CCK-8 was added according to the instructions, and the incubation was continued for 2 h. After the culture was completed, the absorbance at 450 nm was measured with an enzyme reader, and the cell survival rate was calculated according to formula (3–3):

[0155] Formula (3–3):

[0156] OD t ——Optical density value of the experimental group;

[0157] OD c ——Optical density value of the positive control group;

[0158] OD b ——Optical density value of blank control group.

[0159] 1.11 Qualitative analysis of cellular uptake:

[0160] A549 cells in the logarithmic growth phase were cultured at 1×10 5 / dish was inoculated into a glass-bottomed cell culture dish and cultured at 37°C, 5% CO2 for 24 hours. The culture medium was discarded, washed once with PBS, and then replaced with fresh culture medium containing ND(GMT)@DOX-PA, ND(GM)@DOX-PA, ND(MT)@DOX-PA, ND(MSP)@DOX-PA and free DOX (DOX concentration was 6μM), and incubated for 10 hours. 100μM free GE11 was co-incubated for competitive uptake. After the incubation, the culture medium was discarded, washed three times with pre-cooled PBS, fixed with 4% paraformaldehyde at room temperature for 30 minutes, washed three times with PBS, stained with DAPI at room temperature for 5 minutes, washed three times with PBS, added an appropriate amount of anti-fluorescence quenching sealing agent, selected DAPI and Doxorubicin channels, and observed the uptake of nanosystem and free DOX by A549 cells on a laser confocal scanning microscope.

[0161] 1.12. Quantitative analysis of cellular uptake:

[0162] A549 cells in logarithmic growth phase were cultured at 5×10 4 / well was inoculated into a 12-well plate and cultured at 37°C, 5% CO2 for 24h. At specific time points, the medium containing 6μM DOX was replaced (the nanosystem was calculated based on the concentration of DOX), so that the drug treatment time was 0, 1, 2, 4, 8, and 10h. After the incubation, the medium containing floating cells was collected, the attached cells were digested with trypsin, the cells collected twice were combined, centrifuged at 7000rpm for 3min, the supernatant was discarded, the cell pellet was washed 2-3 times with pre-cooled PBS, and the cell pellet after the last wash was resuspended with 0.5mL PBS, and the fluorescence intensity of DOX in each group was detected by BD CytoFLEX.

[0163] 1.13 Statistical analysis

[0164] The experiment was repeated three times, and the data were expressed as mean ± SD. All experimental data were processed with Excel and Graphpadprism, and one-way ANOVA and t-test were used to analyze whether there were significant differences between the data, *P<0.1, **P<0.01, ***P<0.001, ****P<0.0001.

[0165] 2. Experimental results

[0166] 2.1. Synthesis and confirmation of DOX-PA prodrug:

[0167] The chemical formula of the prodrug DOX-PA is C 43 H 61 N3O 11 The relative molecular weight is 795.43, and the theoretical value of mass-to-charge ratio m / z is 796.43 ([M+H] + ), the prepared DOX-PA was dried and confirmed by mass spectrometry. Fig.13 As shown, the molecular weight is consistent with the theoretical value, proving that PA has been successfully linked to DOX. After drying, the weight is 65.7 mg, and the yield is calculated to be 87.5%.

[0168] 2.2. Particle size and morphological characteristics:

[0169] In order to investigate the particle size changes of the nanodisc delivery carrier before and after drug loading, the particle size characteristics of each nanosystem were measured using a Malvern laser particle size analyzer. The results are as follows: Fig.14 As shown in Figures A and B, the particle size of the nanodisc delivery carrier after drug loading is more uniform than before drug loading, and the particle size does not fluctuate significantly, ranging from 10-15nm. After the particle size was investigated using a Malvern laser particle size analyzer, the morphological characteristics of the nanodisc delivery carrier were investigated using a transmission electron microscope, as shown in Figures A and B. Fig.15 As shown. The four nanodisc delivery carriers ND(GMT)@DOX-PA, ND(GM)@DOX-PA, ND(MT)@DOX-PA, and ND(MSP)@DOX-PA all showed a disc-shaped morphology, and the particle size was within the range of the Malvern laser particle size analyzer. Fig.15 As can be seen from the white marks in the figure, the four nanodisc delivery vectors all show a morphology of stacked phospholipid disc-like regions, which is an important feature of the system's self-assembly to form a nanodisc delivery vector. This indicates that the difference in fusion membrane skeleton proteins does not affect the self-assembly process of the nanodisc delivery vector. In general, the successful construction of the nanodisc drug delivery vector can be confirmed based on the particle size and morphological results.

[0170] 2.3. Drug loading and encapsulation efficiency:

[0171] The maximum absorption wavelength of DOX was determined by scanning the absorption spectrum of DOX in PBS containing 1% Triton X-100. The absorption spectrum characteristics of DOX are as follows: Fig.16As shown in the figure, 480nm is one of the maximum absorption wavelengths of DOX in this system, so 480nm is selected as the absorption wavelength for determining the concentration of DOX. In order to investigate the loading efficiency of drugs in the preparation process of the nanosystem, a standard curve between the concentration of DOX in the solution and the absorbance at 480nm was established using doxorubicin hydrochloride standard, as shown in Fig.17 As shown. In the concentration range of 0-0.5 mM, the absorbance of DOX has a good linear relationship with the concentration.

[0172] The drug loading and encapsulation efficiency of the nanodisc drug delivery carrier are crucial for whether the carrier can carry enough drugs to reach tumor cells and play an effective killing effect. After the nanosystem was successfully constructed, the DOX absorbance of each system was measured, and the encapsulation rate and drug loading of each system were calculated according to the standard curve and formulas (3–1) and (3–2). Among them, the encapsulation rate of ND(GMT)@DOX-PA was 57.1%, and the drug loading was 2.90%, the encapsulation rate of ND(GM)@DOX-PA was 54.4%, and the drug loading was 2.76%, the encapsulation rate of ND(MT)@DOX-PA was 55.3%, and the drug loading was 2.81%, and the encapsulation rate of ND(MSP)@DOX-PA was 52.3%, and the drug loading was 2.65%. From the experimental data, it can be seen that there is no significant difference in the encapsulation rate and drug loading of the nanodisc drug delivery system formed by self-assembly of different fusion membrane skeleton proteins, which indicates that the modification of functional peptides TAT ​​and GE11 on the membrane skeleton protein has no obvious effect on the drug loading capacity of the carrier.

[0173] 2.4. Cell proliferation toxicity analysis:

[0174] In order to investigate the in vitro antitumor effect of the nanodisc drug delivery system, CCK-8 was used to detect the cytotoxicity of the nanosystems ND(GMT)@DOX-PA, ND(GM)@DOX-PA, ND(MT)@DOX-PA, ND(MSP)@DOX-PA and free drug DOX on A549 cells. Fig.18 As shown, from ( Fig.18 F) shows that the nanosystem and free DOX showed a dose-dependent inhibitory effect on the growth of A549 cells. At the same concentration, ND(GMT)@DOX-PA and free DOX had a more obvious inhibitory effect on the proliferation of A549 cells ( Fig.18 A, C), while other nanosystems showed lower inhibitory activity. In addition, the IC50 values ​​of ND(GMT)@DOX-PA and free DOX were 0.5024μM and 0.420μM, respectively, which were close to each other, while the IC50 values ​​of ND(GM)@DOX-PA, ND(MT)@DOX-PA, and ND(MSP)@DOX-PA were 1.058μM, 0.973μM, and 1.041μM, respectively. Fig.18 B, D, E), IC values ​​of free drug and ND(GMT)@DOX-PA 50 The value was about 2 times higher. ND(MT)@DOX-PA modified with cell-penetrating peptide TAT alone and ND(GM)@DOX-PA modified with EGFR targeting ligand GE11 alone showed similar inhibitory activity against A549 cells, indicating that the promotion of TAT on the transmembrane transport of nanodisc delivery vectors was comparable to that of GE11. The nanodisc delivery vector ND(GMT)@DOX-PA modified with TAT and GE11 showed an inhibitory activity about 2 times higher, which was comparable to that of free DOX. This indicates that the co-modification of TAT and GE11 can play a synergistic role. Free DOX showed higher inhibitory activity than the nanosystem, which may be because DOX in the solution does not need to be released from the nanosystem, but can directly enter the cells through passive diffusion and accumulate to toxic levels more quickly. In general, the modification of TAT and GE11 can promote the uptake of nanodisc delivery vectors by tumor cells, thereby improving the ability to inhibit the growth of tumor cells.

[0175] 2.5 Qualitative analysis of cellular uptake:

[0176] Taking advantage of the autofluorescence properties of DOX itself, the uptake of nanodisc delivery vectors and free DOX by A549 cells was investigated using confocal laser scanning microscopy. Fig.19As shown. When treated with free DOX and nanodisc drug delivery vehicles at the same drug concentration for the same time, the DOX channel of the free DOX group showed the lowest fluorescence intensity signal, indicating that the uptake of free DOX by A549 cells was much lower than that of the nanodisc drug delivery vehicle group, while the nanodisc drug delivery vehicle could effectively deliver the exogenous drug DOX into the cells, mainly distributed in the cytoplasm. The nanocarrier ND(GMT)@DOX-PA group modified with the cell-penetrating peptide TAT and the EGFR-targeting ligand GE11 showed the greatest fluorescence intensity, indicating that the co-modification of TAT and GE11 showed the greatest promotion effect on the uptake of the nanocarrier. 100μM free GE11 was co-incubated with the ND(GMT)@DOX-PA group to competitively bind to the EGFR receptor. The results showed that the uptake of ND(GMT)@DOX-PA by A549 cells was reduced, indicating that the modification of the GE11 peptide can promote the uptake of ND(GMT)@DOX-PA. The ND(MT)@DOX-PA group modified with TAT showed stronger fluorescence than the ND(GM)@DOX-PA group modified with GE11 and the ND(MSP)@DOX-PA group without functional peptide modification, indicating that TAT also promotes the uptake of nanocarriers, and the promoting effect of TAT is better than that of GE11. In addition, it can be observed that the fluorescence intensity of the ND(MT)@DOX-PA group is close to that of the ND(GMT)@DOX-PA group, which further indicates that TAT has a stronger promoting effect on the uptake of GE11, and that the uptake promoting effect of TAT is dominant in the uptake of ND(GMT)@DOX-PA. It is worth noting that the fluorescence intensity of the ND(GMT)@DOX-PA+GE11 group is weaker than that of the ND(GMT)@DOX-PA and ND(MT)@DOX-PA groups, indicating that the oversaturation of EGFR receptors on the surface of A549 cells by GE11 not only inhibits the promotion of GE11 on the nanocarrier in ND(GMT)@DOX-PA, but also inhibits the clathrin-dependent endocytosis mediated by EGFR under normal conditions, which also indirectly indicates that the nanocarrier ND(GMT)@DOX-PA has EGFR targeting. In general, according to the CLSM imaging results, the single modification or co-modification of the cell-penetrating peptide TAT and the EGFR targeting ligand GE11 has a promoting effect on the uptake of nanocarriers.

[0177] 2.6. Quantitative analysis of cellular uptake:

[0178] After the qualitative analysis by CLSM, the uptake of nanodisc drug delivery vectors and free DOX by A549 cells was investigated by flow cytometry. Fig. 20It can be seen from AE that the uptake of nanodisc drug delivery carriers and free DOX by A549 cells is time-dependent, and the uptake saturation state has not been reached after incubation for 10 hours. Fig. 20 F It can be seen that within the 0-10h incubation time scale, the uptake of the nanodisc drug delivery carrier and free DOX by A549 cells is continuous and uniform, but the uptake rate of the carrier is higher than that of free DOX, which is manifested in that the fluorescence intensity of the carrier group is higher than that of the free drug group in the same period of time, and the fluorescence intensity after 10h of incubation differs by nearly 5 times, indicating that the nanodisc delivery carrier is more aggregated in A549 cells. However, such uptake results seem to be contrary to the above CCK-8 experimental results, that is, the uptake of the nanodisc drug delivery carrier by A549 cells is higher than that of free DOX, while in the CCK-8 experiment, free DOX showed a lower IC than the nanodisc drug delivery carrier. 50 In fact, this may be because the DOX loaded into the nanodisc is a pH-responsive prodrug, which needs to release free DOX in an acidic environment to exert an effective growth inhibitory effect. In addition, flow cytometry cannot effectively distinguish whether the fluorophore molecule is inside the cell or adsorbed on the cell outer membrane when detecting cell uptake. Phospholipids are the main components of nanodisc delivery vehicles, which have a high degree of similarity with cell membranes and are easily adsorbed or fused with cell membranes. It is worth noting that in the time span of 0-10h, the nanocarrier ND(GMT)@DOX-PA modified with cell-penetrating peptide TAT and EGFR targeting ligand GE11 did not show faster or more cell uptake compared with other carriers. Only the TAT-modified nanocarrier ND(MT)@DOX-PA showed slightly more cell uptake compared with other nanocarrier groups. This may be because the relative content of positive charge in the fusion membrane skeleton protein MT is higher than that in the fusion membrane skeleton protein GMT, and the cell membrane itself is negatively charged, making the nanocarrier ND(MT)@DOX-PA easier to adsorb on the cell outer membrane rather than being effectively taken up into the cell. The nanocarrier ND(GMT)@DOX-PA can be effectively taken up into cells with the help of the uptake promotion effect of functional peptides TAT ​​and GE11, thus showing a good growth inhibitory effect on A549 cells (IC 50 =0.5024 μM). In the time span of 0-2h ( Fig. 20 G), although ND(GMT)@DOX-PA did not show better cell uptake than ND(MT)@DOX-PA in terms of fluorescence intensity, it can be seen that its cell uptake is better than that of ND(GM)@DOX-PA and ND(MSP)@DOX-PA groups, further indicating that the modification of TAT and GE11 functional peptides can promote cell uptake. The failure to maintain a good uptake rate in the subsequent period may be due to the saturation of EGFR receptor-mediated endocytosis.

[0179] In summary, this embodiment is based on the fusion membrane skeleton proteins GMT, GM, MT and MSP expressed and purified from the prokaryotic expression system to construct four nanodisc drug delivery carriers ND(GMT)@DOX-PA, ND(GM)@DOX-PA, ND(MT)@DOX-PA, ND(MSP)@DOX-PA with or without functional peptide modification. The particle size, morphology and encapsulation rate and drug loading were characterized successively. The results showed that the particle size of the nanodisc drug delivery carrier did not change significantly before and after drug loading, and was between 10-15nm. Its morphology shows a classic oblate disc structure, and the upper and lower surfaces of the disc are naturally stacked, which is a unique morphological sign of the nanodisc. Its encapsulation rate is between 50%-60%, and the drug loading is about 3%, which is slightly lower than the liposomes also composed of phospholipid bilayers. After completing the above characterization, the nanodisc drug delivery carrier was preliminarily evaluated for anti-tumor effects using non-small cell lung cancer cells A549 as a model. In terms of cellular uptake, the cellular uptake of the nanodisc drug delivery carrier was significantly better than that of free DOX, which indicates that the nanodisc-based drug delivery carrier can effectively promote the intracellular delivery of drugs. Although the carrier ND(GMT)@DOX-PA did not show better cellular uptake ability in the flow cytometry results, ND(GMT)@DOX-PA showed the highest tumor growth inhibition effect compared with other carriers, and its IC 50 The value is close to that of free DOX. This indicates that the experimental results of flow cytometry may not fully and accurately reflect the uptake of nanocarriers by A549 cells (part of the carriers may only be adsorbed outside the cell membrane). The experimental results of CCK-8, confocal and flow cytometry showed that the modification of cell penetrating peptide TAT and EGFR targeting ligand GE11 can promote the uptake of nanodisc drug delivery carriers by A549 cells and improve the anti-tumor effect of the carriers.

[0180] Based on Examples 1 and 2, it can be seen that the present invention obtains fusion membrane skeleton proteins GMT, GM, MT and MSP with the help of a prokaryotic expression system, and based on this, constructs nanodisc drug delivery carriers ND(GMT)@DOX-PA, ND(GM)@DOX-PA, ND(MT)@DOX-PA, ND(MSP)@DOX-PA, which are preliminarily characterized by means of a Malvern laser particle size analyzer and a transmission electron microscope, and then the nanocarriers are preliminarily evaluated at the cellular level using EGFR-overexpressing non-small cell lung cancer A549 cells. The experimental results show that the particle size of these four drug delivery carriers is between 10-15nm, and the morphology is an oblate disc-like structure, with the upper and lower surfaces often stacked on each other, an encapsulation rate between 50%-60%, and a drug loading of about 3%. Using A549 cells as a model, the nanodisc drug delivery carrier showed significantly improved cellular uptake compared to free DOX. In addition, the nanocarrier ND(GMT)@DOX-PA showed the highest tumor growth inhibition effect compared to other carriers, and its IC 50 The value is about 0.5 μM, which is close to that of free DOX. In general, the co-modification of cell-penetrating peptide TAT and EGFR-targeting ligand GE11 can improve the antitumor effect of nanodisc drug delivery vectors.

[0181] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions and variations of these embodiments are made without departing from the principles and spirit of the present invention, and still fall within the protection scope of the present invention.

Claims

1. A method for preparing a bifunctional peptide-modified nano drug delivery system, characterized in that: The following steps are involved: S1. The nucleotide sequence of the fusion membrane skeleton protein GMT shown in SEQ ID No: 5 is cloned into the pET28a(+) plasmid, and the plasmid is transformed into Escherichia coli BL21 for protein expression to obtain the fusion membrane skeleton protein GMT shown in SEQ ID No: 1; S2, adding doxorubicin hydrochloride and palmitic acid hydrazide to a solvent, mixing at room temperature in the dark, then adding trifluoroacetic acid, heating and refluxing, removing the solvent, and then redissolving, crystallizing, washing and drying to obtain the prodrug DOX-PA shown below; S3. The fusion membrane skeleton protein GMT prepared by S1 and the prodrug DOX-PA prepared by S2 are mixed in the form of a stock solution, and then msp buffer, sodium cholate stock solution and phospholipid stock solution are added. The obtained self-assembled mixed system is incubated at 41°C for 1-3 hours, and then beads are added for further incubation. After the incubation, the reaction system is separated from the beads, and then the encapsulated and unencapsulated drugs in the reaction system are separated to obtain a bifunctional peptide-modified nano drug delivery system.

2. The method for preparing a bifunctional peptide-modified nano drug delivery system according to claim 1, characterized in that: The mass ratio of doxorubicin hydrochloride to palmitic acid hydrazide in S1 is 5-6:7-8.

3. The method for preparing a bifunctional peptide-modified nano drug delivery system according to claim 1, characterized in that: The dosage ratio of doxorubicin hydrochloride to trifluoroacetic acid in S1 is 50-60 mg: 7-10 μL.

4. The method for preparing a bifunctional peptide-modified nano drug delivery system according to claim 1, characterized in that: S2 The temperature of the heating reflux reaction is 50-70°C and the time is 4-6h.

5. The method for preparing a bifunctional peptide-modified nano drug delivery system according to claim 1, characterized in that: In S3, the stock solution of the prodrug DOX-PA is a 15-25 mM DOX-PA solution in DMSO, and the stock solution of the fusion membrane skeleton protein GMT is a 400-600 μM GMT solution in sodium cholate.

6. The method for preparing a bifunctional peptide-modified nano drug delivery system according to claim 1, characterized in that: In S3, the encapsulated and unencapsulated drugs are separated by microcolumn centrifugation, and the microcolumn is a Sephadex G-50 microcolumn.

7. The method for preparing a bifunctional peptide-modified nano drug delivery system according to claim 1, characterized in that: In S3, beads were added twice with an interval of 1-3 h in between. After the last addition of beads, incubation was continued for 2-4 h to fully remove sodium cholate.

8. A bifunctional peptide modified nano drug delivery system prepared by the preparation method according to any one of claims 1 to 7.

9. Use of the bifunctional peptide modified nano drug delivery system according to claim 8 in the preparation of anti-tumor preparations.

10. The use according to claim 1, characterized in that: The tumors include non-small cell lung cancer.

Images